Additions to the Pacific Fauna of Haplomunnidae (Isopoda: Asellota) with Descriptions of Three New Species from the Kuril–Kamchatka Trench Region †
Abstract
1. Introduction
2. Material and Methods
2.1. Material Sampling
2.2. Material Processing and Species Description
2.3. Molecular Analysis
3. Results
3.1. Taxonomy
3.1.1. Genus Abyssaranea Wilson and Hessler, 1974
3.1.2. Genus Haplomunna Richardson, 1908
3.1.3. Genus Thylakogaster Wilson and Hessler, 1974
3.2. Molecular Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wilson, G.D.F. The systematics and evolution of Haplomunna and its relatives (Isopoda, Haplomunnidae, new family). J. Nat. Hist. 1976, 10, 569–580. [Google Scholar] [CrossRef]
- Cunha, M.R.; Wilson, G.D.F. Haplomunnidae (Crustacea: Isopoda) reviewed, with a ddescription of an intact specimen of Thylakogaster Wilson & Hessler, 1974. Zootaxa 2003, 326, 1–16. [Google Scholar] [CrossRef]
- Raupach, M.J.; Mayer, C.; Malyutina, M.; Wägele, J.W. Multiple origins of deep-sea Asellota (Crustacea: Isopoda) from shallow waters revealed by molecular data. Proc. R. Soc. B Biol. Sci. 2009, 276, 799–808. [Google Scholar] [CrossRef]
- Brökeland, W.; Brandt, A. Two new species of Ischnomesidae (Crustacea: Isopoda) from the Southern Ocean displaying neoteny. Deep Res. Part II Top. Stud. Oceanogr. 2004, 51, 1769–1785. [Google Scholar] [CrossRef]
- Golovan, O.A.; Malyutina, M.V. A new deep-sea genus of Paramunnidae (Isopoda: Asellota) from the Northwest Pacific adjacent to the Kuril-Kamchatka Trench with remarks on paedomorphosis in deep-sea species. Prog. Oceanogr. 2019, 178, 102200. [Google Scholar] [CrossRef]
- Wilson, G. Compensation improvements in RC-active integrators. IEEE Proc. Part G Electron. Circuits Syst. 1989, 136, 1–8. [Google Scholar] [CrossRef]
- Thistle, D.; Wilson, G.D.F. A Hydrodynamically modified, abyssal isopod fauna. Deep Res. Part I Oceanogr. Res. Pap. 1987, 34, 73–87. [Google Scholar] [CrossRef]
- Beaulieu, S.E. Colonization of habitat islands in the deep sea: Recruitment to glass sponge stalks. Deep Res. Part I Oceanogr. Res. Pap. 2001, 48, 1121–1137. [Google Scholar] [CrossRef]
- Wilson, G.D.F.; Hessler, R.R. Some unusual Paraselloidea (Isopoda, Asellota) from the deep benthos of the Atlantic. Crustaceana 1974, 27, 47–67. [Google Scholar] [CrossRef]
- Gamô, S. Some species of abyssal Asellote isopods (Crustacea) from ast of the Japan Trench, with the descriptions of Janirella (Janirella) aculeata sp. nov., J. (Parajanirella) sedecimtuberculata sp. nov., and Aryballurops japonica gen. et sp. nov. Sci. Rep. Yokohama Natl. Univ. II 1983, 30, 1–18. [Google Scholar]
- Just, J. Haplodendron buzwilsoni gen. nov., sp. nov., the first record of Haplomunnidae from the southern Indo-Pacific (Isopoda: Asellota). Zootaxa 2003, 372, 1–10. [Google Scholar] [CrossRef]
- Boyko, C.B.; Bruce, N.L.; Hadfield, K.A.; Merrin, K.L.; Ota, Y.; Poore, G.C.B.; Taiti, S.; Schotte, M.; Wilson, G.D.F. World Marine, Freshwater and Terrestrial Isopod Crustaceans Database. Available online: http://www.marinespecies.org/aphia.php?p=taxdetails&id=118327 (accessed on 2 June 2023).
- Brenke, N.; Buschmann, A. Thylakogaster namibiensis sp. nov. (Isopoda: Asellota: Janiroidea), a new species of Haplomunnidae from the southeast Atlantic deep sea. Zootaxa 2009, 394, 381–394. [Google Scholar] [CrossRef]
- Elsner, N.O.; Malyutina, M.V.; Golovan, O.A.; Brenke, N.; Riehl, T.; Brandt, A. Deep down: Isopod biodiversity of the Kuril-Kamchatka abyssal area including a comparison with data of previous expeditions of the RV Vityaz. Deep Res. Part II Top. Stud. Oceanogr. 2015, 111, 210–219. [Google Scholar] [CrossRef]
- Golovan, O.A.; Błażewicz, M.; Brandt, A.; Jażdżewska, A.; Jóźwiak, P.; Lavrenteva, A.V.; Malyutina, M.V.; Petryashov, V.V.; Riehl, T.; Sattarova, V.V. Diversity and distribution of peracarid crustaceans (Malacostraca) from the abyss adjacent to the Kuril-Kamchatka Trench. Mar. Biodivers. 2019, 49, 1343–1360. [Google Scholar] [CrossRef]
- Brandt, A.; Elsner, N.; Brenke, N.; Golovan, O.; Malyutina, M.V.; Riehl, T.; Schwabe, E.; Würzberg, L. Epifauna of the Sea of Japan collected via a new epibenthic sledge equipped with camera and environmental sensor systems. Deep Res. Part II Top. Stud. Oceanogr. 2013, 86–87, 43–55. [Google Scholar] [CrossRef]
- Brandt, A.; Elsner, N.O.; Malyutina, M.V.; Brenke, N.; Golovan, O.A.; Lavrenteva, A.V.; Riehl, T. Abyssal macrofauna of the Kuril-Kamchatka Trench Area (Northwest Pacific) collected by means of a camera-epibenthic sledge. Deep Res. Part II Top. Stud. Oceanogr. 2015, 111, 175–187. [Google Scholar] [CrossRef]
- Golovan, O.A.; BŁazewicz-Paszkowycz, M.; Brandt, A.; Budnikova, L.L.; Elsner, N.O.; Ivin, V.V.; Lavrenteva, A.V.; Malyutina, M.V.; Petryashov, V.V.; Tzareva, L.A. Diversity and distribution of peracarid crustaceans (Malacostraca) from the continental slope and the deep-sea basin of the Sea of Japan. Deep Res. Part II Top. Stud. Oceanogr. 2013, 86–87, 66–78. [Google Scholar] [CrossRef]
- Brandt, A.; Alalykina, I.; Fukumori, H.; Golovan, O.; Kniesz, K.; Lavrenteva, A.; Lörz, A.N.; Malyutina, M.; Philipps-Bussau, K.; Stransky, B. First insights into macrofaunal composition from the SokhoBio expedition (Sea of Okhotsk, Bussol Strait and northern slope of the Kuril-Kamchatka Trench). Deep Res. Part II Top. Stud. Oceanogr. 2018, 154, 106–120. [Google Scholar] [CrossRef]
- Janssen, A.; Kaiser, S.; Meißner, K.; Brenke, N.; Menot, L.; Arbizu, P.M. A reverse taxonomic approach to assess macrofaunal distribution patterns in abyssal Pacific polymetallic nodule fields. PLoS ONE 2015, 10, e0117790. [Google Scholar] [CrossRef]
- Raupach, M.J.; Held, C.; Wägele, J.W. Multiple colonization of the deep sea by the Asellota (Crustacea: Peracarida: Isopoda). Deep Res. Part II Top. Stud. Oceanogr. 2004, 51, 1787–1795. [Google Scholar] [CrossRef]
- Golovan, O.A.; Malyutina, M.V. The first record of the family Paramunnidae (Isopoda: Asellota) from the bathyal of the Bering Sea with descriptions of two new species of Munnogonium. Deep Res. Part II Top. Stud. Oceanogr. 2022, 200, 105095. [Google Scholar] [CrossRef]
- Malyutina, M.V.; Golovan, O.A. The first record of Asellota (Isopoda) from hydrothermal vent biotopes of the submarine Piip Volcano, Bering Sea, with descriptions of two new species of Munnopsidae. Deep Res. Part II Top. Stud. Oceanogr. 2022, 202, 105137. [Google Scholar] [CrossRef]
- Riehl, T.; Wölfl, A.C.; Augustin, N.; Devey, C.W.; Brandt, A. Discovery of widely available abyssal rock patches reveals overlooked habitat type and prompts rethinking deep-sea biodiversity. Proc. Natl. Acad. Sci. USA 2020, 117, 15450–15459. [Google Scholar] [CrossRef] [PubMed]
- Kireev, P.A.; Golovan, O.A.; Sharina, S.N. First record of the family Caprellidae (Amphipoda: Senticaudata) from the abyssal zone of the Bering Sea with description of a new species of Cercops. Deep Res. Part II Top. Stud. Oceanogr. 2023, 208, 105238. [Google Scholar] [CrossRef]
- Gamô, S. Systematic study on the benthic small Crustaceans in the Japan Trench and its vicinity. In Preliminary Report of the Hakuho Maru Cruise KH-81-4. 6 July–4 August 1981. Japan Trench (WESTPAC); Ocean Research Institute, University of Tokyo: Tokyo, Japan, 1988; pp. 44–53. [Google Scholar]
- Richardson, H. A Monograph on the isopods of North America. Bull. U. S. Natl. Museum 1905, 54, 1–517. [Google Scholar] [CrossRef]
- Brandt, A.; Malyutina, M.V. The German-Russian deep-sea expedition KuramBio (Kurile Kamchatka biodiversity studies) on board of the RV Sonne in 2012 following the footsteps of the legendary expeditions with RV Vityaz. Deep Res. Part II Top. Stud. Oceanogr. 2015, 111, 1–9. [Google Scholar] [CrossRef]
- Malyutina, M.V.; Chernyshev, A.V.; Brandt, A. Introduction to the SokhoBio (Sea of Okhotsk biodiversity studies) expedition 2015. Deep Res. Part II Top. Stud. Oceanogr. 2018, 154, 1–9. [Google Scholar] [CrossRef]
- Golovan, O.A.; Malyutina, M.V.; Brandt, A. First record of the deep-sea isopod family Dendrotionidae (Isopoda: Asellota) from the Northwest Pacific with description of two new species of Dendromunna. Mar. Biodivers. 2018, 48, 531–544. [Google Scholar] [CrossRef]
- Hessler, R.R. The Desmosomatidae (Isopoda, Asellota) of the Gay Head-Bermuda Transect; University of California Press: Berkeley, CA, USA, 1970; Volume 15, ISBN 0520093194. [Google Scholar]
- Walsh, P.S.; Metzger, D.A.; Higuchi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 1991, 10, 506–513. [Google Scholar] [CrossRef]
- Giribet, G.; Carranza, S.; Baguna, J.; Riutort, M.; Ribera, C. First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Mol. Biol. Evol. 1996, 13, 76–84. [Google Scholar] [CrossRef]
- Whiting, M.F.; Carpenter, J.C.; Wheeler, Q.D.; Wheeler, W.C. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Syst. Biol. 1997, 46, 1–68. [Google Scholar] [CrossRef]
- Distel, D.L. Phylogenetic relationships among Mytilidae (Bivalvia): 18S rRNA data suggest convergence in mytilid body plans. Mol. Phylogenet. Evol. 2000, 15, 25–33. [Google Scholar] [CrossRef]
- Olson, P.D.; Cribb, T.H.; Tkach, V.V.; Bray, R.A.; Littlewood, D.T.J. Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). Int. J. Parasitol. 2003, 33, 733–755. [Google Scholar] [CrossRef]
- Williams, S.T.; Reid, D.G.; Littlewood, D.T.J. A molecular phylogeny of the Littorininae (Gastropoda: Littorinidae): Unequal evolutionary rates, morphological parallelism, and biogeography of the Southern Ocean. Mol. Phylogenet. Evol. 2003, 28, 60–86. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. JModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; IEEE: Piscataway, NJ, USA, 2010; pp. 1–8. [Google Scholar]
- Rambaut, A. FigTree 1.4.4 – Produce Figures of Phylogenetic Trees. 2012, pp. 1–8. Available online: https://mybiosoftware.com/figtree-1-3-1-produce-figures-phylogenetic-trees.html (accessed on 2 June 2023).
- Belyaev, G.M. The Deep-Sea Ocean Trenches and Their Fauna; Nauka: Moskow, Russia, 1989. [Google Scholar]
- Jennings, R.M.; Golovan, O.; Brix, S. Integrative species delimitation of desmosomatid and nannoniscid isopods from the Kuril-Kamchatka Trench, with description of a hadal species. Prog. Oceanogr. 2020, 182, 102236. [Google Scholar] [CrossRef]
- Brix, S.; Svavarsson, J. Distribution and diversity of desmosomatid and nannoniscid isopods (Crustacea) on the Greenland-Iceland-Faeroe Ridge. Polar Biol. 2010, 33, 515–530. [Google Scholar] [CrossRef]
- Jennings, R.M.; Etter, R.J.; Ficarra, L. Population differentiation and species formation in the deep sea: The potential role of environmental gradients and depth. PLoS ONE 2013, 8, e77594. [Google Scholar] [CrossRef]
- Havermans, C.; Sonet, G.; d’Udekem d’Acoz, C.; Nagy, Z.T.; Martin, P.; Brix, S.; Riehl, T.; Agrawal, S.; Held, C. Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE 2013, 8, e74218. [Google Scholar] [CrossRef] [PubMed]
- Brix, S.; Svavarsson, J.; Leese, F. A Multi-gene analysis reveals multiple highly divergent lineages of the isopod Chelator insignis (Hansen, 1916) South of Iceland. Pol. Polar Res. 2014, 35, 225–242. [Google Scholar] [CrossRef]
- Bober, S.; Riehl, T.; Henne, S.; Brandt, A. New Macrostylidae (Isopoda) from the Northwest Pacific Basin described by means of integrative taxonomy with reference to geographical barriers in the abyss. Zool. J. Linn. Soc. 2018, 182, 549–603. [Google Scholar] [CrossRef]
- Bober, J.; Brandt, A.; Frutos, I.; Schwentner, M. Diversity and distribution of Ischnomesidae (Crustacea: Isopoda: Asellota) along the Kuril-Kamchatka Trench—A genetic perspective. Prog. Oceanogr. 2019, 178, 102174. [Google Scholar] [CrossRef]
- Johannsen, N.; Lins, L.; Riehl, T.; Brandt, A. Changes in species composition of Haploniscidae (Crustacea: Isopoda) across potential barriers to dispersal in the Northwest Pacific. Prog. Oceanogr. 2020, 180, 102233. [Google Scholar] [CrossRef]
- Knauber, H.; Silberberg, J.R.; Brandt, A.; Riehl, T. Evolution and biogeography of the Haploniscus belyaevi species complex (Isopoda: Haploniscidae) revealed by means of integrative taxonomy. Syst. Biodivers. 2022, 20, 1–27. [Google Scholar] [CrossRef]
- Golovan, O.A. Desmosomatidae (Isopoda: Asellota) from the abyssal plain to the east of the Kuril-Kamchatka Trench: New data on diversity with the description of two new species. Deep Res. Part II Top. Stud. Oceanogr. 2015, 111, 256–278. [Google Scholar] [CrossRef]
- Golovan, O.A. Description of two ubiquitous species of Desmosomatidae (Isopoda: Asellota) from the Northwest Pacific Basin east of the Kuril-Kamchatka Trench. Zootaxa 2015, 4039, 201–224. [Google Scholar] [CrossRef]
- Riehl, T.; Kühn, M.A.L. Uniting what belongs together—Reevaluation of the isopod species Macrostylis grandis and M. ovata using ontogenetic, morphological and genetic evidence. Prog. Oceanogr. 2020, 181, 102238. [Google Scholar] [CrossRef]
- Malyutina, M.V.; Brandt, A. Munnopsidae (Crustacea, Isopoda, Asellota) from the Kuril–Kamchatka Trench with a regional and inter-ocean comparison of their biogeographic and richness patterns. Prog. Oceanogr. 2020, 183, 102289. [Google Scholar] [CrossRef]
- Elsner, N.O.; Golovan, O.A.; Malyutina, M.V.; Brandt, A. Alone in the dark: Distribution, population structure and reproductive mode of the dominant isopod Eurycope spinifrons Gurjanova, 1933 (Isopoda: Asellota: Munnopsidae) from bathyal and abyssal depths of the Sea of Japan. Deep Res. Part II Top. Stud. Oceanogr. 2013, 86–87, 103–110. [Google Scholar] [CrossRef]
- Riehl, T.; Wilson, G.D.F.; Hessler, R.R. New Macrostylidae Hansen, 1916 (Crustacea: Isopoda) from the Gay Head-Bermuda Transect with special consideration of sexual dimorphism. Zootaxa 2012, 3277, 1–26. [Google Scholar] [CrossRef]
- Kim, J.; Kim, J.; Lee, W.; Karanovic, I. Two new Uromunna species (Isopoda: Asellota: Munnidae) from the Korean Peninsula and their phylogenetic position within munnoid groups. Diversity 2022, 15, 20. [Google Scholar] [CrossRef]
Station | Date | Depth, m | Haul Start | Haul End |
---|---|---|---|---|
KB 223-5-9 | 11 August 2012 | 5376–5380 | 43.5913° N 153.9647° E | 43.5717° N 153.9693° E |
KB 223-7-9 | 17 August 2012 | 5222–5223 | 43.0473° N 152.9905° E | 43.0248° N 152.9727° E |
KB 223-8-9 | 20 August 2012 | 5125–5126 | 42.2447° N 151.7351° E | 42.2378° N 151.7082° E |
SO 10-6 | 29 July 2015 | 4769–4798 | 46.10045° N 152.24065° E | 46.097117° N 152.242933° E |
Name | Sequence 5′ → 3′ | Source | |
---|---|---|---|
18S | 18S-5′(F) | CTGGTTGATYCTGCCAGT | [33] |
4R | GAATTACCGCGGCTGCTGG | [33] | |
3F | GTTCGATTCCGGAGAGGGA | [33] | |
18Sbi | CTAGAGTCTCGTTCGTTATCGG | [34] | |
18S-a2.0 | ATGGTTGCAAAGCTGAAA | [34] | |
1789R | GATCCTTCYGCAGGTTCACCTAC | [35] | |
28S | 900-F | CCGTCTTGAAACACGGACCAAG | [36] |
LSU1600-R | AGCGCCATCCATTTTCAGG | [37] |
Species | Sample | Station | Museum Number | 18s Accession | 28s Accession |
---|---|---|---|---|---|
Abyssaranea minuta sp. nov. | female, pereopod | KB 223-8-9 | SMF 61310 | fail | fail |
Haplomunna kurilensis sp. nov. | male, pereopod | KB 223-5-9 | SMF 61313 | ||
Haplomunna kurilensis sp. nov. | manca, whole | KB 223-7-9 | MIMB 46614 | ||
Haplomunna cf. kurilensis sp. nov. | manca, pereopod | SO 10-6 | MIMB 46616 | fail | fail |
Thylakogaster wilsoni sp. nov. | manca, whole | KB 223-8-9 | SMF 61315 | ||
Thylakogaster wilsoni sp. nov. | manca, whole | KB 223-7-9 | SMF 61316 |
Station | Species | Specimens | Number |
---|---|---|---|
KB 223-5-9 | Haplomunna kurilensis sp. nov. | 1 male | 1 |
KB 223-7-9 | Haplomunna kurilensis sp. nov. | 5 males, 1 female, 12 mancas, 1 damaged | 19 |
KB 223-7-9 | Thylakogaster wilsoni sp. nov. | 2 mancas | 2 |
KB 223-8-9 | Abyssaranea minuta sp. nov. | 1 female | 1 |
KB 223-8-9 | Thylakogaster wilsoni sp. nov. | 3 females, 1 manca | 4 |
SO 10-6 | Haplomunna cf. kurilensis sp. nov. | 1 manca | 1 |
Family | 1 | 2 | 3 | 4 | |
---|---|---|---|---|---|
1 | Haplomunnidae | 0.0038 | 0.0048 | 0.0067 | |
2 | Dendrotionidae | 0.0488 | 0.0044 | 0.0065 | |
3 | Janiridae | 0.0564 | 0.0644 | 0.0066 | |
4 | Munnidae | 0.1097 | 0.1218 | 0.1027 |
1 | 2 | 3 | 4 | 5 | 6 | 7 | ||
---|---|---|---|---|---|---|---|---|
1 | Thylakogaster wilsoni sp. nov. | 0.0000 | 0.0017 | 0.0017 | 0.0025 | 0.0030 | 0.0030 | |
2 | Thylakogaster wilsoni sp. nov. | 0.0000 | 0.0017 | 0.0017 | 0.0025 | 0.0030 | 0.0030 | |
3 | Thylakogaster sp.2EU414425 | 0.0053 | 0.0053 | 0.0000 | 0.0024 | 0.0029 | 0.0028 | |
4 | Thylakogaster sp.2EU414424 | 0.0053 | 0.0053 | 0.0000 | 0.0024 | 0.0029 | 0.0028 | |
5 | Thylakogaster sp.1AY461470 | 0.0129 | 0.0129 | 0.0111 | 0.0111 | 0.0031 | 0.0034 | |
6 | Haplomunna kurilensis sp. nov. | 0.0175 | 0.0175 | 0.0164 | 0.0164 | 0.0216 | 0.0013 | |
7 | Haplomunna kurilensis sp. nov. | 0.0181 | 0.0181 | 0.0158 | 0.0158 | 0.0234 | 0.0029 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Golovan, O.A.; Malyutina, M.V.; Sharina, S.N. Additions to the Pacific Fauna of Haplomunnidae (Isopoda: Asellota) with Descriptions of Three New Species from the Kuril–Kamchatka Trench Region. Diversity 2023, 15, 850. https://doi.org/10.3390/d15070850
Golovan OA, Malyutina MV, Sharina SN. Additions to the Pacific Fauna of Haplomunnidae (Isopoda: Asellota) with Descriptions of Three New Species from the Kuril–Kamchatka Trench Region. Diversity. 2023; 15(7):850. https://doi.org/10.3390/d15070850
Chicago/Turabian StyleGolovan, Olga A., Marina V. Malyutina, and Svetlana N. Sharina. 2023. "Additions to the Pacific Fauna of Haplomunnidae (Isopoda: Asellota) with Descriptions of Three New Species from the Kuril–Kamchatka Trench Region" Diversity 15, no. 7: 850. https://doi.org/10.3390/d15070850
APA StyleGolovan, O. A., Malyutina, M. V., & Sharina, S. N. (2023). Additions to the Pacific Fauna of Haplomunnidae (Isopoda: Asellota) with Descriptions of Three New Species from the Kuril–Kamchatka Trench Region. Diversity, 15(7), 850. https://doi.org/10.3390/d15070850