Uncertainties in Systematics of Flying Squirrels (Pteromyini, Rodentia): Implications from a New Record from Vietnam
Abstract
1. Introduction
2. Materials and Methods
Molecular Studies
3. Results
3.1. Morphological Comparison
- -
- the nasofrontal suture is W-shaped (Figure 4) in the type of P. setosus while being nearly transverse (or slightly M-shaped) in the Song Hinh specimen.
- -
- the coronal suture is markedly V-shaped in the type of P. setosus but is transverse in the Song Hinh specimen.
- -
- in the type of P. setosus the number of visible septa in bulla tympani is five, however the position of septae is different from the Song Hinh specimen with the second septa placed more anteriorly in the former; additionally, bullae appear more inflated in the Song Hinh specimen.
- -
- the ratio of interorbital width to postorbital width is 0.77 (6.9/8.9 mm) in the type of P. setosus compared to 0.64 (7.0/11.0 mm) in the Song Hinh specimen (this ratio is 0.61/0.69 in P. setosus specimens studied by [35]).
- -
- the rostrum is relatively wider in the type of P. setosus, with the maximum width of nasals reaching 5.0 mm (versus 4.59 mm in the Song Hinh specimen); the ratio of nasal length to nasal width in the type is 1.25, which is smaller than in the Song Hinh specimen (1.51) or in the sample examined by [16] (1.58–1.73) It should be noted that, in the Laotian specimen [16], the shape of sutures and cranial proportions are similar to those in the Song Hinh specimen. Meantime, it is worth mentioning that the auditory bullae septa pattern in Laotian specimen was reported as a “honeycomb”, which contradicts both our specimen and the characteristics of Petinomys setosus as a whole (see [23,24,35]). We only may suggest that the “honeycombs” observed in the Laotian animal represents some artifact of the bullae wall and do not reflect the actual number of septa.
3.2. Molecular Phylogeny
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abramov, A.V.; Balakirev, A.E.; Rozhnov, V.V. An enigmatic pygmy dormouse: Molecular and morphological evidence for the species taxonomic status of Typhlomys chapensis (Rodentia: Platacanthomyidae). Zool. Stud. 2014, 53, 34. [Google Scholar] [CrossRef]
- Kruskop, S.V.; Vasenkov, D.A. Significant range extension of two uncommon South-East Asian bat species. Mammal Study 2016, 41, 35–41. [Google Scholar] [CrossRef]
- Fukui, D.; Tu, V.T.; Thanh, H.T.; Arai, S.; Harada, M.; Csorba, G.; Son, N.T. First record of the genus Plecotus from Southeast Asia with notes on the taxonomy, karyology and echolocation call of P. homochrous from Vietnam. Acta Chiropt. 2020, 2, 57–74. [Google Scholar] [CrossRef]
- Kawada, S.; Nguyen, T.S.; Can, D.N. A new species of mole of the genus Euroscaptor (Soricomorpha, Talpidae) from northern Vietnam. J. Mammal. 2012, 93, 850–893. [Google Scholar] [CrossRef]
- Balakirev, A.E.; Abramov, A.V.; Rozhnov, V.V. Phylogenetic relationships in the Niviventer-Chiromyscus complex (Rodentia, Muridae) inferred from molecular data, with description of a new species. ZooKeys 2014, 451, 109–136. [Google Scholar] [CrossRef] [PubMed]
- Balakirev, A.E.; Abramov, A.V.; Rozhnov, V.V. The phylogeography of red spiny rats Maxomys surifer (Rodentia, Muridae) in Indochina with comments on taxonomy and description of new subspecies. Zool. Stud. 2017, 56, 6. [Google Scholar] [CrossRef]
- Zemlemerova, E.D.; Bannikova, A.A.; Lebedev, V.S.; Rozhnov, V.V.; Abramov, A.V. Secrets of the underground Vietnam: An underestimated species diversity of Asian moles (Lipotyphla: Talpidae: Euroscaptor). Procs. Zool. Inst. RAS 2016, 320, 193–220. [Google Scholar] [CrossRef]
- Abramov, A.V.; Balakirev, A.E.; Rozhnov, V.V. New insights into the taxonomy of the marmoset rats Hapalomys (Rodentia: Muridae). Raffles Bull. Zool. 2017, 65, 20–28. [Google Scholar]
- Son, N.T.; Csorba, G.; Tu, V.T.; Thong, V.D.; Wu, Y.; Harada, M.; Oshida, T.; Endo, H.; Motokawa, M. A new species of the genus Murina (Chiroptera: Vespertilionidae) from the Central Highlands of Vietnam with a review of the subfamily Murininae in Vietnam. Acta Chiropt. 2015, 17, 201–232. [Google Scholar] [CrossRef]
- Son, N.T.; Oshida, T.; Phuong, H.D.; Hai, T.B.; Motokawa, M. A new species of squirrel (Sciuridae: Callosciurus) from an isolated island off the Indochina Peninsula in southern Vietnam. J. Mammal. 2018, 99, 813–825. [Google Scholar] [CrossRef]
- Görföl, T.; Kruskop, S.V.; Vuong, T.T.; Estók, P.; Son, N.T.; Csorba, G. A new genus of vespertilionid bat: The end of a long journey for Joffre’s Pipistrelle (Chiroptera: Vespertilionidae). J. Mammal. 2020, 101, 331–348. [Google Scholar] [CrossRef]
- Koprowski, J.L.; Goldstein, E.A.; Bennett, K.R.; Mendes, C.P. Family Sciuridae (tree, flying and ground squirrels, chipmunks, marmots and prairie dogs). In Handbook of the Mammals of the World: Lagomorphs and Rodents I; Wilson, D.E., Mittermeier, R.A., Ruff, S., Martínez-Vilalta, A., Cavallini, P., Eds.; Lynx Editions: Barcelona, Spain, 2016; pp. 648–837. [Google Scholar]
- Sanamxay, D.; Douangboubpha, B.; Bumrungsri, S.; Xayavong, S.; Xayaphet, V.; Satasook, C.; Bates, P.J.J. Rediscovery of Biswamoyopterus (Mammalia: Rodentia: Sciuridae: Pteromyini) in Asia, with the description of a new species from Lao PDR. Zootaxa 2013, 3686, 471–481. [Google Scholar] [CrossRef]
- Li, Q.; Li, X.Y.; Jackson, S.M.; Li, F.; Jiang, M.; Zhao, W.; Song, W.-Y.; Jiang, X.-L. Discovery and description of a mysterious Asian flying squirrel (Rodentia, Sciuridae, Biswamoyopterus) from Mount Gaoligong, southwest China. ZooKeys 2019, 864, 147–160. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Cheng, F.; Jackson, S.M.; Helgen, K.M.; Song, W.-Y.; Liu, S.-Y.; Sanamxay, D.; Li, S.; Li, F.; Xiong, Y.; et al. Phylogenetic and morphological significance of an overlooked flying squirrel (Pteromyini, Rodentia) from the eastern Himalayas with the description of a new genus. Zool. Res. 2021, 42, 389–400. [Google Scholar] [CrossRef]
- Sanamxay, D.; Douangboubpha, B.; Xayaphet, V.; Paphaphanh, P.; Oshida, T.; Motokawa, M. First record of Petinomys setosus (Rodentia: Sciuridae: Pteromyini) from Lao PDR. Mammal Study 2019, 44, 141–146. [Google Scholar] [CrossRef]
- Lunde, D.P.; Son, N.T. An Identification Guide to the Rodents of Vietnam; Center for Biodiversity and Conservation, American Mustum Of Natural History: New York, NY, USA, 2001; pp. 1–80. [Google Scholar]
- Can, D.N.; Endo, H.; Son, N.T.; Oshida, T.; Canh, L.X.; Phuong, D.H.; Lunde, D.P.; Kawada, S.-I.; Hayashida, A.; Sasaki, M. Checklist of Wild Mammal Species of Vietnam; Institute of Ecology and Biological Resources: Hanoi, Vietnam, 2008; pp. 1–400. [Google Scholar]
- Oshida, T.; Lin, L.-K.; Chang, S.-W.; Can, N.D.; Son, N.T.; Nghia, X.N.; Dang, X.N.; Endo, H.; Kimura, J.; Sasaki, M.; et al. Mitochondrial DNA Evidence Suggests Challenge to the Conspecific Status of the Hairy-Footed Flying Squirrel Belomys pearsonii from Taiwan and Vietnam. Mammal Study 2015, 40, 29–33. [Google Scholar] [CrossRef]
- Jackson, S.M.; Schouten, P. Gliding Mammals of the World; CSIRO Publishing: Melbourne, Australia, 2012; pp. 1–232. [Google Scholar]
- Francis, C.M. Field Guide to the Mammals of South-East Asia, 2nd ed.; Bloomsbury Wildlife: London, UK, 2019; pp. 1–416. [Google Scholar]
- Clayton, E. Petinomys setosus. The IUCN Red List of Threatened Species 2016: e.T16739A22241609. 2016. Available online: https://www.iucnredlist.org/species/16739/22241609 (accessed on 1 April 2022).
- Lord, M. The Wild Mammals of Malaya (Peninsular Malaysia) and Singapore, 2nd ed.; Oxford University Press: Kuala Lumpur, Malaysia, 1978; pp. 1–127. [Google Scholar]
- Corbet, G.B.; Hill, J.E. The Mammals of the Indomalayan Region: A Systematic Review; Oxford University Press: New York, NY, USA, 1992; pp. 1–307. [Google Scholar]
- Sikes, R.S.; Gannon, W.L.; The Animal Care and Use Committee of the American Society of Mammalogists. Guidelines of the American Society of Mammalogists for the use of wild mammals in research and education. J. Mammal. 2016, 97, 663–688. [Google Scholar] [CrossRef] [PubMed]
- Hayashida, A.; Endo, H.; Sasaki, M.; Oshida, T.; Kimura, J.; Waengsothorn, S.; Kitamura, N.; Yamada, J. Geographical variation in skull morphology of gray-bellied squirrel Callosciurus caniceps. J. Vet. Med. Sci. 2006, 69, 149–157. [Google Scholar] [CrossRef][Green Version]
- Yang, D.Y.; Eng, B.; Waye, J.S.; Dudar, J.C.; Saunders, S.R. Technical note: Improved DNA extraction from ancient bones using silica-based spin columns. Am. J. Phys. Anthropol. 1998, 105, 539–543. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Minh, B.Q.; Nguyen, M.A.T.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [PubMed]
- Mercer, J.M.; Roth, V.L. The effects of Cenozoic global change on squirrel phylogeny. Science 2003, 299, 1568–1572. [Google Scholar] [CrossRef]
- Li, G.G.; Lwin, Y.H.; Yang, B.; Qin, T.; Phothisath, P.; Maung, K.W.; Quan, R.-C.; Li, S. Taxonomic revision and phylogenetic position of the flying squirrel genus Biswamoyopterus (Mammalia, Rodentia, Sciuridae, Pteromyini) on the northern Indo-China peninsula. ZooKeys 2020, 939, 65–85. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP*—Phylogenetic Analysis Using Parsimony (*and Other Methods), 4th ed.; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
- Muul, I.; Thonglongya, K. Taxonomic status of Petinomys morrisi (Carter) and its relationship to Petinomys setosus (Temminck and Schlegel). J. Mammal. 1971, 52, 362–369. [Google Scholar] [CrossRef] [PubMed]
- Thorington, R.W., Jr.; Koprowski, J.L.; Steele, M.A.; Whatton, J.F. Squirrels of the World; The Johns Hopkins University Press: Baltimore, MD, USA, 2012; pp. 1–459. [Google Scholar]
- Carter, T.D. Three new mammals of the genera Crocidura, Callosciurus and Pteromys from northern Burma. Am. Mus. Novit. 1942, 1208, 1–2. [Google Scholar]
- Oshida, T.; Yoshida, M.C. A note on the chromosomes of the white-bellied flying squirrel Petinomys setosus (Rodentia, Saciuridae). Chromosome Sci. 1998, 2, 119–121. [Google Scholar]
- Oshida, T.; Lin, L.-K.; Yanagawa, H.; Endo, H.; Masuda, R. Phylogenetic relationships among six flying squirrel genera, inferred from mitochondrial cytochrome b gene sequences. Zool. Sci. 2000, 17, 485–489. [Google Scholar] [CrossRef]
- Ellerman, J.R.; Morrison-Scott, T.C.S. Checklist of Palaearctic and Indian Mammals 1758 to 1946; British Museum (Natural History): London, UK, 1951; pp. 1–810. [Google Scholar]
- McKenna, M.C. Eupetaurus and the living Petauristine Sciurids. Am. Mus. Novit. 1962, 2104, 1–38. [Google Scholar]
- Mein, P. Les sciuropteres (Mammalia, Rodentia) neogenes d’Europe occidentale. Geobios 1970, 3, 7–77, (In French with English Abstract). [Google Scholar] [CrossRef]
- Jackson, S.M.; Thorington, R.W. Gliding Mammals: Taxonomy of Living and Extinct Species. In Smithsonian Contributions to Zoology; Smithsonian Institution Press: Washington, DC, USA, 2012; pp. 1–117. [Google Scholar]







| Primers | Sequence (5′→3′) | Reference |
|---|---|---|
| IRBP—interphotoreceptor retinoid-binding protein, exon | ||
| F31a | AGCCATYGAGCAGGCCATGAAGAGT | This study |
| R1135b | RGC AGCCTCATCCTTGGGYATCTCAG | This study |
| Cytb—cytochrome b | ||
| L7-fw | ACCAATGACATGAAAAATCATCGTT | Montgelard et al., 2002 |
| H6-rev | TCTCCATTTCTGGTTTACAAGAC | Montgelard et al., 2002 |
| 12S ribosomal RNA | ||
| 12S_L17b | GCAAAGCRCTGAAAATGCTTAGATGAGT | This study |
| 12S_H906a | GGCGGTGTGTGCGTGCTTTATTG | This study |
| 16S ribosomal RNA | ||
| 16S_L1930 | CCGCCTGTTTACCAAAAACATCACCTCT | This study |
| 16S_H2496 | CCGGTCTGAACTCAGATCACGTAGGAC | This study |
| Cytb | 12S | 16S | IRBP | |
|---|---|---|---|---|
| Aeretes melanopterus | AY227535 | AY227481 | AY227593 | |
| Aeromys tephromelas | AY227536 | AY227482 | AY227594 | |
| Belomys pearsonii | AB126245 LC006019 | AY227537 | AY227483 | AY227595 |
| Biswamoyopterus biswasi | MK105508 MK105509 | MK105526 MK105527 | MK105519 MK105520 | MK105534 MK105535 |
| Eoglaucomys fimbriatus | AB126246 AB126248 | AY227562 | AY227485 | AY227597 |
| Eupetaurus cinereus | AY227538 | AY227484 | AY227596 | |
| Glaucomys sabrinus | AF359223 | |||
| Glaucomys volans | AJ389531 | AY227559 MT259089 | AY227486 MT259089 | AY227598 |
| Hylopetes alboniger | DQ093187 KX710106 | KX710106 | KX710106 | |
| Hylopetes lepidus | AB126250 AB126251 DQ093188 | |||
| Hylopetes nigripes | DQ093190 | |||
| Hylopetes phayrei | AB126252 KC447305 KP708707 | AY227539 KC447305 KP708707 | AY227487 KC447305 KP708707 | AY227599 |
| Hylopetes spadiceus | DQ093189 | |||
| Iomys horsfieldi | AY227540 | AY227488 | AY227600 | |
| Petaurillus kinlochii | AY227542 | AY227490 | AY227602 | |
| Petaurista albiventer | DQ072109 AB092612 | |||
| Petaurista alborufus | AB092613 AB092614 | JQ743657 | JQ743657 | AY227601 |
| Petaurista elegans | JQ928698 MK105516 MK105518 | MK105539 | ||
| Petaurista hainana | DQ072108 | JX572159 | JX572159 | |
| Petaurista lena | AB092615 | AY227541 | AY227489 | |
| Petaurista leucogenys | AB092616 AB092617 AB092618 AB092619 AB433219 AB433269 | |||
| Petaurista petaurista | AB092608 AB092609 AB092611 | |||
| Petaurista philippensis | MK105510 MK105515 | MK105528 MK105531 MK105532 | MK105521 MK105522 MK105523 | MK105536 MK105537 MK105538 |
| Petaurista xanthotis | DQ072111 | |||
| Petaurista yunanensis | DQ072110 JQ928701 JQ928702 | KX528208 | KX528208 | |
| Petinomys fuscocapillus | KP973562 | KP973561 | ||
| Petinomys setosus | AB030260 | AY227544 | AY227492 | AY227604 |
| Pteromys momonga | AB164675 AB164676 | |||
| Pteromys volans | EU919142 KR063240 KR063244 | AY227545 JQ230001 MH212330 MT430951 | AY227493 JQ230001 MH212330 MT430951 | AY227605 |
| Pteromyscus pulverulentus | AY227543 | AY227491 | AY227603 | |
| Trogopterus xanthipes | AY227546 | AY227494 | AY227606 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kruskop, S.V.; Abramov, A.V.; Lebedev, V.S.; Bannikova, A.A. Uncertainties in Systematics of Flying Squirrels (Pteromyini, Rodentia): Implications from a New Record from Vietnam. Diversity 2022, 14, 610. https://doi.org/10.3390/d14080610
Kruskop SV, Abramov AV, Lebedev VS, Bannikova AA. Uncertainties in Systematics of Flying Squirrels (Pteromyini, Rodentia): Implications from a New Record from Vietnam. Diversity. 2022; 14(8):610. https://doi.org/10.3390/d14080610
Chicago/Turabian StyleKruskop, Sergei V., Alexei V. Abramov, Vladimir S. Lebedev, and Anna A. Bannikova. 2022. "Uncertainties in Systematics of Flying Squirrels (Pteromyini, Rodentia): Implications from a New Record from Vietnam" Diversity 14, no. 8: 610. https://doi.org/10.3390/d14080610
APA StyleKruskop, S. V., Abramov, A. V., Lebedev, V. S., & Bannikova, A. A. (2022). Uncertainties in Systematics of Flying Squirrels (Pteromyini, Rodentia): Implications from a New Record from Vietnam. Diversity, 14(8), 610. https://doi.org/10.3390/d14080610
