Cytochrome Oxidase Subunit II: Potential Marker for the Identification of Forensically Significant Species of Coleoptera—A Preliminary Study
Abstract
:Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Specimen Collection
2.2. DNA Extraction
2.3. DNA Amplification and Sequencing
2.4. Phylogenetic Analysis
3. Results
3.1. Amplification of Mitochondrial COII Gene
3.2. Divergence and Nucleotide Composition
3.3. Phylogenetic Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Amendt, J.; Richard, C.S.; Campobasso, C.P.; Zehner, R.; Hall, M.J.R. Forensic Entomology: Applications and Limitations. Forensic Sci. Med. Pathol. 2011, 7, 379–392. [Google Scholar] [CrossRef] [PubMed]
- Catts, E.P.; Goff, M.L. Forensic entomology in criminal investigations. Annu. Rev. Entomol. 1992, 37, 253–272. [Google Scholar] [CrossRef] [PubMed]
- Midgley, J.M.; Richards, C.S.; Villet, M.H. The Utility of Coleoptera in Forensic Investigations. In Current Concepts in Forensic Entomology; Springer: Berlin/Heidelberg, Germany, 2010; pp. 57–68. [Google Scholar]
- Wells, J.D.; Williams, D.W. Validation of a DNA-based method for identifying Chrysomyinae (Diptera, Calliphoridae) used in death investigations. Int. J. Legal Med. 2007, 121, 1. [Google Scholar] [CrossRef]
- Blaxter, M.L. The promise of DNA taxonomy. Philos. Trans. R. Soc. B 2004, 359, 669–679. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Waugh, J. DNA barcoding in animal species: Progress, potential and pitfalls. BioEssays 2007, 29, 188–197. [Google Scholar] [CrossRef] [PubMed]
- Lopes, S.F.T. Forensic Entomology: DNA Barcoding for Coleoptera Identification. Master’s Dissertation, University of Lisbon, Lisbon, Portugal, 2012. [Google Scholar]
- Almeida, L.M.; Mise, K.M. Diagnosis and key of the main families and species of South American Coleoptera of forensic importance. Rev. Bras. Entomol. 2009, 53, 227–244. [Google Scholar] [CrossRef]
- Goff, M.L.; Flynn, M.M. Determination of postmortem interval by arthropod succession: A case study from Hawaiian Islands. J. Forensic Sci. 1991, 36, 607–614. [Google Scholar] [CrossRef]
- Schilthuizen, M.; Scholte, C.; Van Wijk, R.E.J.; Dommershuijzen, J.; Van der Horst, D.; Zu Schlochtern, M.M.; Lievers, R.; Groenenberg, D.S.J. Using DNA-barcoding to make the necrobiont beetle family Cholevidae accessible for forensic entomology. Forensic Sci. Int. 2011, 210, 91–95. [Google Scholar] [CrossRef]
- Schroeder, H.; Klotzbach, H.; Oesterhelweg, L.; Puschel, K. Larder beetles (Coleoptera, Dermestidae) as an accelerating factor for decomposition of human corpse. Forensic Sci. Int. 2002, 127, 231–236. [Google Scholar] [CrossRef]
- Zhuang, Q.; Cai, J.; Zhang, M.; Feng, H.; Guo, Y.; Lan, L.; Chen, Y. Molecular identification of forensically significant beetles (Coleoptera) in China based on COI gene. Rev. Colomb. Entomol. 2011, 37, 95–102. [Google Scholar]
- Dobler, S.; Muller, J.K. Resolving phylogeny at the Family Level by Mitochondrial Cytochrome Oxidase Sequences: Phylogeny of Carrion Beetles (Coleoptera, Silphidae). Mol. Phylogenet. Evol. 2000, 15, 390–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DiZinno, J.A.; Lord, W.D.; Collins-Morton, M.B.; Wilson, M.R.; Goff, M.L. Mitochondrial DNA sequencing of beetle larvae (Nitidulidae: Omosita) recovered from human bone. J. Forensic Sci. 2002, 47, 1–3. [Google Scholar] [CrossRef]
- Ferreira, S.; Oliveira, A.R.; Farinha, A.; Rebelo, M.T.; Dias, D. Forensic entomology: Nuclear and mitochondrial markers for Diptera and Coleoptera identification. Forensic Sci. Int. 2011, 3, e174–e175. [Google Scholar] [CrossRef]
- Su, R.N.; Guo, Y.D.; Xie, D.; Peng, Y.L.; Cai, J.F.; Hua, F.; Sheng, L.H. Identification of forensically important beetles (Coleoptera: Histeridae) in China based on 16S rRNA and Cyt b. Trop. Biomed. 2013, 30, 375–387. [Google Scholar] [PubMed]
- Mashaly, A.M.; Al-Ajmi, R.A.; Al-Johani, H.A. Molecular identification of carrion beetles (Coleoptera) in selected regions of Saudi Arabia. J. Med. Entomol. 2018, 55, 1423–1430. [Google Scholar] [CrossRef] [PubMed]
- Alajmi, R.; Abdel-Gaber, R.; Haddadi, R. Molecular identification of forensically important beetles in Saudi Arabia based on mitochondrial 16 s rRNA gene. Entomol. Res. 2020, 50, 343–350. [Google Scholar] [CrossRef]
- Jang, H.; Shin, S.E.; Youm, K.J.; Karagozlu, M.Z.; Kim, C.B.; Ko, K.S.; Park, S.H. Molecular Identification of Necrophagous Dermestes Species in South Korea Using Cytochrome c Oxidase Subunit I Nucleotide Sequences (Genus Dermestes). J. Forensic Sci. 2020, 65, 283–287. [Google Scholar] [CrossRef] [Green Version]
- Sharma, M.; Singh, D.; Sharma, A.K. Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae). Forensic Sci. Int. 2015, 247, 1–6. [Google Scholar] [CrossRef]
- Sharma, M.; Singh, D.; Sharma, A.K. Cytochrome Oxidase I gene-based identification of forensically important species of Indian flesh flies (Diptera: Sarcophagidae). J. Entomol. Res. 2016, 40, 195–200. [Google Scholar] [CrossRef]
- Khullar, N.; Singh, D.; Jha, C.K. Short COI marker: A valuable tool for identification and phylogenetic analysis of 6 forensically important blowfly species from India. J. Entomol. Zool. Stud. 2016, 4, 27–31. [Google Scholar]
- Khullar, N.; Singh, D.; Jha, C.K. Phylogenetic characterization of some species of family Calliphoridae using COII gene marker. Int. J. Entomol. Res. 2017, 2, 79–82. [Google Scholar]
- Bharti, M.; Singh, B. DNA-Based Identification of forensically important blow flies (Diptera: Calliphoridae) from India. J. Med. Entomol. 2017, 54, 1151–1156. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Li, C.; Zheng, W.; Song, F.; Guo, X.; Wu, Z.; Luo, P.; Yang, Y.; He, L.; Zhao, T. A evalution of the suitability of COI and COII gene variation for reconstructing the phylogeny of, and identifying cryptic species in, anopheline mosquito (Diptera Culicidae). Mitochondrial DNA 2017, 28, 769–777. [Google Scholar] [CrossRef] [PubMed]
- Schawaller, V.W. Taxonomie und Faunistik der Gattung Thanatophilus (Coleoptera: Silphidae). Stuttg. Beitr. Naturkd. 1981, 351, 1–21. [Google Scholar]
- Ruzicka, J.; Schneider, J. Faunistic records of Silphidae from China. Klapalekiana 1996, 32, 77–83. [Google Scholar]
- Ruzicka, J.; Schneider, J. Distributional records of carrion beetles (Coleoptera: Silphidae) from Iran, Afghanistan, Pakistan and north-western India. Klapalekiana 2002, 38, 213–225. [Google Scholar]
- Ruzicka, J.; Schneider, J. Revision of Palaearctic and Oriental Necrophila Kirby & Spence, part 1: Subgenus Deutosilpha Portevin (Coleoptera: Silphidae). Zootaxa 2011, 2987, 1–12. [Google Scholar]
- Ruzicka, J.; Hava, J.; Schneider, J. Taxonomical and distribution notes on Oriental Silphidae, with description of Nicrophorus sausai sp. n. (Insecta: Coleoptera). Reichenbachia 2000, 33, 377–384. [Google Scholar]
- Ruzicka, J.; Qubaiova, J.; Nishikawa, M.; Schneider, J. Revision of Palearctic and Oriental Necrophila Kirby et Spence, part 3: Subgenus Calosilpha Portevin (Coleoptera: Silphidae: Silphinae). Zootaxa 2015, 4013, 451–502. [Google Scholar] [CrossRef]
- Ruzicka, J.; Sipkova, H.; Schneider, J. Notes on carrion beetles (Coleoptera: Silphidae) from India. Klapalekiana 2011, 47, 239–245. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- O’Grady, P.M. Reevaluation of phylogeny in the Drosophila obscura species group based on combined analysis of nucleotide sequences. Mol. Phylogenet. Evol. 1999, 12, 124–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, H.; Beckenbach, A.T. Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insects. Mol. Phylogenet. Evol. 1992, 1, 41–52. [Google Scholar] [CrossRef]
- Sievers, F.; Wilm, A.; Dineen, D.G.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. Available online: https://www.ebi.ac.uk/Tools/msa/clustalo/ (accessed on 24 August 2019). [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. B 2003, 270, 313–321. [Google Scholar] [CrossRef] [Green Version]
- Whitworth, T.L.; Dawson, R.D.; Magalon, H.; Baudry, E. DNA barcoding cannot reliably identify species of the blowfly genus Protocalliphora (Diptera: Calliphoridae). Proc. R. Soc. B 2007, 274, 1731–1739. [Google Scholar] [CrossRef] [Green Version]




| Species | Locality | Collected by | Accession No. | Date of Collection |
|---|---|---|---|---|
| Silphidae Thanatophilus minutus * Necrophila (Calosilpha) Ioptera * Necrophila (Calosilpha) cyvaniventris * Necrophila (Deutosilpha) Rufithorax * | Kullu, Himachal Pradesh Kullu, Himachal Pradesh Kullu, Himachal Pradesh Gagret, Himachal Pradesh | N.Singh N.Singh N.Singh N.Singh | MH023411 MH785185 MG958644 MG940969 MG772614 MH796140 | 5/26/2014 5/26/2014 5/27/2014 5/27/2014 6/10/2014 6/10/2014 |
| Histeridae Saprinus interruptus * | Gagret, Himachal Pradesh | N.Singh | MH023410 MH785186 | 6/10/2014 6/10/2014 |
| Staphylinidae Aleochara nigra Creophilus maxillosus Creophilus flavipennis * | Manali, Himachal Pradesh Kullu, Himachal Pradesh Hamirpur, Himachal Pradesh | N.Singh N.Singh N.Singh | MG958643 MH777400 MG958645 MH778535 MG940970 | 6/30/2015 6/30/2015 5/26/2014 5/26/2014 7/6/2015 |
| Dermestidae Dermestes maculatus | Patiala, Punjab | N.Singh | MG891837 MH764581 MH814725 | 4/10/2014 4/10/2014 4/10/2014 |
| Scarabaeidae Onthophagus cervus * | Kullu, Himachal Pradesh | N.Singh | MH777399 MH814724 MG920500 | 5/26/2014 5/26/2014 6/10/2015 |
| Primer Name | Sequence (5′—3′) | Length | Reference |
|---|---|---|---|
| Forward TL2J 3037 | ATGGCAGATTAGTGCAATGG | 20 | O’Grady (1999) [34] |
| Reverse TKN 3785 | GTTTAAGAGACCAGTACTTG | 20 | Liu and Beckenbach (1992) [35] |
| Species (Accession No.) | Species (Accession No.) | Intraspecific Divergence |
|---|---|---|
| Creophilus maxillosus MG958645 | Creophilus maxillosus # GQ118443 | 10.6% |
| Dermestes maculatus MG891837 | Dermestes maculatus # NC_037200 | 11.5% |
| Aleochara nigra MG958643 | Aleochara nigra # AJ293051 | 12.8 |
| Species (Accession No.) | Species (Accession No.) | Intraspecific Divergence |
|---|---|---|
| Onthophagus cervus MH777399 | Onthophagus cf. taurinus # KU739462 | 14.7% |
| Onthophagus cervus MH777399 | Onthophagus obscurior # KU739477 | 19.6% |
| Creophilus flavipennis MG940970 | Creophilus maxillosus # GQ118443 | 18.9% |
| Creophilus flavipennis MG940970 | Creophilus maxillosus MG958645 | 9.7% |
| Necrophila (Deutosilpha) rufithorax MG772614 | Necrophila (Calosilpha) ioptera MG958644 | 7.3% |
| Necrophila (Deutosilpha) rufithorax MG772614 | Necrophila (Calosilpha) cyvaniventris MG940969 | 8.3% |
| Necrophila (Calosilpha) ioptera MG958644 | Necrophila (Calosilpha) cyvaniventris MG940969 | 6.5% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Singh, N.; Singh, D.; Kesavan, A.K.; Alabdallah, N.M.; Alshehri, M.A.; Sayed, S.; Ansari, M.J.; Bala, M. Cytochrome Oxidase Subunit II: Potential Marker for the Identification of Forensically Significant Species of Coleoptera—A Preliminary Study. Diversity 2022, 14, 369. https://doi.org/10.3390/d14050369
Singh N, Singh D, Kesavan AK, Alabdallah NM, Alshehri MA, Sayed S, Ansari MJ, Bala M. Cytochrome Oxidase Subunit II: Potential Marker for the Identification of Forensically Significant Species of Coleoptera—A Preliminary Study. Diversity. 2022; 14(5):369. https://doi.org/10.3390/d14050369
Chicago/Turabian StyleSingh, Neha, Drishtant Singh, Anup Kumar Kesavan, Nadiyah M. Alabdallah, Mohammed A. Alshehri, Samy Sayed, Mohammad Javed Ansari, and Madhu Bala. 2022. "Cytochrome Oxidase Subunit II: Potential Marker for the Identification of Forensically Significant Species of Coleoptera—A Preliminary Study" Diversity 14, no. 5: 369. https://doi.org/10.3390/d14050369
APA StyleSingh, N., Singh, D., Kesavan, A. K., Alabdallah, N. M., Alshehri, M. A., Sayed, S., Ansari, M. J., & Bala, M. (2022). Cytochrome Oxidase Subunit II: Potential Marker for the Identification of Forensically Significant Species of Coleoptera—A Preliminary Study. Diversity, 14(5), 369. https://doi.org/10.3390/d14050369

