Next Article in Journal
The Similarity of Floral Scent Composition in Two Breynia Species Pollinated by the Same Host-Specific Epicephala Moth
Previous Article in Journal
Diversity of Periphytic Chironomidae on Different Substrate Types in a Floodplain Aquatic Ecosystem
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Record of Ophidonais serpentina (Müller, 1773) (Oligochaeta: Naididae) in China: The Occurrence or Absence of Needles Are Intraspecific Differences

1
State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China
2
College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100049, China
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(4), 265; https://doi.org/10.3390/d14040265
Submission received: 6 March 2022 / Revised: 25 March 2022 / Accepted: 29 March 2022 / Published: 31 March 2022

Abstract

A naidid oligochaete, Ophidonais serpentina (Müller, 1773) is redescribed based on specimens from the Xinkai River in Zhejiang Province, China. O. serpentina is very common in Europe and America. This study is the first record of the species in China. By integrating the previously morphological descriptions related to O. serpentina in the world, it can be divided into three morphological groups: a group with dorsal chaetae starting from VI, a group without dorsal chaetae, and a group with an unstable starting position of the dorsal chaetae. By comparing the mitochondrial DNA (16S rDNA, COI), nuclear DNA (ITS2), and histones (H3) from the three groups, Bayesian inference and maximum likelihood phylogenetic analyses were performed based on the combined data set. Different analyses gave almost consistent phylogenetic trees. All of the genetic distances between the three groups were 0.00%. No genetic variation can be detected between the specimens regardless of the presence and starting position of dorsal chaetae. This result suggests that a single lineage of O. serpentina is widespread worldwide.

1. Introduction

Ophidonais serpentina (Müller, 1773) (Annelida: Clitellata: Naididae: Naidinae) [1] is the type species of the monotypic genus Ophidonais Gervais [2]. In phylogeny, O. serpentina seems to be the sister group to a clade consisting of Stylaria, Ripistes, and Arcteonais [3]. This species is a common species in Europe, America, and Africa. Timm suggested that this species may be widely distributed in the Holarctic realm [4]. In Asia, it has previously been reported in Iran, Japan, Korea and Siberia. This study is the first to find the species in China.
In terms of morphology, dorsal chaetae have been previously described as stout and straight, beginning from VI [4,5]. In North America, Kathman and Brinkhurst found that in some specimens, all of the dorsal chaetae had been shed [6]. Ohtaka also noted the absence of dorsal chaetae [7]. Our specimens, which were collected from Xinkai River, could be divided into two groups. Most of the individuals had no needles, while the rest had needles with an uncertain beginning segment. By integrating records from other regions of the world, there are three morphological groups in O. serpentina, namely the no needles group, the stable needles group, and the unstable needles group.
The aim of the present study was to compare the morphological characteristics of these new specimens with corresponding features of the previously examined specimens of O. serpentina. Through the inclusion of molecular data, we explored whether the differences in morphology were related to genetics or represent phenotypic plasticity.

2. Materials and Methods

2.1. Taxon Sampling and Collection of Specimens

The Xinkai River is a eutrophic urban river in Shaoxing City, Zhejiang Province, China (29°95′99.06″ N, 120°47′57.55″ E) and a coastal river near the East China Sea. Specimens of O. serpentina were collected from the surface of hydrophytes at the shore of Xinkai River. A total of 64 specimens were collected, as shown in Table 1. The conditions of the site were as follows: the sediment was composed of silt and blocks, the water temperature was 25 °C, the depth was 0.5 m, the pH was 7.29, the conductivity was 428.5 μS/cm, the total dissolved solids (TDS) was 290.23 mg/L, the oxidation–reduction potential (ORP) was 564.25 mV, and the dissolved oxygen (DO) was 5.97 mg/L.
The specimens were preserved in 80–90% alcohol. The morphological characteristics were observed with a light microscope (LM) and a scanning electron microscope (SEM). The specimens used for SEM were acidified and dried naturally, then pasted onto the SEM copper platform with carbon conductive adhesive. After that, the specimens were sputtered with gold and placed under the SEM (Hitachi SU-8010) for observation and photography. The permanently preserved specimens were stained with borax carmine, separated by hydrochloric acid alcohol, gradient dehydrated by alcohol (70–99%), hyalinized with xylene, and sealed by Canadian gum. Drawings and measurement were based on preserved specimens. The specimens were deposited in the Institute of Hydrobiology, Chinese Academy of Sciences. In this study, six specimens were selected for the extraction of genes. The gene data of other related species were downloaded from the GenBank database. Rhyacodrilus coccineus and Rhyacodrilus falciformis were selected as outgroups (Table 2). Drawings were made with Adobe Photoshop CC 2019.

2.2. DNA Extraction, Amplification, and Sequencing

DNA was extracted by using a TIANamp Genomic DNA Kit and following the manufacturer’s manual. The conditions for gene amplification are specified in Table 2. The 1μL amplified product was extracted and detected by gel electrophoresis. If the target bands were found, the polymerase chain reaction (PCR) products were sent to Icongene Ltd. (Wuhan, China) for sanger sequencing. All of the primers used for sequencing are described in Table 3.

2.3. Alignments and Phylogenetic Analysis

We used BioEdit to check the original sequence, and then used SeqMan (DNASTAR) to connect the sequence when the sequence showed as single peak. We aligned the complete sequences into NCBI and did BLAST online. The newly acquired and downloaded sequences from the GenBank database were stored in FASTA format for further analysis. Then, we chose PhyloSuite [24] to analyze the data. Four sequences in batches were aligned by using the ‘-auto’ strategy and normal alignment mode in MAFFT [25] and aggregated into a sequence matrix. The best model for the BIC criterion was selected by a model finder [26]. The optimal model was chosen by BIC: GTR + F + G4. Under the conditions of the GTR + G + F model (2 parallel runs, 1 × 107 generations), Bayes 3.2.6 [27] was used to infer the occurrence of the Bayesian inference system, in which 25% of the initial sample data were discarded as burn-in. Maximum likelihood phylogenies were inferred using IQ-TREE [28] under the GTR + G4 + F model for 1000 standard bootstraps. MEGA X was used to calculate the genetic distance between two pairs, and a p-distance model was selected to complete the calculation [29]. We used the Interactive Tree of Life (https://itol.embl.de accessed on 2 March 2022) tool [30] and Adobe Illustrator 2021 to manipulate and combine the phylogenetic trees.

3. Results

3.1. Taxonomy and Morphology

Ophidonais serpentina (Müller, 1773)
See Speber (1948) for synonymies [5].
Description of Chinese specimens: Length 4–30 mm, segments 27–87. The living individual is pale and has pigment stripes on its anterior segments, wrapped by a thin crust of foreign particles (Figure 1D). Coelomocytes are abundantly present (Figure 1C). Obtuse prostomium, eyes present (Figure 1B). Stomach slowly widening in VIII–IX. Unable to swim.
Needles are absent or beginning at posterior segments, often absent (Figure 2B and Figure 3C–E). Needles are stout and straight, length 62–140 μm, width 5 μm, 1 per bundle, 2–3 equal pointed distal end, indistinct under the light microscope, proximal blunt, nodulus proximal 1/3–1/4, and indistinct. Ventral chaetae are 3–5 per bundle, with those of II longer than the rest, having a length 150–178 μm and width 5 μm; other ventral chaetae have length 95–125 μm and width 5 μm. The distal teeth of ventral chaetae are longer than the proximal teeth in anterior segments and equal in the following segments (Figure 2D–F and Figure 3A,B). Nodulus median or proximal, nodulus distal gradually in the following segments.
Specimens deposited. IHB ZJ20210628a-b, two whole-mounted specimens, immature, no needles; IHB ZJ20210628c-d, two whole-mounted specimens, immature, with needles. Six specimens were used for extracting DNA and two specimens were used for electron microscopy. The rest of the specimens were dipped in 80–90% alcohol, and preserved in the Institute of Hydrobiology, Chinese Academy of Sciences.

3.2. Phylogenetic Analyses

We combined 119 nucleotide sequences into a dataset (3603bp) for phylogenetic analysis. The trees based on the combined dataset were largely consistent in the maximum likelihood (ML) and Bayesian inference (BI) analysis. Both trees were shown in an equidistant version (Figure 4), and the support values were given as BI posterior probabilities (pp) and ML bootstrap support (bs). In the selected specimens, Ophidonais serpentina 1–3 were the individuals without dorsal chaetae, and O. serpentina 4–6 were those with dorsal chaetae. O. serpentina A-C were downloaded from GenBank. Two phylogenetic trees highly supported that all of the O. serpentina specimens were recovered as a monophyletic clade (pp 1.00, bs 100). In maximum likelihood analysis, O. serpentina was recovered as sister to the clade comprising four species: Piguetiella blanci, Specaria josinae, Stylaria lacustris, and Stylaria fossularis (bs 54). In Bayesian inference analysis, O. serpentina was sister to the clade comprising Slavina appendiculata and Vejodovskyella comata (pp 0.66). In both trees, all seven species formed a single clade (pp 0.99, bs 89).

3.3. Pairwise Genetic Distances

The uncorrected p-distance for 16S rDNA genes in the Ophidonais showed barcoding gaps were between 1.7 and 4.6%, and the COI genes were between 11.4 and 15.8%. The p-distances between the three morphological groups were 0.00% (Table 4).

4. Discussion

4.1. Morphological Characters of Ophidonais Serpentina

Of the 64 specimens, only 11 individuals had dorsal chaetae which appeared on one side of the body and with one on each segment. So far, the descriptions of this species in the published records were mostly consistent with Sperber (1948) and Timm (2009), without mentioning the lack of dorsal chaetae. This phenomenon has been shown in reports from North America [6] and Japan [31] and was also found in specimens collected in China. Additionally, some scholars found cilia in the papillae [32] but they were absent in our specimens and the arrangement of papillae was irregular. More detailed descriptions of the differences between the species from different regions of the world are listed in Table 5.

4.2. Intraspecies Analysis

The results of pairwise distance and phylogenetic analysis showed that Ophidonais serpentina was related closely to Vejdovskyella comata (pp 89, bs 0.66, mean distance 2.7% (16S), 13.8% (COI)), which was consistent with Bely and Wray’s conclusion. Additionally, we found that Piguetiella blanci (pp 0.99, bs 54, mean distance 2.8% (16S), 12.1% (COI)) was also closely related to O. serpentina, which was not mentioned in Bely’s study. All the results showed that the three groups (the absent dorsal chaetae group, the stable dorsal chaetae group and the unstable dorsal chaetae group) from a single monophyly. Whether the needles existed or not, and whether the starting position of the needles was stable or not, there was no genetic variation that was detected between the specimens. This result suggests that a single lineage of O. serpentina is widespread worldwide. Whether the difference is caused by environmental factors or genetic factors needs further studies.

4.3. Distribution and Habitat

According to the published reports, Ophidonais serpentina prefer to inhabit on hydrophytes, however, the populations living in the Jajrood River (Iran) and the St. Lawrence River (Canada) show a parasitic habit. In some studies, scholars have reported O. serpentina as parasites in the mantle cavity of bivalves and crabs [34,35,36]. George et al. [37] suggested that water conductivity was one of the primary causes of these phenomena. A similar situation presented in Naidids Dero, where the first present segment of dorsal chaetae is related to life stage. In free-living individuals, the presence of dorsal chaetae begins at segment V or VI and in parasitic individuals, dorsal chaetae start from the IV segment [38]. Andrews et al. suggested that Dero parasitize in frogs’ urinary tract and reproduce asexually. When the frogs void bladder urine, they will leave the host and enter back into the water for free-living [39]. However, the specimens in our study did not show parasitism. All of them were collected in the littoral zone of the Xinkai River, an urban river with good growth of Hydrilla verticillata, numerous residents and serious organic pollution. Perhaps the life stage leads to the variation of O. serpentina’s needles. Further studies are required to understand more about the causes of this intraspecific difference.

Author Contributions

Conceptualization, Y.C. and H.W.; methodology, Y.C., J.Y. and T.Z.; software, J.Y.; validation, Y.C., H.W., T.Z. and J.Y.; formal analysis, J.Y.; investigation, Y.C., T.Z. and J.Y.; resources, Y.C.; data curation, T.Z. and J.Y.; writing—original draft preparation, J.Y.; writing—review and editing, H.W., Y.C. and T.Z.; visualization, J.Y.; supervision, Y.C. and H.W.; project administration, Y.C.; funding acquisition, Y.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Second Tibetan Plateau Scientific Expedition and Research (STEP) program (Grant no. 2019 QZKK0304) and the National Natural Science Foundation of China (52039006).

Institutional Review Board Statement

All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. The cited data have been published in NCBI.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Acknowledgments

We highly acknowledge Wei Jiang for revising the manuscript, and for his useful advice on writing and phylogenetic analyses.

Conflicts of Interest

The authors declare no conflict of interest. The funders did not take part in the design, collection, analyses, or the writing of the manuscript.

References

  1. Müller, O.F. Vermium Terrestrium et Fluviatilium II. Hafniae Lipsiae 1773. Available online: https://www.biodiversitylibrary.org/item/50344 (accessed on 26 October 2021).
  2. Gervais, P. Note sur la disposition systématique des Annélides chétopodes de la famille des Nais. Bull. L’académie R. Des Sci. Belles-Lett. Brux. 1838, 5, 13–20. [Google Scholar]
  3. Erséus, C.; Envall, I.; De Wit, P.; Gustavsson, L.M. Molecular data reveal a tropical freshwater origin of Naidinae (Annelida, Clitellata, Naididae). Mol. Phylogenet. Evol. 2017, 115, 115–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Timm, T. A guide to the freshwater Oligochaeta and Polychaeta of northern and central Europe. Lauterbornia 2009, 66, 1–235. [Google Scholar]
  5. Sperber, C. A taxonomical study of the Naididae. Zool. Bidr. Fran Upps. 1948, 28, 1–296. [Google Scholar]
  6. Kathman, D.D.; Brinkhurst, R.O. Guide to the Freshwater Oligochaetes of North America; Revised Version; Aquatic Resources Center: Nashville, TN, USA, 1999; p. 264. [Google Scholar]
  7. Ohtaka, A.; Iwakuma, T. Redescription of Ophidonais serpentina (Muller, 1773) (Naididae, Oligochaeta) from Lake Yunoko, Central Japan, with record of the oligochaete composition in the lake. Jpn. J. Limnol. 1993, 54, 251–259. [Google Scholar] [CrossRef] [Scilit]
  8. Envall, I.; Källersjö, M.; Erséus, C. Molecular evidence for the non-monophyletic status of Naidinae (Annelida, Clitellata, Tubificidae). Mol. Phylogenet. Evol. 2006, 40, 570–584. [Google Scholar] [CrossRef] [Scilit]
  9. Bely, A.E.; Sikes, J.M. Latent regeneration abilities persist following recent evolutionary loss in asexual annelids. Proc. Natl. Acad. Sci. USA 2010, 107, 1464–1469. [Google Scholar] [CrossRef] [Scilit]
  10. Bely, A.E.; Wray, G.A. Molecular phylogeny of naidid worms (Annelida: Clitellata) based on cytochrome oxidase I. Mol. Phylogenet. Evol. 2004, 30, 50–63. [Google Scholar] [CrossRef] [Scilit]
  11. Jiang, W.; Zhou, T.T.; Wang, H.Z.; Yu, P.; Erseus, C.; Cui, Y.D. Genetic and morphological analyses uncover a new record and a cryptic species in Allonais (Clitellata: Naididae). Biologia 2021, 76, 1705–1714. [Google Scholar] [CrossRef] [Scilit]
  12. Envall, I.; Gustavsson, L.M.; Erseus, C. Genetic and chaetal variation in Nais worms (Annelida, Clitellata, Naididae). Zool. J. Linn. Soc. 2012, 165, 495–520. [Google Scholar] [CrossRef] [Scilit]
  13. Martinsson, S.; Achurra, A.; Svensson, M.; Erseus, C. Integrative taxonomy of the freshwater worm Rhyacodrilus falciformis s.l. (C litellata: N aididae), with the description of a new species. Zool. Scr. 2013, 42, 612–622. [Google Scholar]
  14. Vivien, R.; Holzmann, M.; Werner, I.; Pawlowski, J.; Lafont, M.; Ferrari, B.J.D. Cytochrome c oxidase barcodes for aquatic oligochaete identification: Development of a Swiss reference database. PeerJ 2017, 5, e4122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Martin, P.; Martinsson, S.; Wuillot, J.; Erséus, C. Integrative species delimitation and phylogeny of the branchiate worm Branchiodrilus (Clitellata, Naididae). Zool. Scr. 2018, 47, 727–742. [Google Scholar] [CrossRef] [Scilit]
  16. Vivien, R.; Wyler, S.; Lafont, M.; Pawlowski, J.J.P.O. Molecular barcoding of aquatic oligochaetes: Implications for biomonitoring. PLoS ONE 2015, 10, e0125485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Sjölin, E.; Erséus, C.; Källersjö, M. Phylogeny of Tubificidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. Mol. Phylogenet. Evol. 2005, 35, 431–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Erseus, C.; Rota, E.; Matamoros, L.; De Wit, P. Molecular phylogeny of Enchytraeidae (Annelida, Clitellata). Mol. Phylogenet. Evol. 2010, 57, 849–858. [Google Scholar] [CrossRef] [Scilit]
  19. Mejlon, E.; De Wit, P.; Matamoros, L.; Erséus, C. DNA-based phylogeny of the marine genus Heterodrilus (Annelida, Clitellata, Naididae). J. Zool. Syst. Evol. Res. 2015, 53, 194–199. [Google Scholar] [CrossRef] [Scilit]
  20. Palumbi, S.R.; Martin, A.; Romano, S.; McMillan, W.O.; Stice, L.; Grabowski, G. The Simple Fool’s Guide to PCR; Version 2.0; University of Hawaii: Honolulu, HI, USA, 1991; Volume 45. [Google Scholar]
  21. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  22. Liu, Y.; Erséus, C. New specific primers for amplification of the Internal Transcribed Spacer region in Clitellata (Annelida). Ecol. Evol. 2017, 7, 10421–10439. [Google Scholar] [CrossRef] [Scilit]
  23. Brown, S.; Rouse, G.; Hutchings, P.; Colgan, D. Assessing the usefulness of histone H3, U2 snRNA and 28S rDNA in analyses of polychaete relationships. Aust. J. Zool. 1999, 47, 499–516. [Google Scholar] [CrossRef] [Scilit]
  24. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit]
  28. Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [Scilit]
  29. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
  30. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [Scilit]
  31. Ohtaka, A.; Nishino, M. Studies on the aquatic oligochaete fauna in Lake Biwa, central Japan. II. Records and taxonomic remarks of nine species. Hydrobiologia 1999, 406, 33–47. [Google Scholar] [CrossRef] [Scilit]
  32. Yanez, E.; Cuadrado, S.; Martinez-Ansemil, E. External sense organs in freshwater oligochaetes (Annelida, Clitellata) revealed by scanning electron microscopy. J. Morphol. 2006, 267, 198–207. [Google Scholar] [CrossRef] [Scilit]
  33. Spencer, D.R.; Wisseman, R.E. Some new records of Naididae and Tubificidae (Annelida, Oligochaeta) from Washingtons. Great Basin Nat. 1993, 53, 395–401. [Google Scholar]
  34. Conn, D.B. Invading the invaders: Infestation of zebra mussels by native parasites in the St. Lawrence River. In Proceedings of the Fourth International Zebra Mussel Conference, Madison, WI, USA, 7–10 March 1994; p. 8. [Google Scholar]
  35. Jablonska, A.; Pesic, V. Five species of aquatic oligochaetes new to Iran with an updated checklist. Oceanol. Hydrobiol. Stud. 2014, 43, 100–105. [Google Scholar] [CrossRef] [Scilit]
  36. Ardalan, A.A.; Mooraki, N.; Sadeghi, M.S. Occurrence of Ophidonais serpentina in Potamon persicum from Jajrood River, Iran. Iran. J. Fish. Sci. 2011, 10, 177–180. [Google Scholar]
  37. George, A.D.I.; Abowei, J.F.N.; Daka, E.R. Benthic Macro Invertebrate Fauna and Physico-chemical Parameters in Okpoka Creek Sediments, Niger Delta, Nigeria. Int. J. Anim. Vet. Adv. 2009, 1, 59–65. [Google Scholar]
  38. Sinsch, U.; Dehling, M.; Scheid, P.; Balczun, C. A new African species of parasitic Dero (Annelida, Clitellata, Naididae) in the urinary tract of reed frogs. Parasitol. Res. 2019, 118, 3359–3370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Andrews, J.M.; Childress, J.N.; Iakovidis, T.J.; Langford, G.J. Elucidating the Life History and Ecological Aspects of Allodero hylae (Annelida: Clitellata: Naididae), A Parasitic Oligochaete of Invasive Cuban Tree Frogs in Florida. J. Parasitol. 2015, 101, 275–281. [Google Scholar] [CrossRef] [Scilit]
Figure 1. LM micrographs of Ophidonais serpentina specimens from China. (A) Complete individual, (B) eyes, (C) coelomocytes, and (D) thin crust of foreign particles. Observed from 4×, 20×, 40×, and 10×, respectively.
Figure 1. LM micrographs of Ophidonais serpentina specimens from China. (A) Complete individual, (B) eyes, (C) coelomocytes, and (D) thin crust of foreign particles. Observed from 4×, 20×, 40×, and 10×, respectively.
Diversity 14 00265 g001
Figure 2. SEM micrographs of Ophidonais serpentina, specimens from China. (A) Peristomium; (B) needle; (C) papillae in the posterior of segments; and (DF) ventral chaetae in segments VII, III, and V, respectively. Scale bars: (A) 100 μm, (B) 5 μm, and (CF) 15 μm.
Figure 2. SEM micrographs of Ophidonais serpentina, specimens from China. (A) Peristomium; (B) needle; (C) papillae in the posterior of segments; and (DF) ventral chaetae in segments VII, III, and V, respectively. Scale bars: (A) 100 μm, (B) 5 μm, and (CF) 15 μm.
Diversity 14 00265 g002
Figure 3. Chaetae of Ophidonais serpentina. (A) Anterior ventral, (B) posterior ventral, and (C) needles. (D,E) The end of needles. Scale bars: (AB) 10 μm, (C) 20 μm, and (D,E) 5 μm.
Figure 3. Chaetae of Ophidonais serpentina. (A) Anterior ventral, (B) posterior ventral, and (C) needles. (D,E) The end of needles. Scale bars: (AB) 10 μm, (C) 20 μm, and (D,E) 5 μm.
Diversity 14 00265 g003
Figure 4. Phylogenetic trees obtained from the maximum likelihood (left) and Bayesian (right) analysis of the combined dataset.
Figure 4. Phylogenetic trees obtained from the maximum likelihood (left) and Bayesian (right) analysis of the combined dataset.
Diversity 14 00265 g004
Table 1. Comparison for two morphological groups of specimens.
Table 1. Comparison for two morphological groups of specimens.
No Needles GroupWith Needles Group
Specimens5311
Body length4–30 mm4–30 mm
N segments27–8438–87
First segment of needlesnonevariable, beginning at segment between XIV to XXXXV, lacking in most of the segments
Ventral chaetae of II segmentlength 150–178 μm, width 5 μmlength 150–178 μm, width 5 μm
Ventral chaetae of the remaining segmentlength 95–125 μm, width 5 μmlength 95–125 μm, width 5 μm
Papillaedorsal side, scattered, the beginning is variable most appear at the posterior segment; some individuals have abundant papillae, begin at X, then each segment has one papillafew, only appear at those segments have no needles
Table 2. Specimens and sequence used in this study, GenBank accession number and collection localities.
Table 2. Specimens and sequence used in this study, GenBank accession number and collection localities.
SpeciesCollection Site or Source; Collector16SCOIITS2H3
Ingroup
Allonais gwaliorensisMoat at Angor Wat, Cambodia; A. OhtakaKY633311 [3]KY633391 [3]KY633363 [3]-
Allonais inaequalisPacaya-Samiria Reserve, Peruvian Amazon, Peru; D. ShainDQ459952 [8]KY633390 [3]--
Allonais paraguayensisWard’s Natural Science (sold as Stylaria); A. E. BelyGQ355399 [9]AF534828 [10]--
Allonais pectinataEast Lake Scenic Area of Wuhan, China; W. jiangMN914711 [11]MN935212 [11]--
Branchiodrilus hortensisLake Tehang, Central Kalimantan, Indonesia; A. OhtakaKY633312 [3]KY633393 [3]KY633378 [3]-
Branchiodrilus semperiPond in Bogor Botanical Garden, Bogor, West Java, Indonesia; A. OhtakaKY633315 [3]KY633396 [3]KY633379 [3]-
Chaetogaster diaphanusLake Lången, Vårgårda, Sweden; C. ErséusDQ459956 [8]JQ519897 [12]KY633380 [3]-
Chaetogaster limnaeiSacramento, CA, USA; A. Bely/J. Sikes GQ355405 [9]KF952355 [13] --
Chaetogaster diastrophusHällekis, Götene, Sweden; C. ErséusJQ424952 [12]LT904771 [14]--
Dero borelliiExperimental biofilter, Manchester Metropolitan Univ.,UK; M. DempseyKY633324 [3]KY633385 [3]KY633364 [3]-
Dero digitataLake Lången, Vårgårda, Sweden; C. Erséus DQ459954 [8]KY633397 [3]KY633381 [3]MH744978 [15]
Dero furcataDitch, Fengshan, Kaohsiung, Taiwan; C.-R. LiKY633325 [3]KY633388 [3]-MH744979 [15]
Dero superterrenusEastern Melrose, Alachua Co., Fl., USA; D. Strom & M. WetzelKY633326 [3]KY633389 [3]--
Nais barbataLake Låttern, Vingåker, Sweden; C. Erséus JQ424993 [12]JQ519861 [12]--
Nais christinaeUpper Kenai River, Moose beach, AK, USA; L. Arsan & S. AtkinsonJQ424969 [12]JQ519824 [12]--
Nais stolciCharlottenlund, Ystad, Sweden; C. Erséus JQ425026 [12]JQ519894 [12]--
Ophidonais serpentina 1Xinkai River of Shaoxing, China; T. T. Zhou & J. F. YuOM033727OM033378OM033228SRR17607623
Ophidonais serpentina 2Xinkai River of Shaoxing, China; T. T. Zhou & J. F. YuOM033728OM033379OM033229SRR17607622
Ophidonais serpentina 3Xinkai River of Shaoxing, China; T. T. Zhou & J. F. YuOM033729OM033380OM033230SRR17607621
Ophidonais serpentina 4Xinkai River of Shaoxing, China; T. T. Zhou & J. F. YuOM033730OM033381OM033231SRR17607620
Ophidonais serpentina 5Xinkai River of Shaoxing, China; T. T. Zhou & J. F. YuOM033731OM033382OM033232SRR17607619
Ophidonais serpentina 6Xinkai River of Shaoxing, China; T. T. Zhou & J. F. YuOM033732OM033383OM033233SRR17607618
Ophidonais serpentina AKungsbackaån River, Kungsbacka, Sweden; S. Kvist &M. LindströmKY633327 [3]KY633398 [3]LN810239 [16]-
Ophidonais serpentina BSan Francisco Creek, San Mateo Co., California, USA; S. FendDQ459939 [8]LT903820 [14]KY633367 [3]-
Ophidonais serpentina CWildcat Creek, Richmond, CA, USA; A. Bely/J. SikesGQ355411 [9]KY633398 [3]KY633366 [3]-
Piguetiella blanciLake Jäsen, Orsa, Sweden; M. Lindström; C. Erséus KY633320 [3]KY633402 [3]KY633370 [3]-
Paranais botniensisViken, Höganäs, Sweden; C. Erséus KY633316 [3]KY633399 [3]KY633368 [3]-
Paranais friciRappahannock River (brackish), Middlesex Co., VA, USA; S. KvistKY633318 [3]KY633415 [3]KY633369 [3]-
Paranais litorailsRhode River, Edgewater, MD, USA; A. Bely/J. Sikes KY633319 [3]KY633401 [3]--
Slavina appendiculataLången Lake, near Alingsås, Västergötland, Sweden; C. ErséusAY885582 [17]KY633405 [3]KY633371 [3]-
Stylaria fossulariaKampong Chhnang, Lake Tonle Sap, Cambodia; A. OhtakaKY633322 [3]KY633408 [3]KY633374 [3]-
Specaria josinaeLake Lången, Vårgårda, Sweden; C. ErséusKY633321 [3]KY633407 [3]KY633372 [3]-
Stylaria lacustrisLake Lången, Vårgårda, Sweden; C. Erséus DQ459947 [8]KY633409 [3]KY633375 [3]-
Uncinais uncinataLången Lake, near Alingsås, Västergötland, Sweden; C.Erséus DQ459942 [8]KY633410 [3]KY633376 [3]-
Vejodovskyella comataLången Lake, near Alingsås, Västergötland, Sweden; C. ErséusAY885584 [17]KY633411 [3]KY633377 [3]-
Pristina aequisetaPaint Branch, College Park, MD, USA; A. Bely/J. SikesGQ355415 [9]GQ355374 [9]--
Pristina leidyiCarolina Biological Supply (sold as Stylaria).GQ355416 [9]AF534853 [10]--
Pristina longisetaLizard Island (freshwater), Great Barrier Reef, Queensland, Australia; C. ErséusGU901850 [18]GU902108 [18]--
Pristina minutusTjärnö, Strömstad, Sweden; C. Erséus DQ459958 [8]KJ753865 [19]--
Haemonais waldvogeliNaolihe wuxinghu River of Helongjiang, China; T. T. ZhouOM264280MW888774MW885234-
Outgroup
Rhyacodrilus coccineusLake Lången, Vårgårda, Sweden; C. Erséus DQ459931 [8]GU902110 [18]-KF267971 [13]
Rhyacodrilus falciformisVitärtskällan Spring, Kappelshamn, Gotland, Sweden; C. ErséusDQ459938 [8]KF267935 [13]-KF267970 [13]
Table 3. Primers and programs used for amplification and sequencing of fragments of the mitochondrial 16S and COI and nuclear ITS2 and H3 markers.
Table 3. Primers and programs used for amplification and sequencing of fragments of the mitochondrial 16S and COI and nuclear ITS2 and H3 markers.
GenePrimerSequence 5′-3′The Program of PCRReference
16S16SAR-LCGCCTGTTTATCAAAAACAT30 s at 98 °C; 10 s at 98 °C; 45 s at 60 °C; 35 cycles of 1 min at 72 °C; 2 min at 72 °C.Palumbi et al., 1991 [20]
16SBRHCCGGTCTGAACTCAGATCACGTPalumbi et al., 1991
COILCO1490GGTCAACAAATCATAAAGATATTGG30 s at 98 °C; 10 s at 98 °C; 45 s at 45 °C; 35 cycles of 45 s at 72 °C; 3 min at 72 °C.Folmer et al., 1994 [21]
HCO2198TAAACTTCAGGGTGACCAAAAAATCAFolmer et al., 1994
COI-ETATACTTCTGGGTGTCCGAAGAATCABely and Wray 2004 [10]
ITS2606FGTCGATGAAGAGCGCAGCCA30 s at 98 °C; 10 s at 98 °C; 45 s at 55 °C; 35 cycles of 45 s at 72 °C; 3 min at 72 °C.Liu, Erséus 2017 [22]
1082RTTAGTTTCTTTTCCTCCGCTTLiu, Erséus 2017
H3H3FATGGCTCGTACCAAGCAGACVGC5 min at 95 °C; 30 s at 95 °C; 30 s at 50 °C; 35 cycles of 90 s at 72 °C; 8 min at 72 °CBrown et al., 1999 [23]
H3RATATCCTTRGGCATKATRGTGACBrown et al., 1999
Table 4. Genetic distances of O. serpentina with allied species (15 sequences) based on 16S gene (up) and COI gene (down).
Table 4. Genetic distances of O. serpentina with allied species (15 sequences) based on 16S gene (up) and COI gene (down).
123456789101112131415
1. Slavina appendiculata 0.0240.0290.0330.0350.0400.0330.0350.0320.0280.0320.0320.0320.0340.031
2. Vejdovskyella comata0.131 0.0210.0310.0310.0330.0260.0280.0260.0250.0260.0260.0300.0270.029
3. Piguetiella blanci0.1500.131 0.0190.0230.0230.0290.0310.0290.0230.0290.0290.0270.0290.029
4. Specaria josinae0.1420.1420.114 0.0310.0290.0420.0440.0420.0380.0420.0420.0410.0420.042
5. Stylaria lacustris0.1570.1340.1260.143 0.0170.0310.0330.0310.0300.0310.0310.0320.0310.033
6. Stylaria fossularis0.1580.1320.1380.1340.114 0.0440.0440.0440.0400.0440.0440.0460.0440.046
7. Ophidonais serpentina 10.1320.1370.1200.1280.1310.147 0.0000.0000.0000.0000.0000.0000.0000.000
8. Ophidonais serpentina 20.1320.1370.1200.1280.1310.1470.000 0.0000.0000.0000.0000.0000.0000.000
9. Ophidonais serpentina 30.1320.1370.1200.1280.1310.1470.0000.000 0.0000.0000.0000.0000.0000.000
10. Ophidonais serpentina 40.1320.1370.1200.1280.1310.1470.0000.0000.000 0.0000.0000.0000.0000.000
11. Ophidonais serpentina 50.1370.1430.1240.1310.1340.1510.0000.0000.0000.000 0.0000.0000.0000.000
12. Ophidonais serpentina 60.1390.1440.1260.1310.1360.1470.0000.0000.0000.0000.000 0.0000.0000.000
13. Ophidonais serpentina A0.1310.1360.1200.1280.1300.1480.0000.0000.0000.0000.0000.000 0.0000.000
14. Ophidonais serpentina B0.1330.1380.1220.1270.1300.1470.0000.0000.0000.0000.0000.0000.000 0.000
15. Ophidonais serpentina C0.1310.1360.1200.1280.1300.1480.0000.0000.0000.0000.0000.0000.0000.000
Table 5. The differences in morphology of Ophidonais serpentina from different continents.
Table 5. The differences in morphology of Ophidonais serpentina from different continents.
InformationAsiaEuropeAmerica
Body length (mm)4–306–366
Segment27–12623–5162
Eyespresentpresentpresent or absent
Ventral chaetae in
length (μm)150–208152–179130–174
no./bundle2–52–62–4
teethdistal teeth shorter and thinnerdistal teeth shorter and thinnerequal, or distal teeth slightly longer
Ventral chaetae after
length (μm)152–168128–158100–130
no./bundle2–42–63–4
teethdistal teeth shorter and thinner in anterior, equal in posteriordistal teeth shorter than proximal teethequal, or distal teeth slightly shorter
Needle
length (μm)140–172150–168130
staring segmentVI, or absent, not clear in the specimens in ChinaVIVI
no./bundle111
no. of teeth1–2, sometimes 31–2saw-toothed
Penial chaetaetwo teeth closed, and the end swell and sagthe end swell and sagimmature
Habitatshallow lake, the surface of hydrophytesfreshwatercommon in rivers in North America, or live as parasites
ReferenceOhtaka and Iwakuma 1993; this studySperber 1948Spencer et al., 1993 [33]; Conn et al., 1994 [34]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yu, J.; Zhou, T.; Wang, H.; Cui, Y. First Record of Ophidonais serpentina (Müller, 1773) (Oligochaeta: Naididae) in China: The Occurrence or Absence of Needles Are Intraspecific Differences. Diversity 2022, 14, 265. https://doi.org/10.3390/d14040265

AMA Style

Yu J, Zhou T, Wang H, Cui Y. First Record of Ophidonais serpentina (Müller, 1773) (Oligochaeta: Naididae) in China: The Occurrence or Absence of Needles Are Intraspecific Differences. Diversity. 2022; 14(4):265. https://doi.org/10.3390/d14040265

Chicago/Turabian Style

Yu, Jiefeng, Tingting Zhou, Hongzhu Wang, and Yongde Cui. 2022. "First Record of Ophidonais serpentina (Müller, 1773) (Oligochaeta: Naididae) in China: The Occurrence or Absence of Needles Are Intraspecific Differences" Diversity 14, no. 4: 265. https://doi.org/10.3390/d14040265

APA Style

Yu, J., Zhou, T., Wang, H., & Cui, Y. (2022). First Record of Ophidonais serpentina (Müller, 1773) (Oligochaeta: Naididae) in China: The Occurrence or Absence of Needles Are Intraspecific Differences. Diversity, 14(4), 265. https://doi.org/10.3390/d14040265

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop