Next Article in Journal
Silica-Scaled Chrysophytes of Teletskoye Lake and Adjacent Area with a Description of a New Species from the Genus Mallomonas
Next Article in Special Issue
Haemosporidians in Non-Passerine Birds of Colombia: An Overview of the Last 20 Years of Research
Previous Article in Journal
Regulatory Processes in Populations of Forest Insects (A Case Study of Insect Species Damaging the Pine Pinus sylvestris L. in Forests of SIBERIA)
Previous Article in Special Issue
What Can Haemosporidian Lineages Found in Culicoides Biting Midges Tell Us about Their Feeding Preferences?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nematode and Acanthocephalan Parasites of Confiscated Sunda pangolins, Manis javanica Desmarest, 1822 (Mammalia: Pholidota: Manidae), with an Updated List of the Parasites of Pangolins

1
School of Agricultural, Environmental and Veterinary Sciences, Charles Sturt University, Wagga Wagga, NSW 2678, Australia
2
Veterinary Services, Ocean Park Corporation, 180 Wong Chuk Hang Road, Aberdeen, Hong Kong SAR, China
3
State Key Laboratory of Emerging Infectious Diseases, School of Public Health, The University of Hong Kong, Hong Kong SAR, China
4
NSW Department of Primary Industries, Wagga Wagga Agricultural Institute, Wagga Wagga, NSW 2650, Australia
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(12), 1039; https://doi.org/10.3390/d14121039
Submission received: 25 October 2022 / Revised: 22 November 2022 / Accepted: 23 November 2022 / Published: 27 November 2022
(This article belongs to the Special Issue Diversity of Wildlife Pathogens)

Abstract

Background: The Sunda pangolin, Manis javanica Desmarest, 1822, is a critically endangered species of pangolin that occurs from Indonesia to southern China. Knowledge of the biology and ecology of M. javanica is limited, however there have been previous reports of parasites, including nematodes, protozoans, ticks, and a cestode. Methods: An illegal shipment of 88 M. javanica carcasses, originally collected from wild populations throughout southeast Asia, were intercepted by Hong Kong border authorities (AFCD) and confiscated in 2018. Results: During necropsy, two different types of parasites were collected from four infected pangolins. The parasites were identified as the nematode Gendrespirura cf. zschokkei (Meyer, 1896) Chabaud 1958, which were embedded in the stomach wall, and the acanthocephalan, Oligacanthorhynchidae sp., collected from the intestine. Morphological descriptions and molecular characterization for each parasite type is provided. Conclusions: In addition, an updated list of parasites from pangolins, incorporating current taxonomic identifications and publications is presented.

1. Introduction

The Sunda pangolin, Manis javanica Desmarest, 1822, is one of four species of pangolin that occur in the Asian area, with a distribution from Indonesia to southern China and is listed as critically endangered due, primarily, to hunting for meat and traditional medicines [1,2]. Manis javanica is an arboreal, solitary nocturnal animal with a diet dominated by ants and termites [1]. Even with the unfortunate legacy of being the most trafficked animal in the world [1], little information is known about the biology and ecology of most species of pangolin in the wild [2,3].
Although a range of parasites and bacteria have been reported from pangolins [3,4], only five species of nematodes were reported from M. javanica by Mohapatra et al. [3] and Wicker et al. [4]: the blood-borne filarial Brugia malayi S.L. Brug, 1927 and Brugia pahangi (Buckley and Edeson, 1956), the intestinal Necator americanus Stiles, 1902, a strongyle-type nematode and a larval Gendrespirura sp. However, Gendrespirura (originally reported as Habronema) hamospiculata (Neveu-Lemaire, 1927) had also been reported from M. javanica in Vietnam [5] and Borneo [6]. In addition to the nematodes, Mohapatra et al. [3] and Wicker et al. [4] also recorded protozoans (Babesia spp. and Eimeria spp., including E. tenggilingi Else and Colley, 1976), bacteria (Anaplasma pangolinii Koh, Koh, Panchadcharam, Sitam and Tay, 2016, Mycoplasma sp.) and a number of ticks (Amblyomma cordiferum Neumann, 1899, Amblyomma javanense Supino, 1897, Amblyomma (was Aponomma) variensis (Supino, 1897)) from M. javanica. Since these checklists, a further three reports of parasites and bacteria from M. javanica have been published: the tick A. javanense transmitting the bacterium Ehrlichia spp. [7], the blood-borne protozoan Babesia spp. [8], and the intestinal nematode, Ancylostoma sp. [9]. Of the intestinal nematodes, N. americanus and Ancylostoma sp. are common parasites of various mammals, including humans [9,10]. The larval stage of Gendrespirura sp. caused polypoid gastritis in a captive M. javanica [3,11], and due to being a larval stage, was not able to be identified any further. The adult G. hamospiculata described by Hsü [5] were collected from a single M. javanica with no record of any associated pathology. The report by Myers and Kuntz [6] contained no information with regard to infection level or effect on the host. Rescued M. javanica in southern China have been reported to be infected with ectoparasites and some had evidence of infection with internal parasites, although no identification of the parasites had been attempted [2].
No species of acanthocephalan were listed by Mohapatra et al. [3] and Wicker et al. [4] only included three reports, although there were a number of records of acanthocephalans infecting pangolins [12,13,14]. Nephridiacanthus (originally reported as Nephridiorhynchus) palawanesis (Tubangui and Masiluñgan, 1938) was originally reported from M. javanica in the Philippines [12], however it is now recognised that M. javanica does not occur in the Philippines [1], so this record needs to be assigned to the Philippine pangolin, Manis culionensis (de Elera, 1915). Two other acanthocephalans, Nephridiacanthus (originally reported as Oligacanthorhynchus) gerberi (Baer, 1959) and Nephridiacanthus (originally reported as Oligacanthorhynchus) manisensis Meyer, 1931, collected from Smutsia gigantea (Illiger, 1815) and Phataginus tricuspis Rafinesque, 1821, respectively, in Africa were also reported [14]. Paraprosthenorchis ornatus Amin, Van Ha and Heckmann, 2008 was described from Manis pentadactyla Linnaeus, 1758 collected in northern Vietnam [13]. Subsequent to the checklists there have been additional records of an acanthocephalan (Intraproboscis sanghae Amin, Heckmann, Sist and Basso, 2021) from African pangolins [15,16]. However, at this point, there are no records of acanthocephalans infecting M. javanica.
An illegal shipment of M. javanica carcasses, with origins determined to be from wild populations throughout southeast Asia (based on results provided in Worthington et al. (In Review)), were intercepted by Hong Kong border authorities and the Agriculture, Fisheries and Conservation Department (AFCD) of the Government of the Hong Kong SAR and confiscated in 2018. During necropsy, parasites were found in the intestinal system and are presented here.

2. Materials and Methods

A total of 88 carcasses were intercepted and were frozen until necropsied. At the time of necropsy, it was noted that each body had been descaled and cleaned, with the internal organs removed, bagged and placed inside the abdominal cavity (Figure 1). As the carcasses had been frozen, this prevented histological examination of organs and collection of blood samples; internal organs and the intestinal system were examined grossly. The overall body condition of the pangolins was noted as healthy, with body condition scores of 4/5.
Parasites were collected and preserved in 80% ethanol and sent to the Shamsi Parasitology Laboratory at Charles Sturt University, Australia, for identification.
Parasites were examined under a dissector microscope and identified to type prior to excision of a small piece of tissue for molecular characterisation. The remaining sections of parasites were mounted in lactophenol/glycerol for morphological characterisation.
Measurements were made using a micrometer eyepiece. Photographs were taken using a 9-MP microscope digital camera (AmScope Model MU900, USA). Parasite specimens have been deposited in the Australian Helminthological Collection at the South Australian Museum.

Molecular Analysis

Genomic DNA was extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Three gene regions were attempted for both species, including small subunit ribosomal RNA (18S rRNA), Internal Transcribed Spacer (ITS) and Cytochrome c oxidase I (CoxI). PCR amplification was only successful for the 18S region for Oligacanthorhynchidae sp. and the CoxI gene for Gendrespirura cf. zschokkei using the primer pairs (SSU_F04 GCTTGTCTCAAAGATTAAGCC [17] and 1270R CCGTCAATTCCTTTAAGTTT [18]), and (NTF TGATTGGTGGTTTTGGTAA and NTR ATAAGTACGAGTATCAATATC [19]), respectively. PCR were conducted in a 25 µL system containing 1× buffer, 2.5 mM MgCl, 0.4 μM of each dNTP, 500 nM of each primer and 0.25 μL of GoTaq polymerase (Promega, Madison, WI, USA). PCR cycles were initiated with a 95 °C denaturing for 2 min, followed by 40 cycles of 95 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min. The cycle is concluded with a final extension at 72 °C for 10 min. The PCR products were checked by electrophoresis and single band products were sequenced with the same primer at Australian Genome Research Facility (Brisbane). All our sequences were quality checked in the original chromatogram using SeqMan Pro ver. 8.1.0(3) (DNASTAR, Inc.). Primers were removed from the sequences and all mutations were double-checked. Sequences of closely related species were obtained from GenBank and aligned using MAFFT [20]. HKY + G and GTR + G were chosen as the best fit evolutionary model for Oligacanthorhynchidae sp. and G. cf. zschokkei using Jmodeltest 2 [21]. Phylogenetic trees were inferred using MrBayes [22] with 2,000,000 generations and visualized by Figtree V 1.4.3 [23]. Sequences generated in this study were deposited in GenBank with accession numbers OP605522 (Oligacanthorhynchidae gen. sp.) and OP618835-OP618841 (G. cf. zschokkei).

3. Results

Two different types of parasites were collected from the intestinal systems of 4 of the 88 pangolin carcasses (Table 1). Two pangolins were infected with nematodes, identified as Gendrespirura cf. zschokkei, which were collected from the stomach, and two were infected with acanthocephalans, identified as Oligacanthorhynchidae sp., collected from the intestine.
Phylum Nematoda
Family Habronematidae Ivaschkin, 1961
Genus Gendrespirura Chabaud, 1958
Gendrespirura cf. zschokkei (Meyer, 1896) Chabaud 1958
Host: Manis javanica Desmarest, 1822
Locality: Southeast Asia: Borneo
Site of infection: Stomach
Museum specimens: Voucher specimens: AHC 49285-49286
Description (Figure 2 and Figure 3; Table 2)
General. Body stout, medium-sized. Cuticle faintly transversely striated along entire body length (Figure 2B). Lateral alae absent. Cephalic region (Figure 2A) with two large lateral pseudolabia, each with three teeth on inner surface; central tooth more prominent than lateral teeth; two small lips; single pair subventral amphids. Buccal capsule cylindrical, well-developed, strongly chitinised. Oesophagus long, with shorter narrow muscular portion and longer wider glandular portion. Cervical papillae anterior to nerve ring; excretory pore posterior to nerve ring.
Female (based on 2 mature specimens and 4 immature specimens; Figure 2): Vulva in anterior part of body; small circular opening (Figure 2C). Vagina backwards from vulva with single uterus in most of body space. Mature eggs small, with thick wall, polar ends with thickened cuticle forming raised hoops, giving a barrel-like appearance (Figure 2E). Immature eggs without thickened hoops (Figure 2D). Tail curved, with blunt rounded end; phasmids near tip (Figure 2B); ratio of tail length to total length 0.016 (0.013–0.021)
Male (based on a single specimen; Figure 3): Posterior extremity spirally coiled, caudal alae well developed, symmetrical. Four pairs of preanal pedunculate papillae (Figure 3C), 1 pair of preanal sessile papilla, and 2 pairs post-anal papillae (Figure 3A). Pre-anal and post-anal pedunculate papillae approximately equal in size, 32 (28.25–35) μm long by 31 (27.5–37.5) μm wide. Spicules uneven (Figure 3B); left spicule very long and slender with terminal hook (ratio of length of spicule to total length 0.254); right spicule short and stout (ratio of length of spicule to total length 0.054); ratio of length of left spicule to right spicule 4.69. Gubernaculum present. Cluster of 5 pairs of small papillae present at posterior extremity (Figure 3A). Posterior papillae 7.5 μm long. Cloacal region, and ventral surface of body immediately anterior, covered with small cuticular elongate ridges or bosses (Figure 3D); post-cloacal median region covered with small cuticular rounded bosses.
Molecular characterization: Only Cox1 sequences were successfully obtained from seven specimens of G. cf. zschokkei. The length of the Cox1 sequences is 649 bp. The intraspecific variation ranged from 0–0.22% among the sequences. There are no other sequences for species of Gendrespirura available in GenBank. Gendrespirura cf. zschokkei sequences formed a highly supported and distinct group in the phylogenetic tree (Figure 4A) and were closely related to Tetrameres grusi (Shumakovich, 1946), collected from red-necked cranes in China [29] within a clade of species of Habronema Diesing, 1861.
Phylum Acanthocephala
Family Oligacanthorhynchidae Southwell and Macfie, 1925
Oligacanthorhynchidae sp.
Host: Manis javanica Desmarest, 1822
Locality: Southeast Asia: Borneo and Java
Site of infection: Intestine
Museum specimens: Voucher specimens: AHC 49287-49288
Description (Figure 5)
General. Trunk long, slender, anterior end narrower than posterior end, usually fixed with numerous transverse wrinkles. Proboscis subspherical (Figure 5A), 300 long, 340 wide. Proboscis hooks arranged in 5 longitudinal rows of 6 hooks each, giving about 30 hooks in total. Hooks gradually decreasing in size from anterior to posterior with anterior hook 60 long, posterior hook 40 long. Hooks, not barbed, with flange giving hook overall globular appearance, in papillae in proboscis (Figure 5B).
Male specimens not collected.
Female (based on 2 mature specimens and 2 immature specimens): Trunk > 20 cm long, 3–5 mm wide. Uterine bell present. Mature eggs dissected from body oval, 72.5 (65–80) μm long by 45 (50–50) μm wide (Figure 5D).
Molecular characterization: Only 18S sequence was obtained from a single specimen of Oligacanthorhynchidae sp. The length of the 18S sequences was 1022 bp. The phylogenetic tree placed the sequence obtained in this study as basal to a group containing a number of Archiacanthocepahalans, including I. sanghae, collected from the African pangolin, Phataginus tetradactyla (Linnaeus, 1766) [16] (Figure 4B). However, the support for the groupings was not high, and the phylogenetic relationship among the species within the family are not resolved.

4. Discussion

This study presents two species of intestinal helminths from the critically endangered M. javanica from Southeast Asia which updates the number of intestinal helminths reported from this host to nine [3,5,6,9,30].
Habronematoid nematodes have been collected from various species of pangolin under a variety of generic names. The nematode Filaria zschokkei Meyer, 1896 was collected from the intestinal system of M. pentadactyla collected in Sri Lanka [25] with notes of an earlier finding of a “vast number of the Ascaris genera” present within a stomach cyst (by Jansson, 1830 in [25]). This record was subsequently referred to as Ascaris manidis Diesing, 1851, but this was refuted as, without a formal description, whether the nematodes were ascarids or habronematids remained unknown [28,31]. Spiroptera orca von Linstow, 1906 was subsequently reported from the stomach of M. pentadactyla, also collected in Sri Lanka [27], with an immature F. zschokkei from the peritoneum of M. pentadactyla also listed (Esslinger [32], however, stated that von Linstow [27] examined specimens that had been collected by Meyer [25], so this was not a new record). Esslinger [32] stated that the specimens of F. zschokkei collected by Meyer [25] were more likely a spiruroid, not a filaroid, based on the description, but did not officially transfer the species. Nematodes collected from Temminck’s pangolin, Smutsia temminckii (Smuts, 1832), in Africa, were originally referred to S. orca (Monnig (1924) in [28]). Subsequently, however, with fresh collections, nematodes collected from S. temminckii were determined to be a different species, Protospirura hamospiculata Neveu-Lemaire, 1927 [24]. All these nematodes listed above were then referred to the genus Habronema [28]. The African specimens were considered to be the single species, Habronema hamospiculatum (Neveu–Lemaire, 1927), while the specimens reported by von Linstow [27] (Baylis [28] did not refer to the specimens from Meyer [25]) were also considered to belong to the same genus, despite a very different described egg morphology. The eggs for H. hamospiculatum were slightly asymmetrical and flattened at the poles [28], whereas the eggs for the von Linstow [27] specimens had thickened ridges at the polar ends of the eggs, forming raised hoops and giving a “barrel-like” appearance. Specimens of H. hamospiculatum from M. javanica were collected from the area of Ho Chi Minh City, Vietnam [5], with differences from the description provided for the African species [28] noted with regard to the teeth morphology and location of vulva opening. Habronema hamospiculatum was also reported from M. javanica collected in Borneo with no description provided [6]. Nematodes collected from P. tricuspis in Africa were named Habronema congolese Vuylsteke, 1936 but were found to be identical to the specimens collected by Neveu-Lemaire [31]. Baylis [33], once aware of the specimens from Meyer [25], subsequently referred all the Asian specimens to Habronema zschokkei (Meyer, 1896). Similar barrel-shaped eggs had been reported [25] and were also reported for nematodes collected from M. pentadactyla in southern China, with the description of Chenospirura kwangtungensis Kou, 1958 [26]. The genus Gendrespirura Chabaud, 1958 was erected for species with an elongated buccal capsule and two strong median teeth that parasitised toothless mammals (pangolins and aardvarks) [27]. Gendrespirura hamospiculata (Neveu-Lemaire, 1927) was designated as the type species, although the validity of the species was questioned due to inconsistencies in the description of the tip of the left copulatory spicule and the observation of barrel-like eggs in nematodes collected from an African pangolin [31]. As the description of the eggs was the character differentiating the African and Asian species [28], this was considered no longer valid as a differentiating characteristic, but the species were not formally synonymized [31]. Chenospirura kwangtungensis was not included in the initial generic description [31], but was later included within the synonymies of Gendrespirura [34]. Only one species within the genus Gendrespirura is currently listed [35], but without details or explanation. However, if the species are to be synonymized, G. zschokkei (Meyer, 1896) should be the designated species due to the International Code of Zoological Nomenclature Principle of Priority. Consequently, the specimens collected in this study are referred to G. cf. zschokkei.
We concur that Gendrespirura is a valid genus, however further research is required to re-examine the various “species” of nematodes described from the different host species in their geographical locations. For example, many of the Asian specimens were described from M. pentadactyla in Sri Lanka [25,27]. This species of pangolin is no longer recognised in Sri Lanka [1] and these records must now be referred to the Indian pangolin, Manis crassicaudata E. Geoffroy, 1803. Similarly, although the overall body measurements of the specimens collected in this study matched those for the H. hamospiculatum described by Hsü [5], the measurements for the left spicule were much larger than for the description of P. hamospiculata [24] (Table 3). Although this is not enough to justify the erection of a new species, the potential for different species of nematodes to be infecting the different species of pangolins is a possibility (see Table 2 and Table 3 for comparison of measurements across the different hosts), and future research may determine the nematodes in M. javanica to be a new species. Future research should attempt to obtain molecular sequences for specimens from all pangolin hosts across a broad geographic distribution to determine if there is only the one species infecting all. At the present time the only molecular sequences for a species of Gendrespirura are those obtained in this study. Given the possible pathological implications of infection with these nematodes [11], a better understanding of the actual species infecting the hosts is required.
The molecular results obtained placed the specimens sequenced in this study as sister to species of Tetrameres Creplin, 1846 within a clade of species of Habronema. However, without sequences from other habronematid nematodes collected from pangolins a more detailed phylogenetic analysis is not possible. The life cycle of Gendrespirura has not yet been documented [36]. However, the life cycles of species of Habronema involve transmission by muscid flies, with infective larvae being released onto the host’s face (e.g., near the mouth or nose) as the fly feeds [36]. From there, the larvae move into the mouth, are swallowed and develop within the stomach of the host, where females occur in small tumours in the stomach wall [36], similar to previous reports [11] and what was found in this study. The life cycle of terrestrial species of Tetrameres, the genus which grouped with G. cf. zschokkei in the phylogenetic tree, utilises insects as intermediate hosts, which are ingested by the definitive hosts [36]. Similar to the other genera, species of Tetrameres embed in gastric glands within the proventriculus of their bird hosts [36]. Given the predominant ant and termite diet of pangolins [1], it is possible that these are the intermediate hosts; however, given the low occurrence of these parasites (for example, only 2 of 88 M. javanica were infected), the intermediate hosts may be other insects which are incidentally ingested [37] or are muscid flies as for Habronema.
Acanthocephalans have been infrequently reported from pangolins, with all but one species belonging to the family Oligacanthorhynchidae [13,15], but none were listed in the checklist of Mohapatra et al. [3]. Within Asia, the two reported acanthocephalan parasites, N. palawanensis from M. culionensis [12] and P. ornatus from M. pentadactyla in Vietnam [13], are both within the family Oligacanthorhynchidae, as are the specimens collected in this study. However, due to the condition of the specimens collected (faecal extrusion and pulled from the small intestine) and the lack of male specimens, combined with the unique structure of the proboscis hooks, they cannot be identified to any genus so far described within the Oligacanthorhynchidae [38]. Acanthocephalans within this group are renowned for penetration of the intestinal wall, causing secondary septic peritonitis [16]. Given the diet of pangolins, it is not surprising that they are infected with acanthocephalans which are known to utilise insects, such as ants and termites, as intermediate hosts [13].
The molecular results found in this study suggested support for previous phylogenetic analyses of acanthocephalans [39,40], finding the representatives of the Archiacanthocephala to be monophyletic. However, the values of support for the various branches were low. The results of our analyses, however, did show that the Oligacanthorhynchidae sp. collected from M. javanica was separate to all other available sequences. The only other acanthocephalan from a pangolin that has been sequenced, I. sanghae [16] to be closest to Moniliformis moniliformis (Bremser, 1811), collected from a laboratory rat [41], which was supported in the phylogenetic analyses in this study. As for the nematodes, future research should concentrate on the collection of molecular sequences across a range of genes to determine the range of acanthocephalan species across the various host species.
Wicker et al. [4] found that the prevalence of parasites in recently capture pangolins is extremely high, causing fatalities in debilitated animals. The low level of infection with parasites found in this study should be treated with caution as the history of the animals prior to examination is not known. It is possible that pangolins are kept in captivity prior to their illegal trade, either as live or dead animals [1], thus it is possible that, through a combination of time in captivity, change in diet and/or other physiological factors (e.g., stress) that the parasite levels found are not reflective of wild populations. Additionally, due to the treatment of the carcasses prior to necropsy, a full necropsy (including histological examination and blood samples) could not be performed. Thus, it is very likely that a number of parasites may have been overlooked during the examination.

Helminth Parasites of Pangolins: An Updated List of Species

The taxonomic history of most parasites reported from pangolins is complicated, especially with changes in host taxonomy. As such, some of the parasite taxonomy presented in Mohapatra et al. [3] and Wicker et al. [4] is incorrect. Although not directly related to this study, we have included them here to ensure that knowledge regarding the parasites of pangolins is as up to date as possible (Table 4; Supplementary Table S1) and to attempt to unravel some of the complex, and complicated, taxonomy that researchers may come across.
Nematodes of the superfamily Trichostrongyloidea have been reported from a number of pangolins under a variety of generic names. Strongylus costatus Meyer, 1896, was originally reported from M. pentadactyla in Sri Lanka [25]. Following collection of specimens in China, this was subsequently referred to Trichoskrjabinia costata (Meyer, 1896) [54]. However, as the genus Trichoskrjabinia Travassos, 1937 was a reptile-specific nematode, this was later referred to Manistrongylus meyeri [55]. Prior to that, however, Trichochenia mucronata Singh, 1958, was described from a pangolin in India [48; the pangolin was listed as a M. pentadactyla that had died in captivity in the animal house at Osmania University, Hyderabad, India without indicating its actual geographic origin; however, as Hyderabad was listed as the collection locality, this species is referred to M. crassicaudata, pending further research]. At the same time, reference was made to three species collected from M. pentadactyla in China: T. cantonensis Kou, 1958, T. papillosa Kou, 1958 and T. manisa Kou, 1958, although the third species was considered a synonym of T. cantonensis [48]. It was also suggested that S. costatus was most likely a species of Trichochenia Kou, 1958, but further work was required to confirm this [48]. Two trichostrongyles, Manistrongylus manidis Baer, 1959 and Pholidostrongylus armatus Baer, 1959, were subsequently described from P. tricuspis in the Democratic Republic of Congo [50]. Trichochenia conincki Chabaud, Bain and Puylaert, 1967 was then described based on a single male specimen collected from a P. tricuspis in Gabon in a co-infection with T. rousseloti Biocca, 1959, both of which were found in faecal material attached to the external surface of cestodes [44,56]. Additional specimens collected in Sri Lanka (Naidu and Naidu, 1981 in [4]) were referred to Trichochenia meyeri (Travassos, 1937). Durette-Desset [57] listed the genera Manistrongylus (there were two separate descriptions for this genus by Baer, 1959 [50] and Cameron and Meyers, 1960 [55]; both were included within the synonymy) and Pholidostrongylus Baer, 1959 as synonyms of Trichochenia. Subsequently, 5 species of Trichochenia were listed from Asian pangolins (T. meyeri, T. mucronata, T. cantonensis, T. manisa and T. papillosa) and 4 species from African pangolins (T. manidis (Baer, 1959), T. armata (Baer, 1959), T. rousseloti and T. conincki) [44]. Mainspinostrongylus Kalyanker and Palladwar, 1989 was erected for nematodes collected from “M. crassifialia” in India [58]; this is a misspelling of the host species and should be corrected to M. crassicaudata. Mainspinostrongylus was moved, due to its similarity with Trichochenia, into the family Molineidae within the Trichostrongyloidea [58]. Mainspinostrongylus is currently listed with 1 valid species, M. crassifialia, see [59] (within the subfamily Trichostrongylinae) and Trichochenia is currently listed with only 3 valid species (T. costata, T. meyeri, and T. rousseloti (see [60]) (within the subfamily Molineinae) within the family Trichostrongylidae [35]. No information on the fates of the other species could be found. Thus, with regard to the records presented by Mohapatra et al. [3], Mohapatra et al. [61] and Wicker et al. [4], the records of Manistrongylus meyeri from M. pentadactyla and T. meyeri from M. crassicaudata, should both be referred to as T. meyeri, following the current taxonomic knowledge. The other species of Trichochenia have been listed in Table 4 until knowledge of their true taxonomic status is found. It is apparent, however, that the trichostrongyloid fauna of pangolins needs urgent re-examination, with new specimens collected for molecular characterisation in combination with morphological measurements to ensure an accurate understanding of the number and distribution of species.
Chenofilaria filaria Kou, 1958 was described from M. pentadactyla in China [53,61]. Dipatelonema fausti Esslinger, 1966 was subsequently reported from the same host species, also in China (as listed in [3]), but there was no mention of the earlier description. Both species were subsequently synonymised and placed within Acanthocheilonema (Chenofilaria) Cobbold, 1870, which comprised of species described from pangolins and Australian marsupials [43].
Leipernema leiperi Singh, 1976 was originally described from a M. pentadactyla that had died in captivity in India [47]. As for T. mucronata [48], the origin of the pangolin was not stated but the collection locality was given as Hyderabad and this record has been referred to M. crassicaudata. The report of Strongyloides sp. attributed to Singh [47] by Mohapatra et al. [3] is actually a misrepresentation of the information provided where the specimens were referred to as resembling Strongyloides sp. [47]. Wicker et al. [4] did not refer to the record of Strongyloides sp. (and mis-referenced the L. leiperi record as Singh (2009)) but did refer to a report as “Strongyle type” [62] which is how it is referred to in Table 4.
The only cestode listed by Mohapatra et al. [3] was the larval stage of Echinoccocus sp. infecting M. crassicaudata. Wicker et al. [4] listed a number of cestodes infecting pangolins, although with some incorrect taxonomy and host–parasite records as described below.
The taeniid cestode, Davainea contorta Zschokke, 1895, was reported as a parasite of M. crassicaudata (as M. pentadactyla) in Sri Lanka [25]. This species was subsequently transferred to the genus Raillietina Fuhrmann, 1920 and reported from M. javanica [45]. The genus Diorchiraillietina Yamaguti, 1959 was erected with a single species, D. contorta (Zschokke, 1895), within the Family Davaineidae [63], for these records. Diorchiraillietina contorta was also reported in M. javanica collected from Malaysia [30].
Five species of cestodes collected from African pangolins were described: Raillietina bovieni Baer and Fain, 1956 from M. javanica from Indonesia; Raillietina anoplocephaloides Baer and Fain, 1956 from P. tricuspis and S. gigantea from Ivory Coast, Rwanda and Burundi; R. rahmi Baer and Fain, 1956 from P. tricuspis from Ivory Coast; Metadavainea aelleni Baer and Fain, 1956 from P. tricuspis and S. gigantea from Ivory Coast, Rwanda and Burundi; and Hymenolepis manidis Baer and Fain, 1956 from S. gigantea from Rwanda and Burundi [45]. The Ivory Coast specimens were provided by Rahm [64] to Baer and Fain [45] for description and have mistakenly been attributed to infecting P. tetradactyla by Wicker et al. [4]. The genus Baerfainia Yamaguti, 1959 was erected with the single species B. anoplocephaloides to replace R. anoplocephaloides [46]; the possibility that this species belonged to a different genus had been flagged [45], due to differences in the morphology of the scolex, but the differences were not considered sufficient at the time. Baerfainia has been transferred to different families based on its unusual reproductive structures [64] but has been returned to the family Davaineidae due to its close resemblance to the other cestodes described from pangolins [63,65]. The genus Manitaurus Spasskaya and Spasski, 1971 was erected for R. rahmi [65]. Jones and Bray [65] refuted a synonymy of this genus with Diorchiraillietina (by Schmidt in 1986) due to differences in the number of eggs per segment and confirmed Manitaurus as a valid genus (see [63]).
Specimens of a Metadavainea sp. were collected from S. teminckii in Nigeria with a 38% infection across six pangolins, and a mean intensity of 22 cestodes per infected host animal [52]. A novel species of Raillietina was also reported [42] from M. pentadactyla in China; no morphological description was provided. This was the first molecular sequence provided for a cestode collected from a pangolin, which confirmed its placement within the family Davaineidae.
Inermicapsifer rhodiensis Mettrick, 1959 (family Anoplocephalidae) was described from P. temminckii in Zimbabwe [51] but this report has not beein included in either of the previous checklists. Chabaud et al. [44] also reported cestodes in P. tricuspis in Gabon, Africa (the nematodes that were described were originally found in faecal matter attached to the cestodes); however, no name or description of the cestodes was provided.
Although reporting parasites from M. javanica, Zhang et al. [49] did not provide identifications. They did, however, provide photographs which could be identified to parasite type: the intestinal parasite (Figure 5A in 2) was a cestode (identifiable by the body segmentation) and the mesenteric parasite (Figure 5B in 2) appeared to be a larval pentastomid (identifiable by shape and body segmentation). Additional larval pentastomids have also been reported from S. temminckii [64] and P. tricuspis [4].
Interestingly, many of the cestode genera listed above have representatives that are zoonotic [66]. Additionally, the pentastomid genus Armillifer Sambon, 1922 (as found in S. temminckii), is also zoonotic [67]. As described herein, the taxonomic history of many of these species is complicated and combined with a lack of molecular data to help differentiate species [63], their true zoonotic potential may not be realised [66]. As human–wildlife interactions increase, the possibility of zoonotic infections with these parasites, especially due to the amount of traffic of pangolin meat, will also increase [66,68,69].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d14121039/s1, Table S1: List of synonyms of parasite names mentioned in the text. Original parasite names are listed alphabetically.

Author Contributions

Conceptualization, D.P.B. and P.M.; methodology, B.M.W., P.M., D.P.B. and X.Z.; formal analysis, D.P.B.; investigation, D.P.B., P.M.; resources, S.S.; data curation, D.P.B. and X.Z.; writing—original draft preparation, D.P.B.; writing—review and editing, all authors; project administration, D.P.B. and T.T.-Y.L.; funding acquisition, T.T.-Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Research Impact Fund (R7021-20) and Collaborative Research Fund (C7144-20GF) University Grants Committee, Hong Kong Special Administrative Region (HKSAR), as well as the Health and Medical Research Fund (COVID190223), Food and Health Bureau of HKSAR.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Seized pangolin carcasses were donated for use in this study by the Agriculture, Fisheries and Conservation Department (AFCD) of the Government of the Hong Kong SAR. The authors are grateful to the Veterinary Department, Ocean Park, Hong Kong for their necropsies of the pangolin carcasses.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. IUCN. The IUCN Red List of Threatened Species. Version 2022-1. Available online: https://www.iucnredlist.org (accessed on 8 March 2022).
  2. Zhang, F.; Yu, J.; Wu, S.; Li, S.; Zou, C.; Wang, Q.; Sun, R. Keeping and breeding the rescued Sunda pangolins (Manis javanica) in captivity. Zoo Biol. 2017, 36, 387–396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Mohapatra, R.K.; Panda, S.; Nair, M.V.; Acharjyo, L.N. Check list of parasites and bacteria recorded from pangolins (Manis sp.). J. Parasit. Dis. 2016, 40, 1109–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Wicker, L.V.; Lourens, K.; Hai, L.K. Veterinary health of pangolins. In Pangolins: Science, Society and Conservation; Challender, D.W.S., Nash, H.C., Waterman, C., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 461–493. [Google Scholar]
  5. Hsü, H.F. A study of some parasitic nematodes from Tonkin, Indo-China and of Strongyluris brevicaudata Mueller, 1894 from Hainan Island, South China. Peking Nat. Hist. Bull. 1932, 7, 99–115 + Plates I–III. [Google Scholar]
  6. Myers, B.J.; Kuntz, R.E. Nematode parasites of mammals (Dermoptera, Primates, Pholidota, Rodentia, Carnivora, and Artiodactyla) from North Borneo (Malaysia). Can. J. Zool. 1969, 47, 419–421. [Google Scholar] [CrossRef] [Scilit]
  7. Zhai, J.; Wu, Y.; Chen, J.; Zou, J.; Shan, F.; Li, W.; Chen, W.; Zhou, N. Identification of Amblyomma javanense and detection of tick-borne Ehrlichia spp. in confiscated Malayan Pangolins. Int. J. Parasitol. Parasites Wildl. 2021, 14, 107–116. [Google Scholar] [CrossRef] [Scilit]
  8. Yodsheewan, R.; Sukmak, M.; Sangkharak, B.; Kaolim, N.; Ploypan, R.; Phongphaew, W. First report on detection of Babesia spp. in confiscated Sunda pangolins (Manis javanica) in Thailand. Vet. World 2021, 14, 2380–2385. [Google Scholar] [CrossRef] [Scilit]
  9. Tuli, M.D.; Li, H.; Li, S.; Zhai, J.; Wu, Y.; Huang, W.; Feng, Y.; Chen, W.; Yuan, D. Molecular detection of a novel Ancylostoma sp. by whole mtDNA sequence from pangolin Manis javanica. Parasites Vectors 2022, 15, 70. [Google Scholar] [CrossRef] [Scilit]
  10. Baylis, H.A. XLIII.—On some parasitic worms from Java, with remarks on the Acanthocephalan genus Pallisentis. Ann. Mag. Nat. History. Ser. 10. 1933, 12, 443–449. [Google Scholar] [CrossRef] [Scilit]
  11. Gardiner, C.H.; Werner, R.M. Polypoid gastritis in a scaly anteater caused by larvae of Gendrespirura sp. J. Wildl. Dis. 1984, 20, 68–70. [Google Scholar] [CrossRef] [Scilit]
  12. Tubangui, M.A.; Masiluñgan, V.A. Nephridiorhynchus palawanensis sp. nov., an acanthocephalan parasites of Manis javanica Desmarest. Philipp. J. Sci. 1938, 66, 1–6. [Google Scholar]
  13. Amin, O.M.; Van Ha, N.; Heckmann, R.A. New and already known acanthocephalans mostly from mammals in Vietnam, with descriptions of two new genera and species in Archiacanthocephala. J. Parasitol. 2008, 94, 194–201. [Google Scholar] [CrossRef] [Scilit]
  14. Schmidt, G.D. Revision of the Class Archiacanthocephala Meyer, 1931 (Phylum Acanthocephala), with emphasis on Oligacanthorhynchidae Southwell et Macfie, 1925. J. Parasitol. 1972, 58, 290–297. [Google Scholar] [CrossRef] [Scilit]
  15. Amin, O.M.; Heckmann, R.A.; Sist, B.; Basso, W.U. A review of the parasite fauna of the black-bellied pangolin, Phataginus tetradactyla Lin. (Manidae), from central Africa with the description of Intraproboscis sanghae n. gen., n. sp. (Acanthocephala: Gigantorhynchidae). J. Parasitol. 2021, 107, 222–238. [Google Scholar] [CrossRef] [Scilit]
  16. Sist, B.; Basso, W.; Hemphill, A.; Cassidy, T.; Cassidy, R.; Gudehus, M. Case report: Intestinal perforation and secondary peritonitis due to Acanthocephala infection in a black-bellied pangolin (Phataginus tetradactyla). Parasitol. Int. 2021, 80, 102182. [Google Scholar] [CrossRef] [Scilit]
  17. Blaxter, M.L.; De Ley, P.; Garey, J.R.; Liu, L.X.; Scheldeman, P.; Vierstraete, A.; Vanfleteren, J.R.; Mackey, L.Y.; Dorris, M.; Frisse, L.M.; et al. A molecular evolutionary framework for the phylum Nematoda. Nature 1998, 392, 71–75. [Google Scholar] [CrossRef] [Scilit]
  18. Littlewood, D.T.J.; Olson, P. Small Subunit rDNA and the Platyhelminthes: Signal, Noise, Conflict and Compromise. In Interrelationships of the Platyhelminthes; Littlewood, D.T.J., Bray, R.A., Eds.; CRC Press: Boca Raton, FL, USA, 2000; pp. 262–278. [Google Scholar]
  19. Jian, R.; Wang, S.-W.; Zhang, W.-X.; Zhang, L.-P. Morphological and molecular identification of Habronema spp. (Nematoda: Habronematidae) from donkeys in Xinjiang, China, and notes on the taxonomical status of Habronema majus (Creplin, 1849) and H. microstoma (Schneider, 1866). Syst. Parasitol. 2017, 94, 511–525. [Google Scholar] [CrossRef] [Scilit]
  20. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [Scilit]
  21. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Scilit]
  22. Ronquist, F.; Huelsenbeck, J. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
  23. Rambaut, A. FigTree, Version 1.4.3. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 1 December 2020).
  24. Neveu-Lemaire, M. Protospirura hamospiculata n. sp. Nématode parasite d’un pangolin Africain Manis (Pholidotus) temminckii. Ann. De Parasitol. 1927, 5, 107–113. [Google Scholar] [CrossRef] [Scilit]
  25. Meyer, A. Neue ceyloische Nematoden aus Säugetieren (Filaria, Strongylus) und aus Julus (Oxyuris). Arch. Für Nat. 1896, 62, 54–82 & plates IV–V. [Google Scholar]
  26. Kou, C.C. Studies on parasitic nematodes of mammals from Canton. I. Some new species from Paradoxurus minor exitus Schwarj, Paguma larvata larvata (Hamilton Smith) and Manis pentadactyla aurita Hodgson. Acta Zool. Sin. 1958, 10, 60–72+63 plates. [Google Scholar]
  27. Von Linstow, O. Helminthes from the collection of the Colombo Museum. Spolia Zeylan. 1906, 3, 166–188. [Google Scholar]
  28. Baylis, H.A. XXIII.—On a nematode parasite of pangolins. Ann. Mag. Nat. Hist. 1931, 8, 191–194. [Google Scholar] [CrossRef] [Scilit]
  29. Gao, J.F.; Mao, R.-F.; Li, Y.; Sun, Y.-Y.; Gao, Z.-Y.; Zhang, X.-G.; Jin, Z.-H.; An, Q.; Zhang, Z.-H.; Zhang, A.-H.; et al. Characterization of the mitochondrial genome of Tetrameres grusi and insights into the phylogeny of Spirurina. Int. J. Parasitol. Parasites Wildl. 2022, 17, 35–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Mariaux, J.; Georgiev, B.B. Cestode parasites (Neodermata, Platyhelminthes) from Malaysian birds, with description of five new species. Eur. J. Taxon. 2020, 616, 1–35. [Google Scholar] [CrossRef] [Scilit]
  31. Chabaud, A.G. Essai de classification des Nêmatodes Habronematinae. Ann. De Parasitol. Hum. Et Comp. 1958, 33, 455–508. [Google Scholar]
  32. Esslinger, J.H. Dipetalonema fausti sp. n. (Filarioidea: Ochocercidae), a filarial parasite of the scaly anteater, Manis pentadactyla L. (Pholidota), from China. J. Parasitol. 1966, 52, 494–497. [Google Scholar] [CrossRef] [Scilit]
  33. Baylis, H.A. Nematoda. Vol. II. (Filarioidea, Dioctophymoidea and Trichinelloidea). In The Fauna of British India, Including Ceylon and Burma; Sewell, R.B.S., Ed.; Taylor and Francis: London, UK, 1939; pp. 1–274. [Google Scholar]
  34. Chabaud, A.G. No. 3. Key to the genera of the Order Spirurida. Part 2. Spiruroidea, Habronematoidea and Acuarioidea. In CIH Keys to the Nematode Parasites of Vertebrates; Anderson, R.C., Chabaud, A.G., Willmott, S., Eds.; Commonwealth Agricultural Bureaux: Farnham Royal, UK, 1975; pp. 29–58. [Google Scholar]
  35. Hodda, M. Phylum Nematoda: A classification, catalogue and index of valid genera, with a census of valid species. Zootaxa 2022, 5114, 1–289. [Google Scholar] [CrossRef] [Scilit]
  36. Anderson, R. Nematode Parasites of Vertebrates: Their Development and Transmission; CAB International: Wallingford, UK, 1992; p. 578. [Google Scholar]
  37. Hua, L.; Gong, S.; Wang, F.; Li, W.; Ge, Y.; Li, X.; Hou, F. Captive breeding of pangolins: Current status, problems and future prospects. Zookeys 2015, 507, 99–114. [Google Scholar] [CrossRef]
  38. Smales, L.R. Multisentis myrmecobius, gen. et. sp. nov. (Acanthocephala: Oligacanthorhynchidae), from the Numbat, Myrmecobius fasciatus, and a key to genera of the Oligacanthorhynchidae. Invertebr. Taxon. 1997, 11, 301–307. [Google Scholar] [CrossRef] [Scilit]
  39. Near, T.J.; Garey, J.R.; Nadler, S.A. Phylogenetic relationships of the Acanthocephala inferred from 18S ribosomal DNA sequences. Mol. Phylogenetics Evol. 1998, 10, 287–298. [Google Scholar] [CrossRef] [Scilit]
  40. García-Varela, M.; Pérez-Ponce De León, G.; de la Torre, P.; Cummings, M.P.; Sarma, S.S.S.; Laclette, J.P. Phylogenetic relationships of Acanthocephala based on analysis of 18S ribosomal RNA gene sequences. J. Mol. Evol. 2000, 50, 532–540. [Google Scholar] [CrossRef] [Scilit]
  41. Telford, M.J.; Holland, P.W.H. The phylogenetic affinities of the Chatognaths: A molecular analysis. Mol. Biol. Evol. 1993, 10, 660–676. [Google Scholar]
  42. Tuli, M.D.; Li, H.; Pan, X.; Li, S.; Xhai, J.; Wu, Y.; Chen, W.; Huang, W.; Feng, Y.; Xiao, L.; et al. Heteroplasmic mitochondrial genomes of a Raillietina tapeworm in wild Pangolin. Parasites Vectors 2022, 15, 204. [Google Scholar] [CrossRef] [Scilit]
  43. Chabaud, A.G.; Bain, O. La lignée Dipetalonema. Nouvel essai de classification. Ann. De Parasitol. Hum. Et Comp. 1976, 51, 365–397. [Google Scholar] [CrossRef] [Scilit]
  44. Chabaud, A.G.; Bain, O.; Puylaert, F. Description de trois nouveaux nématodes Molineinae et considérations sur la systématique et le caractére archaïque de cette sous-famille. Bull. Du Mus. Natl. D’histoire Nat. Ser. 2 1967, 38, 904–920. [Google Scholar]
  45. Baer, J.G.; Fain, A. Les Cestodes des Pangolins. Bull. De La Société Neuchâteloise Des Sci. Nat. 1955, 78, 37–52. [Google Scholar]
  46. Yamaguti, S. Systema Helminthum. Volume II. The Cestodes of Vertebrates; Interscience Publishers: New York, NY, USA; London, UK, 1959; p. vii + 860. [Google Scholar]
  47. Singh, S.N. On a new nematode Leipernema leiperi n.g., n.sp. (Strongyloididae), parasitic in the pangolin Manis pentadactyla from Hyderabad, India. J. Helminthol. 1976, 50, 267–274. [Google Scholar] [CrossRef] [Scilit]
  48. Singh, S.N. On Trichochenia mucronata n.sp. and a new subfamily Trichocheniinae (Trichostrongylidae Leiper, 1912). J. Helminthol. 1958, 32, 251–258. [Google Scholar] [CrossRef] [Scilit]
  49. Zhang, F.; Yu, J.; Wu, S.; Li, S.; Zou, C.; Wang, Q.; Sun, R. Keeping and breeding the rescued Sunda pangolins (Manis javanica) in captivity. Zoo Biol. 2017, 36, 387–396. [Google Scholar]
  50. Baer, J.G. Helminthes Parasites. In Exploratie der Nationale Parken van Belgisch Congo; Baer, J.G., Gerber, W., Eds.; Institut des Parcs Nationaux du Congo Belge: Brussels, Belgium, 1959; p. 159. [Google Scholar]
  51. Mettrick, D.F. A new tapeworm, Inermicapsifer rhodesiensis sp. nov. from a scaly ant-eater, Manis temminckii, in southern Rhodesia. J. Helminthol. 1959, 33, 273–276. [Google Scholar] [CrossRef] [Scilit]
  52. Okonkwo, V.O.; Okaka, C.E. An investigation into parasites of the African grand pangolins Manis temminckii (Akabo in Igbo Langage) Ayamelum L.G.A. of Anambra south eastern Nigeria. Int. J. Health Saf. Environ. 2018, 4, 308–314. [Google Scholar]
  53. Ugiagbe, N.S.; Awharitome, A.O. Parasitic infections in African pangolin (Manis temminckii) from Edo State, southern Nigeria. Zoologist 2015, 13, 17–21. [Google Scholar]
  54. Chin, T.-H. Trichoskrabinia costata from the pangolin, Manis pentadactyla. Chin. Med. J. 1941, 60, 81–83. [Google Scholar]
  55. Cameron, T.W.M.; Myers, B.J. Manistrongylus meyeri (Travassos, 1937) gen. nov., and Necator americanus from the pangolin. Can. J. Zool. 1960, 38, 781–786. [Google Scholar] [CrossRef] [Scilit]
  56. Prod’hon, J. Redescription de Trichochenia conincki Chabaud, Bain et Puylaert, 1967. Cah. De La Maboké 1969, 7, 135–137. [Google Scholar]
  57. Durette-Desset, M.-C. No. 10. Keys to genera of the superfamily Trichostrongyloidea. In CIH Keys to the Nematode Parasites of Vertebrates; Anderson, R.C., Chabaud, A.G., Eds.; Commonwealth Agricultural Bureaux: Farnham Royal, UK, 1983; p. 86. [Google Scholar]
  58. Gibbons, L.M. Keys to the Nematode Parasites of Vertebrates. Supplementary Volume; CABI: Wallingford, UK, 2010; p. 416. [Google Scholar]
  59. IRMNG. Mainspinostrongyius Kalyankar & Palladwar. 1989. Available online: https://irmng.org/aphia.php?p=taxdetails&id=1454988 (accessed on 26 August 2022).
  60. IRMNG. Trichochenia Kou. 1958. Available online: https://www.irmng.org/aphia.php?p=taxdetails&id=1390094 (accessed on 26 August 2022).
  61. Mohapatra, R.K.; Banik, A.; Sahu, S.K.; Panda, S.; Dangar, T.K. Parasites and bacteria associated with Indian pangolins Manis crassicaudata (Mammalia: Manidae). Glob. Ecol. Conserv. 2020, 23, e01042. [Google Scholar] [CrossRef] [Scilit]
  62. Heath, M.E.; Vanderlip, S.L. Biology, husbandry, and veterinary care of captive Chinese pangolins (Manis pentadactyla). Zoo Biol. 1988, 7, 293–312. [Google Scholar] [CrossRef] [Scilit]
  63. Mariaux, J.; Tkach, V.V.; Vasileva, G.P.; Waeschenbach, A.; Beveridge, I.; Dimitrova, Y.D.; Haukislami, V.; Greiman, S.E.; Littlewood, D.T.J.; Makarikov, A.A.; et al. Cyclophyllidea van Beneden in Braun, 1900. In Planetary Biodiversity Inventory (2008–2017): Tapeworms from Vertebrate Bowels of the Earth; Caira, J.N., Jensen, K., Eds.; The University of Kansas Natural History Museum: Lawrence, KS, USA, 2017; Volume Special Publication No. 25; pp. 77–148. [Google Scholar]
  64. Rahm, U. Notes on pangolins of the Ivory Coast. J. Mammal. 1956, 37, 531–537. [Google Scholar] [CrossRef] [Scilit]
  65. Jones, A.; Bray, R.A. Family Davaineidae Braun, 1900. In Keys to the Cestode Parasites of Vertebrates; Khalil, L., Jones, A., Bray, R., Eds.; CAB International: Wallingford, UK, 1994; pp. 407–441. [Google Scholar]
  66. Sapp, S.; Bradbury, R. The forgotten exotic tapeworms: A review of uncommon zoonotic Cyclophyllidea. Parasitology 2020, 147, 533–558. [Google Scholar] [CrossRef] [Scilit]
  67. Riley, J. The biology of pentastomids. Adv. Parasitol. 1986, 25, 46–128. [Google Scholar]
  68. Cantlay, J.; Ingram, D.; Meredith, A. A review of zoonotic infection risks associated with the wild meat trade in Malaysia. EcoHealth 2017, 14, 361–388. [Google Scholar] [CrossRef] [Scilit]
  69. Bezerra-Santos, M.; Mendoza-Roldan, J.; Thompson, R.; Dantas-Torres, F.; Otranto, D. Illegal wildlife trade: A gateway to zoonotic infectious diseases. Trends Parasitol. 2021, 37, 181–184. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Carcass of pangolin, Manis javanica, at time of necropsy; note internal organs in bag in body cavity.
Figure 1. Carcass of pangolin, Manis javanica, at time of necropsy; note internal organs in bag in body cavity.
Diversity 14 01039 g001
Figure 2. Gendrespirura cf. zschokkei collected from Manis javanica. Female specimens. (A) Anterior end, showing teeth on lateral lips and chitinised vestibule, median view. (B) Posterior end, showing anus and caudal papillae, ventral view; note striated cuticle. (C) Vulva opening with vagina running posteriorly, lateral view. (D) Immature egg, dissected from uterus. (E) Mature egg, showing characteristic barrel-shape, dissected from uterus. Scale bars: (A) 50 μm. (B) 50 μm. (C) 100 μm. (D) 20 μm. (E) 20 μm.
Figure 2. Gendrespirura cf. zschokkei collected from Manis javanica. Female specimens. (A) Anterior end, showing teeth on lateral lips and chitinised vestibule, median view. (B) Posterior end, showing anus and caudal papillae, ventral view; note striated cuticle. (C) Vulva opening with vagina running posteriorly, lateral view. (D) Immature egg, dissected from uterus. (E) Mature egg, showing characteristic barrel-shape, dissected from uterus. Scale bars: (A) 50 μm. (B) 50 μm. (C) 100 μm. (D) 20 μm. (E) 20 μm.
Diversity 14 01039 g002
Figure 3. Gendrespirura cf. zschokkei collected from Manis javanica. Male specimen. (A) Line drawing of posterior end, showing caudal alae, pre- and post-cloacal papillae, pattern of ventral ridges and cloaca, ventral view. (B) Photomicrograph of right spicule in situ, ventral view. (C) Photomicrograph of pre-cloacal papillae. (D) Photomicrograph of ridges on ventral surface of nematode, anterior to cloacal region. Scale bars: (A) 50 μm. (B) 50 μm. (C) 25 μm. (D) 20 μm.
Figure 3. Gendrespirura cf. zschokkei collected from Manis javanica. Male specimen. (A) Line drawing of posterior end, showing caudal alae, pre- and post-cloacal papillae, pattern of ventral ridges and cloaca, ventral view. (B) Photomicrograph of right spicule in situ, ventral view. (C) Photomicrograph of pre-cloacal papillae. (D) Photomicrograph of ridges on ventral surface of nematode, anterior to cloacal region. Scale bars: (A) 50 μm. (B) 50 μm. (C) 25 μm. (D) 20 μm.
Diversity 14 01039 g003
Figure 4. Phylogenetic placement of Gendrespirura cf. zschokkei (A) and Oligacanthorhynchidae sp. (B) based on Cox1 and 18S rRNA sequences, respectively. Branch supports (shown as posterior probabilities > 0.9) are indicated on the branches. Sequences generated in this study are highlighted and indicated with an *.
Figure 4. Phylogenetic placement of Gendrespirura cf. zschokkei (A) and Oligacanthorhynchidae sp. (B) based on Cox1 and 18S rRNA sequences, respectively. Branch supports (shown as posterior probabilities > 0.9) are indicated on the branches. Sequences generated in this study are highlighted and indicated with an *.
Diversity 14 01039 g004
Figure 5. Oligachanthorhynchidae sp. collected from Manis javanica. Female specimens. (A) Line drawing of roboscis showing pattern of hooks. (B) Line drawing of hooks on proboscis; bottom hook is flattened against the proboscis. (C) Photomicrograph of posterior end, showing uterine bell. (D) Photomicrograph of egg dissected from body. Scale bars: (A). 40 μm. (B). 40 μm. (C). 500 μm. (D). 20 μm.
Figure 5. Oligachanthorhynchidae sp. collected from Manis javanica. Female specimens. (A) Line drawing of roboscis showing pattern of hooks. (B) Line drawing of hooks on proboscis; bottom hook is flattened against the proboscis. (C) Photomicrograph of posterior end, showing uterine bell. (D) Photomicrograph of egg dissected from body. Scale bars: (A). 40 μm. (B). 40 μm. (C). 500 μm. (D). 20 μm.
Diversity 14 01039 g005
Table 1. Host information. AFCD case reference number for all pangolins: CPM/4/55/18. HKU, Hong Kong University; SPL, Shamsi Parasitology Laboratory.
Table 1. Host information. AFCD case reference number for all pangolins: CPM/4/55/18. HKU, Hong Kong University; SPL, Shamsi Parasitology Laboratory.
HKU NumberGeographical Origin aSPL NumberTotal LengthWeightSexParasites
(Number Collected)
Location in Host
HKU41-2018Borneo1292100 cm3.2 kgFemaleNematodes (4)Embedded in stomach wall
HKU46-2018Borneo1295134.5 cm7.6 kgMaleAcanthocephala (3)Faecal extrusion
HKU51-2018Borneo1293113.5 cm4.16 kgFemaleNematodes (5)Stomach
HKU74-2018Java, Indonesia129495.5 cm3.1 kgFemaleAcanthocephala (3)Small intestine
a Origin determined via population genomics study presented in Worthington et al. (In Review).
Table 2. Measurements of female Gendrespirura cf. zschokkei collected from Manis javanica in this study compared to previous reports of specimens collected from various pangolins. Species names listed by their original described name; currently all species are considered within Gendrespirura. Measurements are presented in micrometers.
Table 2. Measurements of female Gendrespirura cf. zschokkei collected from Manis javanica in this study compared to previous reports of specimens collected from various pangolins. Species names listed by their original described name; currently all species are considered within Gendrespirura. Measurements are presented in micrometers.
Original IdentificationGendrespirura cf. zschokkeiHabronema hamospiculatumProtospirura hamospiculataFilariazschokkeiChenospirura kwangtungensisGendrespirura sp.
HostManis javanicaManis javanicaSmutsia temminckiiManis crassicaudataManis pentadactylaManis crassicaudata
LocationMalaysiaVietnamCentral African RepublicSri LankaChinaSri Lanka
ReferenceThis studyHsü [5]Neveu-Lemaire [24]Meyer [25]Kou [26]von Linstow [27]
Body length17,685 (7525–25,375)
Mature only: 23,662.5 (21,950–25,375)
15,700–23,80018,000–23,00032,000 (25,000–35,000)25,810–29,51032,000
Body width453.1 (337.5–550)500–800590–6801300770–885950
No. pairs of teeth on pseudolabia337 a-7Not stated
Nerve ring to anterior end400 (350–450)260–310350–400 330–370
Cervical papillae to anterior end292.5 (230–390) 265–306
Excretory pore to anterior end540 (250–900) 402
Vestibule length120 (105–135)150–180130–150114 200
Oesophagus length3940 (2430–5100)3800–39203800–4300~6400 (5000–7000)4500–53709143 b
Vulva to anterior end6243.3 (5180–7850)5380 (in 22,000 specimen)90008000
(1/4 body length)
7350–7750Behind mid-body (18,667 b)
Egg length × widthMature: 46.7 (45–47.5) × 25.4 (25–26.25)
Immature: 35.6 (32.5–37.5) × 22.8 (21.25 × 25)
42–43 × 24–2644–46 × 23–2443 × 23–3446–47 × 26–2747 × 29
Tail length233.8 (155–305)280–440250–300330–380 485 b
a Specimens re-examined by Baylis [28]. b Figures calculated from data presented in [27].
Table 3. Measurements of male Gendrespirura cf. zschokkei collected from Manis javanica in this study compared to previous reports of specimens collected from various pangolins. Species names listed by their original described name; currently all species are considered within Gendrespirura. Measurements are presented in micrometers.
Table 3. Measurements of male Gendrespirura cf. zschokkei collected from Manis javanica in this study compared to previous reports of specimens collected from various pangolins. Species names listed by their original described name; currently all species are considered within Gendrespirura. Measurements are presented in micrometers.
Original IdentificationGendrespirura cf. zschokkeiHabronema hamospiculatumProtospirura hamospiculataFilaria zschokkeiChenospirura kwangtungensisGendrespirura sp.
HostManis javanicaManis javanicaSmutsia temminckiiManis crassicaudataManis pentadactylaManis crassicaudata
LocationMalaysiaVietnamCentral African RepublicSri LankaChinaSri Lanka
ReferenceThis studyHsü [5]Neveu-Lemaire [24]Meyer [25]Kou [26]von Linstow [27]
Body length13,37511,400–16,10015,000–17,00021,000 (19,000–24,000)18,250–22,38025,000
Body width500380–590525–5701100664–758710
No. pairs of teeth on pseudolabia337 a-7Not stated
Nerve ring to anterior end 230–250325 324–367
Cervical papillae to anterior end230 265–278
Excretory pore to anterior end 230
Buccal cavity length130132–145130114 200
Oesophagus length38003240–39003300–3700~4200 (3800–4800)3337–46518333 b
Left spicule length34003170–345023004700–53003010–32303740
Right spicule length725550–6206001800–2000650–710570
Gubernaculum length11070
Tail length370360–450370490 481
a Specimens re-examined by Baylis [28]. b Figures calculated from data presented in [27].
Table 4. An updated checklist of helminths and pentastomes of pangolins. Note that the protozoans, ectoparasites and bacteria listed in Mohapatra et al. [3] and Wicker et al. [4] have not been included in this update. If there are no changes from the list as presented in Mohapatra et al. [3] and/or Wicker et al. [4], that is the reference listed; see Mohapatra et al. [3] and/or Wicker et al. [4] for the specific references to those parasites.
Table 4. An updated checklist of helminths and pentastomes of pangolins. Note that the protozoans, ectoparasites and bacteria listed in Mohapatra et al. [3] and Wicker et al. [4] have not been included in this update. If there are no changes from the list as presented in Mohapatra et al. [3] and/or Wicker et al. [4], that is the reference listed; see Mohapatra et al. [3] and/or Wicker et al. [4] for the specific references to those parasites.
Pangolin Host (Scientific Name)Parasite TypeParasite SpeciesReferences
Asian pangolins
Chinese pangolin
(Manis pentadactyla)
AcanthocephalaParaprosthenorchis ornatusAmin et al. [13]
CestodaRaillietina sp.Tuli et al. [42]
NematodaAcanthocheilonema (Chenofilaria) fausti (Esslinger, 1966)Chabaud and Bain [43]
Ancylostoma sp.Wicker et al. [4]
Capillaria spp.Wicker et al. [4]
Cylicospirura sp.Mohapatra et al. [3], Wicker et al. [4]
Gendrespirura zschokkeiChabaud [31]
Necator americanusMohapatra et al. [3], Wicker et al. [4]
Strongyle typeWicker et al. [4]
Strongyloides spp.Wicker et al. [4]
Trichochenia cantonensisChabaud et al. [44]
Trichochenia manisaChabaud et al. [44]
Trichochaenia meyeriChabaud et al. [44]
Trichochenia papillosaChabaud et al. [44]
Indian pangolin (Manis crassicaudata)CestodaDiorchiraillietina contortaBaer and Fain [45], Yamaguti [46]
Echinococcus sp.Mohapatra et al. [3], Wicker et al. [4]
NematodaGendrespirura zschokkeiChabaud [31]
Leipernema leiperiSingh [47]
Necator americanusMohapatra et al. [3]
Trichochenia meyeriMohapatra et al. [3], Wicker et al. [4]
Trichochenia mucronataSingh [48], Chabaud et al. [44]
Philippine pangolin (Manis culionensis)AcanthocephalaNephridiacanthus palawanesisTubangui and Masiluñgan [12]
Malayan/Sunda pangolin (Manis javanica)AcanthocephalaOligacanthorhynchidae gen. sp.This study
CestodaCestode sp.Zhang et al. [49]
Diorchiraillietina contortaBaer and Fain [45], Yamaguti [46]
Raillietina (Paroniella) bovieniBaer & Fain [45]
NematodaAncylostoma sp.Tuli et al. [9]
Brugia malayiMohapatra et al. [3], Wicker et al. [4]
Brugia pahangiMohapatra et al. [3], Wicker et al. [4]
Gendrespirura zschokkeiChabaud [31], This study
Gendrespirura sp.Mohapatra et al. [3]
Necator americanusMohapatra et al. [3], Wicker et al. [4]
Strongyle typeWicker et al. [4]
PentastomidaPentastomida sp.Zhang et al. [49]
African pangolins
Giant ground pangolin (Smutsia gigantea)AcanthocephalaNephridiacanthus gerberiBaer [50]
CestodeBaerfinia anoplocephaloides (Baer and Fain, 1955)Baer and Fain [45], Yamaguti [46]
Hymenolepis manidisBaer and Fain [45]
Metadavainea aelleniBaer and Fain [45]
NematodaAncylostoma sp.Mohapatra et al. [3], Wicker et al. [4]
Temminck’s ground pangolin (Smutsia temminckii)CestodaInermicapsifer rhodiensisMettrick [51]
Metadavainea sp.Okonkwo and Okaka [52]
Oochoristica sp.Ugiagbe and Awharitome [53]
NematodaGendrespirura hamospiculataChabaud [31]
Parastrongyloides sp.Wicker et al. [4]
Strongylidae sp.Ugiagbe and Awharitome [53]
Strongyle typeWicker et al. [4]
PentastomidaArmillifer sp.Ugiagbe and Awharitome [53]
Tree/White-bellied pangolin (Phataginus tricuspis)AcanthocephalaMacracanthorhynchus sp.Amin et al. [15]
Nephridiacanthus manisensisAmin et al. [15]
Oncicola sp.Amin et al. [15]
CestodaBaerfinia anoplocephaloidesBaer and Fain [45], Yamaguti [46]
Cestodes (unidentified)Chabaud et al. [44]
Metadavainea aelleniBaer and Fain [45]
Metadavainea sp.Wicker et al. [4]
Raillietina (Raillietina) rahmiBaer and Fain [45]
NematodaAncylostoma sp.Wicker et al. [4]
Gendrespirura hamospiculataChabaud [31]
Microfilaria lukakae Pais Caeiro, 1959Wicker et al. [4]
Microfilaria lundae Pais Caeiro, 1959Wicker et al. [4]
Microfilaria nobrei Pais Caeiro, 1959Wicker et al. [4]
Microfilaria vilhenae Pais Caeiro, 1959Wicker et al. [4]
Parastrongyloides sp.Wicker et al. [4]
Trichochenia armataChabaud et al. [44]
Trichochenia coninckiChabaud et al. [44]
Trichochenia manidisChabaud et al. [44]
Trichochenia rousselotiChabaud et al. [44]
PentastomidaUnidentified pentastomeWicker et al. [4]
Black-bellied pangolin (Phataginus tetradactyla)AcanthocephalaIntraproboscis sanghaeAmin et al. [15]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Barton, D.P.; Martelli, P.; Worthington, B.M.; Lam, T.T.-Y.; Zhu, X.; Shamsi, S. Nematode and Acanthocephalan Parasites of Confiscated Sunda pangolins, Manis javanica Desmarest, 1822 (Mammalia: Pholidota: Manidae), with an Updated List of the Parasites of Pangolins. Diversity 2022, 14, 1039. https://doi.org/10.3390/d14121039

AMA Style

Barton DP, Martelli P, Worthington BM, Lam TT-Y, Zhu X, Shamsi S. Nematode and Acanthocephalan Parasites of Confiscated Sunda pangolins, Manis javanica Desmarest, 1822 (Mammalia: Pholidota: Manidae), with an Updated List of the Parasites of Pangolins. Diversity. 2022; 14(12):1039. https://doi.org/10.3390/d14121039

Chicago/Turabian Style

Barton, Diane P., Paolo Martelli, Brian M. Worthington, Tommy T.-Y. Lam, Xiaocheng Zhu, and Shokoofeh Shamsi. 2022. "Nematode and Acanthocephalan Parasites of Confiscated Sunda pangolins, Manis javanica Desmarest, 1822 (Mammalia: Pholidota: Manidae), with an Updated List of the Parasites of Pangolins" Diversity 14, no. 12: 1039. https://doi.org/10.3390/d14121039

APA Style

Barton, D. P., Martelli, P., Worthington, B. M., Lam, T. T.-Y., Zhu, X., & Shamsi, S. (2022). Nematode and Acanthocephalan Parasites of Confiscated Sunda pangolins, Manis javanica Desmarest, 1822 (Mammalia: Pholidota: Manidae), with an Updated List of the Parasites of Pangolins. Diversity, 14(12), 1039. https://doi.org/10.3390/d14121039

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop