Next Article in Journal
Molecular Modulation of the Crosstalk Between TDP-43 and SOD1
Next Article in Special Issue
Mitogenomes Reveal Novel Phylogeographic Patterns and Temporal Evolutionary History of Barn Swallows and Close Relatives
Previous Article in Journal
Performance of Urine Fluorescence In Situ Hybridization for Diagnosis of Upper Tract Urothelial Carcinoma: A Comprehensive Review
Previous Article in Special Issue
Csn5 Depletion Reverses Mitochondrial Defects in GCN5-Null Saccharomyces cerevisiae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 8
10.3390/ijms27083407
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Six Complete Mitochondrial Genomes and ITS Sequences from Armillaria mellea (Vahl) P. Kumm.: A Phylogenetic Study and Comparative Analysis

by
Yuan Jiang
†,
Yaping Li
†,
Yuanfan Zhang
,
Jiadi Jin
,
Yisu Cao
,
Yanjun Wang
and
Zhirong Sun
*
School of Chinese Materia Medica, Beijing University of Chinese Medicine, Beijing 102488, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2026, 27(8), 3407; https://doi.org/10.3390/ijms27083407
Submission received: 13 March 2026 / Revised: 4 April 2026 / Accepted: 8 April 2026 / Published: 10 April 2026
(This article belongs to the Special Issue Research on Mitochondrial Genetics and Epigenetics)
Browse Figures
Versions Notes

Abstract

Armillaria species hold significant ecological and economic importance and they play a vital role in the growth of traditional Chinese medicine Gastrodia elata (G. elata). In this study, we assembled and compared the mitochondrial genomes (mitogenomes) of six Armillaria mellea (Vahl) P. Kumm. (A. mellea) strains isolated from the main G. elata-producing region of Hanzhong, China. The internal transcribed spacer (ITS) sequencing confirmed that all six strains form a monophyletic clade. Their mitogenomes (120,775 to 120,839 bp) exhibit a highly conserved architecture, each containing 16 protein-coding genes (PCGs), 23 open reading frames (ORFs), 27 tRNAs, and two rRNAs. Codon usage and amino acid frequency were strikingly similar among the six strains, with a strong AT bias. In contrast, comparisons with other Armillaria species revealed marked differences in gene order, repeat structures, and selection pressures. Phylogenetic analyses based on PCGs further resolved the close relationship among the six strains while highlighting distinct molecular variation across species. On the whole, these findings demonstrate that A. mellea strains co-evolving with G. elata maintain a highly uniform mitochondrial genome architecture, suggesting strong purifying selection or recent divergence within this symbiotic population. The pronounced differences from other Armillaria species at the levels of gene arrangement and selection pressure imply that mitochondrial gene rearrangement may have accompanied species diversification in the genus. By providing the first complete mitogenomes of A. mellea from a major G. elata cultivation area, this study not only expands the genomic resources for Armillaria but also establishes a foundation for understanding how mitochondrial variation might influence fungal growth, adaptation, and symbiotic efficiency with G. elata.

1. Introduction

Armillaria, (Basidiomycota, Physalacriaceae) [1] is widely distributed across various climates worldwide and impacts more than 500 hosts [2]. Eastern Asia represents the biogeographic region with the highest species richness [3]. Armillaria can provide ecological benefits and economic value [4], such as helping forest regeneration and promoting forest succession [5,6]. Moreover, it has rich nutrients and functional compounds, like enzymes and secondary metabolites, which have potential application value in industries such as food and pharmaceuticals [7,8,9]. Armillaria species can also form symbiotic associations with the orchid Gastrodia elata [10]. Gastrodia elata is a rare Chinese herbal medicine that has the effect of calming wind and relieving spasmosis, calming liver-yang, dispelling wind, and clearing collaterals [11]. Gastrodia elata is a rootless, leafless heterotrophic plant that requires the fungi of the Armillaria genus to provide nutrients, so Armillaria members, such as A. mellea, A. gallica, etc., play essential roles in the nutrient supply and growth modulation of G. elata [10,12]. Unfortunately, not all of the fungi of the Armillaria genus can exert a symbiotic effect. One of the important reasons is that fungi will gradually deteriorate as the number of generations increases, with their reproductive capacity declining [13]. In actual production, the fungi of the Armillaria genus are similar to other fungi [14]. Moreover, the compatibility between the fungi of the Armillaria genus in different regions is not consistent with that in the Qinba Mountain area; the research shows that there are 16 biological species (CBS) of Armillaria fungi in China. Mating experiments and verification using the Genome Consistency Phylogenetic Species Recognition Method (GCPSR) has shown that these species exhibit significant genetic differentiation and reproductive isolation in different geographical regions [15]. We collected six Armillaria mellea (Vahl) P. Kumm. strains from the Qinba Mountains, which show good symbiotic compatibility with G. elata. On the one hand, their biological characteristic differences from other regions’ fungi of Armillaria genus are still not fully understood. On the other hand, among the more than 40 species in the genus Armillaria, complete mitogenomes have been reported for only four species to date. In this study, four publicly available mitogenomes, namely A. borealis (MH407470; NC_042230), A. gallica (MH878687), A. sinapina (MH282847; NC_042229), and A. solidipes (MH660713; NC_042231) were included based on stringent selection criteria, in which only fully assembled and well-annotated complete mitogenomes were retained, while partial sequences, individual mitochondrial genes, and fragmented assemblies were excluded through manual curation. Consequently, sequencing and analyzing the mitogenomes of Armillaria species is of great significance. It not only provides essential data for phylogenetic and evolutionary studies of the genus but also offers genetic insights into the Armillaria–Gastrodia elata interaction, which is fundamental to sustainable G. elata production.
In biological identification, particularly in molecular systematics and DNA barcoding techniques, ITS (internal transcribed spacer) is the most frequently mentioned molecular marker. Essentially, they are specific DNA segments within the genome. Scientists use the sequencing of these segments to distinguish the identities of different species [16,17]. ITS, a non-coding region in the ribosomal RNA cluster, is valued for its high intraspecific conservation and high interspecific variability [18]. The ITS 1 and 2 with the 5.8S and the intergenic spacer 1 (IGS1) are common discrimination sequences in fungal molecular identification [19]. However, the mitogenomes of Armillaria have been little studied [20], limiting a complete understanding of the genetic characteristics and evolutionary histories of Armillaria. Mitochondria are semi-autonomous organelles that are primarily responsible for cellular respiration. Most eukaryotes have their mitogenomes, which are thought to have been derived from the ancestral member of the Alphaproteobacteria via endosymbiosis. As the “second genome” of eukaryotes, the mitogenomes have many characteristics different from the nuclear genome. In fungi, mitochondrial DNA (mtDNA) is circular or linear [21]. They show frequent DNA rearrangement events and high variability of gene order, although high synteny and conserved gene order are also present between closely related species [22].
In the present study, we aimed to characterize the mitogenomes of A. mellea and to investigate their evolutionary patterns within the genus. We hypothesized that, despite belonging to the same species, different strains of A. mellea may exhibit variation in mitogenome structure and evolutionary features. To test this, six strains were subjected to ITS sequencing to confirm their taxonomic identity, and phylogenetic analyses using Maximum Likelihood (ML) and Bayesian inference (BI) were performed to verify their placement within the genus. Their complete mitogenomes were further sequenced, assembled, and annotated. Comparative analyses were conducted on genome organization, repetitive elements, codon usage, and selection pressure to assess the conservation and divergence of these features. This study provides new insights into intraspecific variation and mitochondrial genome evolution in A. mellea and enriches genomic resources for the genus Armillaria.

2. Results

2.1. ITS Sequence Analysis

Based on the ITS sequences, the ML and BI phylogenetic trees were constructed to analyze the genetic relationship in the fungi of the Armillaria genus (Figure 1). All clades within the trees were supported (Bootstrap Value (BS) ≥ 65; Bayesian posterior probability (BPP) ≥ 0.7). The overall topology of the ML and BI trees was largely consistent with previously reported phylogenetic frameworks of Armillaria [23]. Major clades such as the A. mellea, A. tabescens, and A. ostoyae–A. borealis groups were recovered. The six strains formed a well-supported clade (BS = 100; BPP = 0.968) with short branch lengths (approximately 1.4 × 10−3 substitutions per site), indicating close genetic relationship among them. Then, they were clustered with the A. mellea strains downloaded from NCBI into the same branch, indicating that they were closely related. While the A. mellea clade is strongly supported, the lower thresholds for other internal nodes are displayed for topological context only and do not represent robust phylogenetic relationships.

2.2. Features and Protein-Coding Genes of the Armillaria Mitogenomes

The results of the reads mapping of the six mitogenomes showed uniform coverage and a non-zero value (Figure S1). The results indicated that the mitogenome assembly results of the six strains were correct and there was no heteroplasmy. All mitogenomes were reannotated using a consistent pipeline to ensure comparability, and homologous genes were identified based on sequence similarity. The size of the six mitogenomes of A. mellea was 120,779 bp (J4), 120,775 bp (NQ9), 120,839 bp (QM1), 120,785 bp (QM2), 120,789 bp (QN1), and 120,778 bp (QN2). The GC content of the six mitogenomes was 28.7%, and all PCGs, rRNAs, and tRNAs were located on the direct strand of the mitogenomes (Figure 2). These genomes were composed of 16 PCGs, 23 ORFs, 27 tRNA genes, and two rRNAs, for a total of 68 genes. In addition, the 23 ORFs are independent of the PCGs. Among them, the distribution of tRNA genes in the mitogenomes was clustered (Table 1). Mitochondrial genomes typically contain 15 core PCGs involved in oxidative phosphorylation. These include the mitochondrially encoded ATP synthase membrane subunits 6, 8, and 9 (atp6, atp8, atp9); cytochrome c oxidase subunits 1, 2, and 3 (cox1, cox2, cox3); cytochrome b (cob); NADH dehydrogenase subunits 1–6 (nad1, nad2, nad3, nad4, nad4 L, nad5, nad6); and a mitochondrial ribosomal protein S3 (rps3). Moreover, there were eight genes (nad5, nad1, cob, cox2, cox3, cox1, large subunit, and small subunit) that contained introns in the six mitogenomes. Among them, the types of introns were similar, and the cox1 gene harbored the highest number of introns (Table S1). However, further analysis revealed that the other five strains were highly similar in all three dimensions (type, position, and encoded protein), whereas strain QM1 exhibited distinct intron-encoded proteins.
The six strains of Armillaria mellea share the same rps3 gene length (3447 bp), which differs from those of four other known species: A. borealis (3438 bp), A. solidipes (2817 bp), A. gallica (3447 bp), and A. sinapina (3438 bp). A. gallica differs from the six strains in our study in terms of core PCG base composition and length. Specifically, it lacks 30 base pairs (bp) in the atp9 gene, while the cob gene in the six A. mellea strains is missing 252 bp. In the gene of Armillaria solidipes the highest number of bases are absent, specifically 621 bp.

2.3. Mitogenome Deletion Scale

To explore the Armillaria species mitogenome deletion scale, we performed a heat map of gene deletion using A. borealis as a reference (Figure 3). The intronic ORFs deoxyribonucleic acid polymerase (dpol), dpol1, dpol2, dpol3, dpol4, dpol5, hypothetical proteins 1 (hyp1), open reading frame in intron 1 of NADH dehydrogenase subunit 5 gene (oi1nad5), oi2nad1, oi2rnl, oi3cob, oi3cox2, oi3nad1, oi5cob, oi6cox1, oi7cob, oi7cox1, oi8cob and oi9cox1 were lost in all Armillaria except A. borealis. Compared with the known complete mitogenomes of A. borealis, A. sinapina, and A. solidipes, six strains of A. mellea have a unique gene open reading frame in intron 2 of the small subunit ribosomal RNA gene (oi2rns), and two copies of the oi4cox1 gene, which are different from the known mitogenome of Armillaria. All species of Armillaria shown in Figure 2 had the 16 core PCGs, and the genes oi1cob, oi1cox1, oi1cox2, oi1nad1, oi2cob, oi2cox1, oi4cob, oi4cox1, and rps3, which is consistent with previous studies. Moreover, the number of tRNAs and rRNAs was the same for all species in Figure 2 except A. sinapina [24,25].

2.4. Codon Usage Analysis

Prior investigations have revealed that codon usage is directly related to the rate of translation and the energy required, and genes in mitochondria prefer to use specific codons to save time and energy for cell growth [25]. In this study, codon usage patterns of 16 PCGs from six strains of A. mellea mitogenomes were systematically analyzed. The Relative Synonymous Codon Usage (RSCU) results revealed a highly conserved codon usage pattern among the six strains, all showing a strong preference for AT-rich codons. A total of 22 amino acids (including stop codons) were identified. Specifically, codons ending with A or U were overwhelmingly favored, with UUA (526), UUU (283), and AAU (281) being the most frequently used, whereas GC-rich codons such as UGC (1), AGG (1), and UAG (1) were rarely utilized (Figure 4). This pattern indicates a pronounced AT bias in the mitogenomes of A. mellea. When comparing the codon usage patterns between A. mellea and the other four Armillaria species (A. solidipes, A. sinapina, A. gallica, and A. borealis), a high degree of conservation was observed. All species exhibited a pronounced bias toward AT-rich codons, with the most frequently used codons being nearly identical, including UUA (Leu), UUU (Phe), and AAU (Asn) in A. mellea, and UUA, UUU, AUA, AUU, and GGU in the other four species. This consistency suggests that the overall codon usage landscape is highly conserved within the genus Armillaria. Nevertheless, minor differences were noted. For instance, the codon CGC (Arg) was present but not preferred in A. mellea, whereas it was universally absent in the other four species [26]. Compared to the other species of Basidiomycota, the codon preference of five strains of Armillaria, except for QN1, was similar to that of Ganoderma lucidum and Pleurotus, which had high usage frequency in codon UUA [27,28]. Similar to other fungal studies, mitochondrial genes of six A. mellea strains had a high number of AT-rich codons, and similar codon frequencies are found in other fungal mitogenomes [27,28].

2.5. Repeat Analysis

Our analysis characterized the Simple Sequence Repeats (SSRs) in the mitogenomes of six A. mellea strains. The types of these SSRs were mononucleotide repeating units, trinucleotide repeating units, and tetranucleotide repeating units (Figure 5A). The numbers and types of SSRs in the six mitogenomes were similar, with 40–41 single-nucleotide repeats, five trinucleotide repeats, and four tetranucleotide repeats. The main type and number of mononucleotide repeats was A, and the trinucleotide repeats were ATT.
In addition, we also searched for tandem repeat loci using the Tandem Repeats Finder. A total of 26 tandem repeats were detected in the QM1 mitogenomes, and the other five mitogenomes had 25 repeats. The longest tandem repeat of QM1 was 64 bp, copied twice, and the longest sequence of the other five mitogenomes was 33 bp, also copied twice, with a resulting difference in repeat length (~62 bp) (Table S2). Among them, there was one tandem repeat from the large subunit rRNA exon and four tandem repeats from the large subunit rRNA introns. Moreover, the tandem repeats analysis of the GIY-YIG and LAGLIDADG sequences revealed that no tandem repeats exist in these sequences. Notably, QM1 exhibited a slightly larger mitogenome size (120,839 bp) compared to the other strains (120,775~120,789 bp), the length difference is approximately 60 bp and matches the observed difference in repeat length, suggesting that variation in tandem repeat length may contribute to genome size differences among strains.
Analysis of interspersed repeated sequences in the six strains’ mitogenomes revealed high similarity among them (Figure 5). Specifically, each mitogenome contained two complement repeats, 12 palindrome repeats, and 20 reverse repeats. Additionally, the QM1 mitogenome contained 28 forward repeats, while the other five strains’ mitogenomes contained 29 forward repeats. Among them, eight forward repeats and eight reverse repeats were found in six mitochondrial introns. Only QM1 contained one palindrome repeat, while the mitochondrial introns of the other five strains each contained two palindrome repeats. A statistical analysis was conducted on the interspersed repeated sequences in the GIY-YIG and LAGLIDADG sequences of the six strains’ mitogenomes. The results revealed that the GIY-YIG sequences from all six strains lacked interspersed repeated sequences. While the LAGLIDADG sequences of five strains’ mitogenomes contained one forward repeat in cox1, QM1 lacked it.

2.6. Comparative Mitogenomic Analysis

The collinear analysis showed that the six A. mellea mitogenome strains in this study share many homologous regions with other Armillaria (Figure 6). While some genes underwent genetic rearrangements and reversals, the position and size of genes changed significantly. The six A. mellea strains analyzed in this study showed complete collinearity without any gene rearrangement. Compared with the four species that have been publicly available in NCBI, A. gallica shows the highest degree of similarity in alignment with the six strains of A. mellea. Therefore, we discussed that within this species, the primary evolutionary consequence of these repeats is driving micro-scale length polymorphism (genome expansion) rather than large-scale structural recombination. Compared with the core PCGs of the other four Armillaria species, some genes showed rearrangements, such as cox3, nad2, nad3, nad6, rns, and atp6. Furthermore, the nad2 and nad3 genes occurred in reverse order in A. borealis and A. solidipes (Figure 7). Given that repetitive sequences frequently act as hotspots for homologous recombination in fungal mitogenomes, the accumulation and distribution of these repeats likely drive the large-scale structural rearrangements and evolutionary divergence observed among different Armillaria species.

2.7. Selective Pressure

We analyzed the selection pressure of 16 core genes. The ratio of non-synonymous to synonymous substitutions dN/dS (ω) values < 1 indicates that these genes were subject to purifying selection, while dN/dS (ω) values > 1 indicates that these genes were subject to positive selection. The result showed that the six strains of A. mellea had similarity in the hyp9 gene and oi1cob, oi1cox1, oi2cox1, oi2cox2, oi4cob ORFs; purifying selection occurred in all of them (Figure 8). In addition, positive selection occurred in some genes, for example oi1cob and oi2cob in A. gallica (MH878687), A. sinapina (MH282847; NC_042229), and A. solidipes (MH660713; NC_042231); oi2cox1 and oi4cox1 in A. gallica (MH878687) and A. sinapina (MH282847; NC_042229); oi1cox1 and oi4cob in A. sinapina (MH282847; NC_042229); and oi2cox2 in A. solidipes (MH660713; NC_042231).

2.8. Phylogenetic Analysis

The ML and BI phylogenetic trees were constructed based on the 16 PCGs to investigate the phylogeny of Armillaria (Figure 9). The mitochondrial phylogeny robustly supports the monophyly of the six strains (bootstrap = 90) relative to other taxa, supporting their monophyly. However, the relationships within this clade remain poorly resolved, with most internal nodes lacking statistical support (bootstrap = 0). Subsequently, these six strains of A. mellea clustered together with A. gallica (bootstrap support values = 100). Moreover, A. sinapina, A. borealis and A. solidipes clustered in a branch, and each branch contains higher supporting values (>70). This result indicated that compared to the published mitogenomes of the Armillaria, the genetic relationship of the six strains of A. mellea was close with A. gallica.
The ML and BI phylogenetic trees were constructed based on the 16 PCGs (Figure 9). All six A. mellea strains formed a well-supported monophyletic clade (bootstrap = 90/100) relative to the other Armillaria species and outgroup taxa. Within this clade, however, the branching order among the six strains was completely unresolved (bootstrap = 0 for all internal nodes), indicating that the phylogenetic relationships among these strains could not be reliably determined from the concatenated PCG data. The six A. mellea strains clustered together with A. gallica with high support (bootstrap = 100). Additionally, A. sinapina, A. borealis, and A. solidipes formed another well-supported clade (bootstrap > 70).

3. Discussion

In this study, we collected six A. mellea strains symbiotic with G. elata in the Qinba Mountains of Shaanxi Province. The ITSs of six A. mellea strains were sequenced, and ML and BI phylogenetic trees were constructed. The results showed that the local topological structure of the ML and BI trees were basically consistent with the previous study, such as A. cepistipes and A. sinapina being a sister group, as well as A. ostoyae and A. borealis [23]. Figure 1 showed that the six strains were close to other A. mellea. Therefore, this result confirmed that the six strains collected in this study were Armillaria mellea.
Mitogenomes provide high-resolution genetic data, which are instrumental in revealing intricate phylogenetic relationships and serve as an invaluable tool in the field of evolutionary biology. In this study, we first assembled and characterized six A. mellea mitogenomes, including their length, introns, gene arrangement, collinear analysis, and codon usage. Fungal mitogenomes are among the largest and most variable in length of eukaryotic mitogenomes. The size of complete fungal mitogenomes varies from the 12 kb mt genome of Rozella allomycis [29] to the 332 kb mt genome of Golovinomyces cichoracearum [30]. In the published complete Armillaria mitogenomes, their sizes are different (103, 563–122, 167 bp). Armillaria solidipes (MH660713; NC_042231) is similar in size to the mitogenomes in this study, about 120,000 bp [26]. Basidiomycota species generally contain 16 core PCGs, including 14 genes for energy metabolism (atp6, atp8, atp9, cob, coxl, cox2, cox3, nadl, nad2, nad3, nad4, nad4 L, nad5, and nad6) and one rps3 gene for transcriptional regulation [26]. In addition, 20–36 tRNA genes and two rRNA genes were also detected in basidiomycete mitogenomes [26]. The six mitogenomes in this study also contain the aforementioned 16 core PCGs, 27 tRNA genes, and two rRNA genes.
Introns are common in mitogenomes of fungi, and the number and type of introns vary greatly between different species. Moreover, they are considered one of the main factors contributing to variations in the size and organization of fungal mitogenomes [27,31]. Many mitogenomes contain introns in such genes as cox1, cox2, cob, nad1, nad5, and rnl. Table S1 shows that the six A. mellea strains in this study had the same total number of introns as A. solidipes. The cox1 gene was found to be the main gene of introns, representing 30% of all introns in the mitogenomes. Because the variation in introns in the cox1 gene could significantly affect the length and structure of the mitogenomes, the introns of cox1 were often selected as the object of intron research [32,33]. Most mitochondrial group I introns contain ORFs with GIY-YIG or LAGLIDADG homing endonuclease (HEGS) motif [31,34,35]. HEGs are one of the mobile genetic elements capable of inserting into specific genomic locations [36]. Kolesnikova et al. [26] found that A. sinapina contains 12 LAGLIDADG and seven GIY-YIG, A. borealis contains 15 and nine, A. solidipes contains 17 and eight, and A. gallica contains 13 and four. In this study, the cox1 of the five strains of Armillaria fungi revealed one LAGLIDADG. This striking reduction in intron number suggests a relatively simplified mitochondrial genome structure in A. mellea compared to other Armillaria species. Given that LAGLIDADG and GIY-YIG elements are typically associated with mobile introns, their variation is often linked to intron gain and loss events during evolution. Therefore, the low intron content observed here may reflect either intron loss or limited intron invasion, potentially contributing to the reduced genetic variation and weak phylogenetic resolution observed among the strains. Moreover, intron dynamics are known to play an important role in shaping fungal mitochondrial genome evolution. The reduced number of mobile introns in A. mellea may indicate a more conserved mitochondrial architecture, which could partly explain the limited sequence divergence detected in the phylogenetic analysis. Further comparative studies across Armillaria species will be necessary to clarify the evolutionary mechanisms underlying intron diversity and their impact on mitochondrial genome evolution.
Purifying selection typically acts to conserve existing phenotypes, whereas positive selection, also known as Darwinian selection [37], drives the emergence of novel adaptive traits, thereby enhancing a population’s fitness in its environment. In this study, several genes involved in oxidative phosphorylation within the mitogenomes of six strains of A. mellea were found to be under purifying selection. However, positive selection occurs in the cox and cob genes of A. gallica, A. solidipes, and A. sinapina, which may suggest adaptive modifications in oxidative phosphorylation. In high-altitude ecosystems, fungal species face severe environmental constraints such as hypoxia and low temperatures. Recent studies have demonstrated that positive selection and adaptive modifications often occur in key mitochondrial genes (e.g., cox and cob) of these fungi, ensuring efficient oxidative phosphorylation (OXPHOS) and robust ATP production under low oxygen availability [38]. Notably, these mitogenomic adaptations significantly impact their interactions with plant hosts. The modified OXPHOS machinery not only provides the massive energy required for successful host colonization and invasion but also modulates the fungal redox homeostasis, enhancing the fungus’s ability to scavenge or withstand the reactive oxygen species (ROS) bursts triggered by the plant immune system [39]. These changes may enhance ATP production efficiency and oxygen utilization under environmental constraints such as low oxygen availability at high altitudes. Given the obligate symbiotic relationship between Gastrodia elata and Armillaria, such mitochondrial adaptations in the fungus likely contribute indirectly to the ecological fitness of the host plant. Furthermore, the optimization of respiratory enzyme performance within a moderate temperature range (20–25 °C) may explain the observed growth preference of the symbiotic system.
The lack of phylogenetic resolution among the six A. mellea strains (bootstrap = 0) suggests that the mitochondrial PCG sequences do not contain sufficient phylogenetic signal to resolve their branching order. This could be due to a recent divergence event, low substitution rates in mitochondrial genes among these strains, or limited sequence variation within the analyzed genomic regions. Further analyses using higher-resolution markers (e.g., single-nucleotide polymorphisms from whole mitogenomes or nuclear markers) would be needed to clarify the relationships among these strains.

4. Materials and Methods

4.1. Sample Collection and Material Cultivation

Six strains of A. mellea were collected from Ningqiang County (Qinba Mountains), Hanzhong City, Shaanxi Province, China, in October 2022 (Figure 10). The A. mellea specimens and the wood to which they were attached were placed in an ice box and brought to the laboratory for preservation at 4 °C. Collect the black strands that are attached to the surface of the wood, sterilize the surface of the strands with ethanol (70%) for 30 s, and rinse three times in sterile water to avoid unnecessary contaminants from the surface. Inside the ultra-clean bench, use a scalpel to incise the black epidermis to expose the enclosed white hyphae. Finally, inoculate the uncontaminated white hyphae into test tubes filled with PDA cylindrical semi-solid culture mediums, with an inoculation length of 0.5 cm per tube. Place the inoculated test tubes in an environment at 24 °C and conduct dark cultivation for 20 days.

4.2. DNA Extraction and Sequencing

The DNA of six strains of A. mellea was extracted using the first generation with the Ezup Column Fungi Genomic DNA Purification Kit (Sangon Biotech, Shanghai, China). Then, internal transcribed spacer (ITS) regions of ribosomal RNA genes were amplified with the primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC [18]. Additionally, 1% agarose gel and 1 × TAE electrophoresis buffer solution were prepared. Electrophoresis (150 V, 100 mA) was performed for 20 min. The gel imager was for observation. The molecular weight shown by the bands was consistent with the expectation (900 bp), and the bands were clear, bright, and free of impurities. Then, PCR amplicons were subjected to bidirectional Sanger sequencing on an ABI 3730 XL instrument (Applied Biosystems, Thermo Fisher Scientific, Delaware, DE, USA) [40].
Mitogenomes sequencing libraries were constructed from the extracted genomic DNA using NEBNext Ultra II DNA Library Prep Kits (NEB, Beijing, China), following the manufacturer’s instructions. Whole genomic sequencing was performed on an Illumina HiSeq 2500 Platform and 250 bp paired-end reads were generated (6 Gb raw data, San Diego, CA, USA).

4.3. Quality Check, Assembly and Annotation of the Mitogenomes of Armillaria

The pair-end reads were trimmed for adapter and low-quality reads (Phred score < 30) using the NGS QC Toolkit v.2.3.3 software [41], resulting in the clean data being used for subsequent analysis. The six mitogenomes were assembled using NOVOPlasty V.3.8.3 (A. gallica MH878687 as seed sequence) [42]. The Bowtie2: V2.3.2 and Samtools v1.0 [43,44,45,46] were used to map the reads to the assembled genome and evaluate the effectiveness of the assembly results. Gaps between contigs were filled using MITObim V.1.9 [47]. Conducted coverage checks on six strains to illustrate the completeness of genome assembly and the uniformity of sequencing depth were then annotated by GeSeq version 2.03 [48] (https://chlorobox.mpimp-golm.mpg.de/geseq.html (accessed on 15 June 2025)). Annotation of mtDNA was performed using Geneious V.9.1.4 (https://www.geneious.com (accessed on 16 June 2025)), with the NCBI Reference Sequence: NC042230. To ensure comparability, all mitogenomes were re-annotated using a consistent pipeline, and homologous genes were identified based on sequence similarity and conserved annotation features.

4.4. Characterization and Comparative Analysis of Mitogenomes

The primary characteristics of the mitogenomes of six strains of A. mellea were analyzed. The total length of mitogenomes, number of genes, and base content were calculated by Geneious V.9.1.4 (https://www.geneious.com (accessed on 16 June 2025)); the length and number of introns were also counted by GeSeq [48]. Whole mitogenome alignments to clarify collinearity in the mitogenomes of six strains of A. mellea were performed using Mauve version v1.0 [49].

4.5. Repeat Analysis

Misa.pl version 1.0 was used to screen the simple sequence repeats (SSRs) [50]. Tandem repeats within the mitogenomes were also clarified using the Tandem Repeats Finder [51]. The interspersed repeated sequences of the mitogenome and introns were clarified using Reputer in (https://bibiserv.cebitec.uni-bielefeld.de/reputer (accessed on 20 June 2025)) [52].

4.6. Codon Usage

As in the research methods used in the previous study by the reference research group [53], the PCGs were extracted with Phylosuite V.1.2.2 [54]. RSCU and codon usage values were analyzed with CodonW V.1.4.2. The RSCU values were shown in a heatmap by Tbtools V.2.360 [55].

4.7. Selective Pressure in Armillaria Mitogenome Genes

The PCGs and ORFs were extracted with Phylosuite V.1.2.2 [54] and aligned with MAFFT v7 [56]. The above selection pressure of Armillaria was analyzed using an ML tree from the adaptive branch-site random effects likelihood (aBSREL) model in HyPhy. Nodes with p < 0.05 were considered to indicate that different selective pressures influence the sequence evolution of the mitogenome gene.
Codon-based alignments of PCGs were generated using MAFFT. Selection pressures were estimated using the aBSREL model in HyPhy v2.5 [57], which uses AICc to infer branch-specific ω rate categories. Likelihood ratio tests compared full (ω ≥ 0) vs. null (ω ≤ 1) models, with p-values corrected by Holm–Bonferroni. Branches with corrected p < 0.05 were considered to exhibit episodic positive selection (sites with ω > 1). All branches were tested.

4.8. Phylogenetic Analysis

The 102 published Armillaria rDNA-ITS sequences were downloaded from NCBI. Then, we aligned all rDNA-ITS using MAFFT v7 [56]. Constructed Maximum Likelihood (ML) and Bayesian inference (BI) phylogenetic trees were created using PhyloSuite 1.2.2 [54] with default parameter settings, and we visualized the trees using MEGA version X [57].
Mitogenome phylogenetic analysis was performed based on 12 complete mitogenomes, including the six assembled sequences in our study, and four mitogenomes downloaded from the NCBI database: A. borealis (MH407470, NC_042230), A. gallica (MH878687), A. sinapina (MH282847, NC_042229), A. solidipes (MH660713, NC_042231), Lentinula edodes (MF774813) and Ganoderma applanatum (KR109212) as outgroup. A total of 16 shared PCGs were extracted by PhyloSuite V.1.2.2 [54] and aligned using MAFFT v7 [56]. Subsequently, the alignment was conducted based on BI in MrBayes using the GTR  +  I  +  G evolution model [58]. The parameter was set to run for five million generations and sampled every 1000 generations, with all other settings left at their defaults, and the first 25% of each run was discarded as burn-in. The alignment was evaluated using bootstrap analysis on 1000 generations in a ML by RAxML [59], with parameters: raxmlHPC-PTHREADS-SSE3-fa-N1000-m GTRGAMMA-x551,314,260-p551,314,260-o Lentinula_edodes_MF774813, Ganoderma_applanatum_KR109212-T 20.
Finally, HyPhy v2.5 [60,61] was used for visualization. The screening criterion for the results was significance, with p < 0.05. HyPhy is an open-source software capable of analyzing selection pressure, providing various calculation models such as aBSREL, GARD, SLAC, FEL, FUBAR, and FADE. In this paper, the aBSREL [62] model was adopted. Through the branch-site model and likelihood ratio test, it was determined whether certain branches had undergone positive selection.

5. Conclusions

In this study, we constructed phylogenetic trees using ITS sequences to determine the phylogenetic position of six strains of A. mellea within the genus Armillaria. Subsequently, we assembled and characterized the mitogenomes of six strains of A. mellea. Compared with the four published mitogenomes, the gene types of the six mitogenomes were consistent. However, the PCGs of these mitogenomes exhibit rearrangements, and the number of repetitive sequences and the results of selective pressure analysis were different. The codon usage and amino acid frequency among the six strains of A. mellea showed a high similarity; both contain high AT content. The phylogenetic trees constructed by PCGs in the mitogenomes showed that these six mitogenomes form a monophyletic branch. Our study supplemented the biological information of Armillaria mellea mitogenomes and enhanced the genomic resources available for Armillaria.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms27083407/s1.

Author Contributions

Conceptualization, Z.S.; Data curation, Y.Z. and Y.J.; Formal analysis, Y.Z., Y.J. and Y.L.; Investigation, Y.W.; Methodology, Y.Z. and Y.J.; Software, Y.L., J.J. and Y.C.; Supervision, Z.S.; Validation, Y.L. and J.J.; Visualization, Y.J.; Writing—original draft, Y.Z. and Y.J.; Writing—review and editing, Y.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the earmarked fund for the China Agriculture Research System (CARS-21) and the Research of development of rejuvenation technology of Gastrodia elata Ningqiang in Shaanxi Province (KJ2019-001). These funding agencies had no role in the research design, data gathering, data analysis, or writing of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequences used in this study were submitted to NCBI with the accession numbers PP467623 (J4), PP467626 (NQ9), PP467624 (QM1), PP467625 (QM2), PP467621 (QN1), and PP467622 (QN2). The dataset generated and or analyzed during the current study is deposited in Genbank with the accession numbers OR885309 (J4), OR885310 (NQ9), OR885311 (QM1), OR885312 (QM2), OR783479 (QN1), and OR885313 (QN2).

Acknowledgments

Funding acquisition, Wei Zhang, Huairong Zhang and Zhirong Sun; Project administration, Wei Zhang and Zhirong Sun; Resources, Wei Zhang, Huairong Zhang. We would like to express our gratitude to Huairong Zhang for his technical and material support for this research; to Wei Zhang for his financial support for this research; and to Xingliang Chen for his technical and methodological guidance.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Abbreviations

The following abbreviations are used in this manuscript:
G. elataGastrodia elata
ITSInternal Transcribed Spacer
A. melleaArmillaria mellea
PCGsProtein-Coding Genes
ORFsOpen Reading Frames
A. gallicaArmillaria gallica
GCPSRGenome Consistency Phylogenetic Species Recognition Method
A. borealisArmillaria borealis
A. sinapinaArmillaria sinapina
A. solidipesArmillaria solidipes
IGS1Intergenic Spacer 1
mitogenomesMitochondrial Genomes
MLMaximum Likelihood
BIBayesian Inference
BSBootstrap Values
BPPBayesian Posterior Probability
A. tabescensArmillaria tabescens
A. ostoyaeArmillaria ostoyae
Tef1-αTranslation elongation factor 1-alpha
atp6, atp8, atp9ATP synthase subunit 6, 8, 9
cox1, cox2, cox3cytochrome c oxidase subunit 1, 2, 3
cobcytochrome b
nad1, nad2, nad3, nad4, nad4 L, nad5, nad6NADH dehydrogenase subunit 1–6
rps3ribosomal protein S3
hyp3, hyp5, hyp9hypothetical protein 3, 5, 9
dpol, dpol1, dpol2, dpol3, dpol4, dpol5deoxyribonucleic acid polymerase 1, 2, 3, 4, 5
oilrnl/oirnsopen reading frame in intron of the mitochondrial large/small ribosomal RNA
RSCURelative Synonymous Codon Usage
SSRsSimple Sequence Repeats
dN/dSRatio of Nonsynonymous Substitutions to Synonymous Substitutions
A. cepistipesArmillaria cepistipes
HEGsHoming Endonuclease
OXPHOSOxidative Phosphorylation
ROSReactive Oxygen Species
aBSRELAdaptive Branch-Site Random Effects Likelihood

References

  1. Watling, R.; Kile, G.A.; Gregory, N.M. The genus Armillaria—Nomenclature, typification, the identity of Armillaria mellea and species differentiation. Trans. Br. Mycol. Soc. 1982, 78, 271–285. [Google Scholar] [CrossRef]
  2. Devkota, P.; Hammerschmidt, R. The infection process of Armillaria mellea and Armillaria solidipes. Physiol. Mol. Plant Pathol. 2020, 112, 101543. [Google Scholar] [CrossRef]
  3. Koch, R.A.; Herr, J.R. Global Distribution and Richness of Armillaria and Related Species Inferred From Public Databases and Amplicon Sequencing Datasets. Front. Microbiol. 2021, 12, 733159. [Google Scholar] [CrossRef] [PubMed]
  4. Hua, Z.Y.; Liu, T.R.; Han, P.J.; Zhou, J.H.; Zhao, Y.Y.; Huang, L.Q.; Yuan, Y. Isolation, genomic characterization, and mushroom growth-promoting effect of the first fungus-derived Rhizobium. Front. Microbiol. 2022, 13, 947687. [Google Scholar] [CrossRef] [PubMed]
  5. Kim, M.S.; Hanna, J.W.; McDonald, G.I.; Klopfenstein, N.B. Armillaria altimontana in North America: Biology and Ecology. J. Fungi 2023, 9, 904. [Google Scholar] [CrossRef]
  6. Heinzelmann, R.; Dutech, C.; Tsykun, T.; Labbé, F.; Soularue, J.P.; Prospero, S. Latest advances and future perspectives in Armillaria research. Can. J. Plant Pathol. 2019, 41, 1–23. [Google Scholar] [CrossRef]
  7. Zhan, J.; Yuan, J.; Liu, J.; Zhang, F.; Yu, F.; Wang, Y. Metabolomics analysis of mycelial exudates provides insights into fungal antagonists of Armillaria. Mycology 2023, 14, 264–274. [Google Scholar] [CrossRef]
  8. Ren, S.Z.; Gao, Y.P.; Li, H.; Ma, H.H.; Han, X.L.; Yang, Z.T.; Chen, W.J. Research Status and Application Prospects of the Medicinal Mushroom Armillaria mellea. Appl. Biochem. Biotechnol. 2023, 195, 3491–3507. [Google Scholar] [CrossRef]
  9. Nowacka-Jechalke, N.; Kanak, S.; Moczulski, M.; Martyna, A.; Kubinski, K.; Maslyk, M.; Szpakowska, N.; Kaczynski, Z.; Nowak, R.; Olech, M. Crude polysaccharides from wild-growing Armillaria mellea-chemical composition and antidiabetic, anti-inflammatory, antioxidant, and antiproliferative potential. Appl. Sci. 2023, 13, 3853. [Google Scholar] [CrossRef]
  10. Cai, J.L.; Muhammad, I.; Chen, B.L.; Xu, P.; Li, Y.G.; Xu, H.N.; Li, K.Z. Whole genome sequencing and analysis of Armillaria gallica Jzi34 symbiotic with Gastrodia elata. BMC Genom. 2023, 24, 275. [Google Scholar] [CrossRef]
  11. de Souza, P.; Crestani, S.; da Silva Rde, C.; Gasparotto, F.; Kassuya, C.A.; da Silva-Santos, J.E.; Gasparotto, A., Jr. Involvement of bradykinin and prostaglandins in the diuretic effects of Achillea millefolium L. (Asteraceae). J. Ethnopharmacol. 2013, 149, 157–161. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, Y.H.; Xu, J.; Yuan, Q.S.; Guo, L.P.; Xiao, C.H.; Yang, C.G.; Li, L.Y.; Jiang, W.K.; Zhou, T. Effect of symbiotic fungi-Armillaria gallica on the yield of Gastrodia elata Bl. and insight into the response of soil microbial community. Front. Microbiol. 2023, 14, 1233555. [Google Scholar] [CrossRef] [PubMed]
  13. Zhao, F.Y.; Wang, Q.L.; An, X.M.; Tan, Q.F.; Yun, J.M.; Zhang, Y.B. Oxidative damage from repeated tissue isolation for subculturing causes degeneration in Volvariella volvacea. Front. Microbiol. 2023, 14, 1210496. [Google Scholar] [CrossRef] [PubMed]
  14. Yu, E.; Gao, Y.G.; Li, Y.Q.; Zang, P.; Zhao, Y.; He, Z.M. An exploration of mechanism of high quality and yield of Gastrodia elata Bl. f. glauca by the isolation, identification and evaluation of Armillaria. BMC Plant Biol. 2022, 22, 621. [Google Scholar] [CrossRef]
  15. Qin, G.F.; Qin, W.M.; Wang, H.C.; Zhao, J.; Korhonen, K.; Chen, J.; Dai, Y.C.; Yuan, Y. Phylogeny and species diversity of Armillaria in China based on morphological, mating test, and GCPSR criteria. Mycology 2025, 16, 777–811. [Google Scholar] [CrossRef]
  16. Li, X.W.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.T.; Chen, S.L. Plant DNA barcoding: From gene to genome. Biol. Rev. 2015, 90, 157–166. [Google Scholar] [CrossRef]
  17. Chen, S.L.; Yao, H.; Han, J.P.; Liu, C.; Song, J.Y.; Shi, L.C.; Zhu, Y.J.; Ma, X.Y.; Gao, T.; Pang, X.H.; et al. Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE 2010, 5, e8613. [Google Scholar]
  18. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  19. Tsykun, T.; Rigling, D.; Prospero, S. A new multilocus approach for a reliable DNA-based identification of Armillaria species. Mycologia 2013, 105, 1059–1076. [Google Scholar] [CrossRef]
  20. Liu, Y.; Steenkamp, E.T.; Brinkmann, H.; Forget, L.; Philippe, H.; Lang, B.F. Phylogenomic analyses predict sistergroup relationship of nucleariids and Fungi and paraphyly of zygomycetes with significant support. BMC Evol. Biol. 2009, 9, 272. [Google Scholar] [CrossRef]
  21. Megarioti, A.H.; Kouvelis, V.N. The Coevolution of Fungal Mitochondrial Introns and Their Homing Endonucleases (GIY-YIG and LAGLIDADG). Genome Biol. Evol. 2020, 12, 1337–1354. [Google Scholar] [CrossRef]
  22. Nie, Y.; Wang, L.; Cai, Y.; Tao, W.; Zhang, Y.J.; Huang, B. Mitochondrial genome of the entomophthoroid fungus Conidiobolus heterosporus provides insights into evolution of basal fungi. Appl. Microbiol. Biotechnol. 2019, 103, 1379–1391. [Google Scholar] [CrossRef] [PubMed]
  23. Guo, T.; Wang, H.C.; Xue, W.Q.; Zhao, J.; Yang, Z.L. Phylogenetic Analyses of Armillaria Reveal at Least 15 Phylogenetic Lineages in China, Seven of Which Are Associated with Cultivated Gastrodia elata. PLoS ONE 2016, 11, e0154794. [Google Scholar] [CrossRef] [PubMed]
  24. Li, Q.; Yang, M.; Chen, C.; Xiong, C.; Jin, X.; Pu, Z.G.; Huang, W.L. Characterization and phylogenetic analysis of the complete mitochondrial genome of the medicinal fungus Laetiporus sulphureus. Sci. Rep. 2018, 8, 9104. [Google Scholar] [CrossRef]
  25. Sharp, P.M.; Bailes, E.; Grocock, R.J.; Peden, J.F.; Sockett, R.E. Variation in the strength of selected codon usage bias among bacteria. Nucleic Acids Res. 2005, 33, 1141–1153. [Google Scholar] [CrossRef] [PubMed]
  26. Kolesnikova, A.I.; Putintseva, Y.A.; Simonov, E.P.; Biriukov, V.V.; Oreshkova, N.V.; Pavlov, I.N.; Sharov, V.V.; Kuzmin, D.A.; Anderson, J.B.; Krutovsky, K.V. Mobile genetic elements explain size variation in the mitochondrial genomes of four closely-related Armillaria species. BMC Genom. 2019, 20, 351. [Google Scholar] [CrossRef]
  27. Li, Q.; Chen, C.; Xiong, C.; Jin, X.; Chen, Z.Q.; Huang, W.L. Comparative mitogenomics reveals large-scale gene rearrangements in the mitochondrial genome of two Pleurotus species. Appl. Microbiol. Biotechnol. 2018, 102, 6143–6153. [Google Scholar] [CrossRef]
  28. Li, Q.; Xiang, D.B.; Wan, Y.; Wu, Q.; Wu, X.Y.; Ma, C.R.; Song, Y.; Zhao, G.; Huang, W.L. The complete mitochondrial genomes of five important medicinal Ganoderma species: Features, evolution, and phylogeny. Int. J. Biol. Macromol. 2019, 139, 397–408. [Google Scholar] [CrossRef]
  29. James, T.Y.; Pelin, A.; Bonen, L.; Ahrendt, S.; Sain, D.; Corradi, N.; Stajich, J.E. Shared Signatures of Parasitism and Phylogenomics Unite Cryptomycota and Microsporidia. Curr. Biol. 2013, 23, 1548–1553. [Google Scholar] [CrossRef]
  30. Zaccaron, A.Z.; Stergiopoulos, I. Characterization of the mitochondrial genomes of three powdery mildew pathogens reveals remarkable variation in size and nucleotide composition. Microb. Genom. 2021, 17, 000720. [Google Scholar] [CrossRef]
  31. Mardanov, A.V.; Beletsky, A.V.; Kadnikov, V.V.; Ignatov, A.N.; Ravin, N.V. The 203 kbp Mitochondrial Genome of the Phytopathogenic Fungus Sclerotinia borealis Reveals Multiple Invasions of Introns and Genomic Duplications. PLoS ONE 2014, 9, e107536. [Google Scholar] [CrossRef]
  32. Férandon, C.; Xu, J.P.; Barroso, G. The 135 kbp mitochondrial genome of Agaricus bisporus is the largest known eukaryotic reservoir of group I introns and plasmid-related sequences. Fungal Genet. Biol. 2013, 55, 85–91. [Google Scholar] [CrossRef] [PubMed]
  33. Li, Q.; Wang, Q.F.; Jin, X.; Chen, Z.Q.; Xiong, C.; Li, P.; Zhao, J.; Huang, W.L. Characterization and comparison of the mitochondrial genomes from two Lyophyllum fungal species and insights into phylogeny of Agaricomycetes. Int. J. Biol. Macromol. 2019, 121, 364–372. [Google Scholar] [CrossRef] [PubMed]
  34. Sethuraman, J.; Majer, A.; Friedrich, N.C.; Edgell, D.R.; Hausner, G. Genes within genes: Multiple LAGLIDADG homing endonucleases target the ribosomal protein S3 gene encoded within an rnl group I intron of Ophiostoma and related taxa. Mol. Biol. Evol. 2009, 26, 2299–2315. [Google Scholar] [CrossRef] [PubMed]
  35. Monteiro-Vitorello, C.B.; Hausner, G.; Searles, D.B.; Gibb, E.A.; Fulbright, D.W.; Bertrand, H. The Cryphonectria parasitica mitochondrial rns gene: Plasmid-like elements, introns and homing endonucleases. Fungal Genet. Biol. 2009, 46, 837–848. [Google Scholar] [CrossRef]
  36. Hausner, G. Introns, Mobile Elements, and Plasmids. In Organelle Genetics: Evolution of Organelle Genomes and Gene Expression; Bullerwell, C.E., Ed.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 329–357. [Google Scholar]
  37. Nielsen, R. Molecular signatures of natural selection. Annu. Rev. Genet. 2005, 39, 197–218. [Google Scholar] [CrossRef]
  38. Kang, X.C.; Hu, L.Q.; Shen, P.Y.; Li, R.; Liu, D.B. SMRT Sequencing Revealed Mitogenome Characteristics and Mitogenome-Wide DNA Modification Pattern in Ophiocordyceps sinensis. Front. Microbiol. 2017, 8, 1422. [Google Scholar] [CrossRef]
  39. Mendoza, H.; Lamb, E.A.; Thomas, J.; Tavares, D.G.; Schroeder, L.A.; Müller, C.; Agrawal, N.; Schirawski, J.; Perlin, M.H. Comparative mitogenomic analysis of Sporisorium reilianum f. sp. zeae suggests recombination events during its evolutionary history. Front. Physiol. 2024, 15, 1264359. [Google Scholar] [CrossRef]
  40. Gardes, M.; Bruns, T. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
  41. Jin, J.J.; Yu, W.B.; Yang, J.B.; Song, Y.; dePamphilis, C.W.; Yi, T.S.; Li, D.Z. GetOrganelle: A fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biol. 2020, 21, 241. [Google Scholar] [CrossRef]
  42. Dierckxsens, N.; Mardulyn, P.; Smits, G. NOVOPlasty: De novo assembly of organelle genomes from whole genome data. Nucleic Acids Res. 2017, 45, e18. [Google Scholar]
  43. Wu, X.; Heffelfinger, C.; Zhao, H.Y.; Dellaporta, S.L. Benchmarking variant identification tools for plant diversity discovery. BMC Genom. 2019, 20, 701. [Google Scholar] [CrossRef]
  44. Yao, Z.; You, F.M.; N’Diaye, A.; Knox, R.E.; McCartney, C.; Hiebert, C.W.; Pozniak, C.; Xu, W.N. Evaluation of variant calling tools for large plant genome re-sequencing. BMC Bioinform. 2020, 21, 360. [Google Scholar] [CrossRef] [PubMed]
  45. Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
  46. Langmead, B.; Wilks, C.; Antonescu, V.; Charles, R. Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics 2019, 35, 421–432. [Google Scholar] [CrossRef] [PubMed]
  47. Hahn, C.; Bachmann, L.; Chevreux, B. Reconstructing mitochondrial genomes directly from genomic next-generation sequencing reads—A baiting and iterative mapping approach. Nucleic Acids Res. 2013, 41, e129. [Google Scholar] [CrossRef]
  48. Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq—Versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
  49. Rissman, A.I.; Mau, B.; Biehl, B.S.; Darling, A.E.; Glasner, J.D.; Perna, N.T. Reordering contigs of draft genomes using the Mauve Aligner. Bioinformatics 2009, 25, 2071–2073. [Google Scholar] [CrossRef]
  50. Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
  51. Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef]
  52. Kurtz, S.; Schleiermacher, C. REPuter: Fast computation of maximal repeats incomplete genomes. Bioinformatics 1999, 15, 426–427. [Google Scholar] [CrossRef]
  53. Jiang, Y.; Zhu, C.; Wang, S.; Wang, F.; Sun, Z. Identification of three cultivated varieties of Scutellaria baicalensis using the complete chloroplast genome as a super-barcode. Sci. Rep. 2023, 13, 5602. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, D.; Gao, F.L.; Jakovlic, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
  55. Chen, C.J.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.H.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  56. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  57. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  58. Nylander, J.A.A.; Ronquist, F.; Huelsenbeck, J.P.; Nieves-Aldrey, J.L. Bayesian phylogenetic analysis of combined data. Syst. Biol. 2004, 53, 47–67. [Google Scholar] [CrossRef]
  59. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
  60. Pond, S.L.K.; Frost, S.D.W.; Muse, S.V. HyPhy: Hypothesis testing using phylogenies. Bioinformatics 2005, 21, 676–679. [Google Scholar] [CrossRef]
  61. Pond, S.L.K.; Poon, A.F.Y.; Velazquez, R.; Weaver, S.; Hepler, N.L.; Murrell, B.; Shank, S.D.; Magalis, B.R.; Bouvier, D.; Nekrutenko, A.; et al. HyPhy 2.5—A Customizable Platform for Evolutionary Hypothesis Testing Using Phylogenies. Mol. Biol. Evol. 2020, 37, 295–299. [Google Scholar] [CrossRef]
  62. Smith, M.D.; Wertheim, J.O.; Weaver, S.; Murrell, B.; Scheffler, K.; Pond, S.L.K. Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection. Mol. Biol. Evol. 2015, 32, 1342–1353. [Google Scholar] [CrossRef]
Ijms 27 03407 g001
Figure 1. Molecular phylogeny of the ITS region in 102 Armillaria sequences based on ML (A) and BI (B) analyses. Lentinus edodes and Ganoderma applanatum were used as the outgroup. BS: Bootstrap, BPP: Bayesian posterior probability.
Figure 1. Molecular phylogeny of the ITS region in 102 Armillaria sequences based on ML (A) and BI (B) analyses. Lentinus edodes and Ganoderma applanatum were used as the outgroup. BS: Bootstrap, BPP: Bayesian posterior probability.
Ijms 27 03407 g001
Ijms 27 03407 g002
Figure 2. Mitogenome map of six strains of Armillaria mellea. Different colored blocks represent genes. Colored blocks within each ring indicate that the genes are on the direct strand.
Figure 2. Mitogenome map of six strains of Armillaria mellea. Different colored blocks represent genes. Colored blocks within each ring indicate that the genes are on the direct strand.
Ijms 27 03407 g002
Ijms 27 03407 g003
Figure 3. Gene deletion in the Armillaria genus. Each column represents a strain of Armillaria. Each row represents a gene. The grid color from red to blue represents copy numbers 7 to 0.
Figure 3. Gene deletion in the Armillaria genus. Each column represents a strain of Armillaria. Each row represents a gene. The grid color from red to blue represents copy numbers 7 to 0.
Ijms 27 03407 g003
Ijms 27 03407 g004
Figure 4. The RSCU values of all PCGs for six strains of Armillaria mellea. Color key: the red values indicate higher RSCU values and the green values indicate lower RSCU values.
Figure 4. The RSCU values of all PCGs for six strains of Armillaria mellea. Color key: the red values indicate higher RSCU values and the green values indicate lower RSCU values.
Ijms 27 03407 g004
Ijms 27 03407 g005
Figure 5. Comparison of repeats in the mitogenomes of six strains of Armillaria mellea. (A) SSRs for mitogenomes of six strains of Armillaria mellea. (B) Interspersed repeated sequences of complete mitogenomes. (C) Interspersed repeated sequences of introns. (D) Tandem repeats quantity.
Figure 5. Comparison of repeats in the mitogenomes of six strains of Armillaria mellea. (A) SSRs for mitogenomes of six strains of Armillaria mellea. (B) Interspersed repeated sequences of complete mitogenomes. (C) Interspersed repeated sequences of introns. (D) Tandem repeats quantity.
Ijms 27 03407 g005
Ijms 27 03407 g006
Figure 6. Collinearity of nine mitogenomes of Armillaria. The white rectangle represents CDS, the red rectangle represents rRNA, and introns are connected by line segments.
Figure 6. Collinearity of nine mitogenomes of Armillaria. The white rectangle represents CDS, the red rectangle represents rRNA, and introns are connected by line segments.
Ijms 27 03407 g006
Ijms 27 03407 g007
Figure 7. Core gene arrangement map. The same genes are indicated by squares of the same color. The squares located below the horizontal line correspond to the genes, which are situated on the reverse strand.
Figure 7. Core gene arrangement map. The same genes are indicated by squares of the same color. The squares located below the horizontal line correspond to the genes, which are situated on the reverse strand.
Ijms 27 03407 g007
Ijms 27 03407 g008
Figure 8. The dN/dS of 16 PCGs and ORFs (oi4cox1, oi1cob, oi1cox1, oi2cox1, oi2cox2, oi4cob, oi2cob, and rpol). The numbers on the branches indicate dN/dS (ω) value. The blue area represents the six strains of A. mellea.
Figure 8. The dN/dS of 16 PCGs and ORFs (oi4cox1, oi1cob, oi1cox1, oi2cox1, oi2cox2, oi4cob, oi2cob, and rpol). The numbers on the branches indicate dN/dS (ω) value. The blue area represents the six strains of A. mellea.
Ijms 27 03407 g008
Ijms 27 03407 g009
Figure 9. The ML (right) and BI (left) phylogenetic trees were constructed based on the 16 PCGs. Lentinus edodes and Ganoderma applanatum were used as the outgroup. The red data represents the support rate, while the black data represents the length of the evolutionary branch. The same color box indicates a closer genetic relationship.
Figure 9. The ML (right) and BI (left) phylogenetic trees were constructed based on the 16 PCGs. Lentinus edodes and Ganoderma applanatum were used as the outgroup. The red data represents the support rate, while the black data represents the length of the evolutionary branch. The same color box indicates a closer genetic relationship.
Ijms 27 03407 g009
Ijms 27 03407 g010
Figure 10. Six strains of Armillaria mellea.
Figure 10. Six strains of Armillaria mellea.
Ijms 27 03407 g010
Table 1. Genes in the mitogenomes of six strains of Armillaria mellea.
Table 1. Genes in the mitogenomes of six strains of Armillaria mellea.
Group of GenesGene NamesAmount
Protein-coding genes (PCGs)nad1, nad2, nad3, nad4, nad4 L, nad5, nad6, cob, cox1, cox2, cox3, atp6, atp8, atp9, rps3, rpo16
Intronic ORFsGIY-YIG endonuclease and intron ORFs (oi1cox1, oi2cox1, etc.)20
Intergenic ORFs (hypothetical proteins)hyp3, hyp5, hyp93
rRNArnl (large subunit rRNA), rns (small subunit rRNA)2
tRNATyrosine, Proline (×2), Asparagine (×2), Phenylalanine, Aspartic acid, Tryptophan, Isoleucine, Arginine (×2), Glycine, Threonine, Glutamine, Leucine (×2), Glutamic acid, Lysine, Valine, Cysteine, Methionine (×3), Serine, Histidine, Alanine, Serine27
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jiang, Y.; Li, Y.; Zhang, Y.; Jin, J.; Cao, Y.; Wang, Y.; Sun, Z. Characterization of Six Complete Mitochondrial Genomes and ITS Sequences from Armillaria mellea (Vahl) P. Kumm.: A Phylogenetic Study and Comparative Analysis. Int. J. Mol. Sci. 2026, 27, 3407. https://doi.org/10.3390/ijms27083407

AMA Style

Jiang Y, Li Y, Zhang Y, Jin J, Cao Y, Wang Y, Sun Z. Characterization of Six Complete Mitochondrial Genomes and ITS Sequences from Armillaria mellea (Vahl) P. Kumm.: A Phylogenetic Study and Comparative Analysis. International Journal of Molecular Sciences. 2026; 27(8):3407. https://doi.org/10.3390/ijms27083407

Chicago/Turabian Style

Jiang, Yuan, Yaping Li, Yuanfan Zhang, Jiadi Jin, Yisu Cao, Yanjun Wang, and Zhirong Sun. 2026. "Characterization of Six Complete Mitochondrial Genomes and ITS Sequences from Armillaria mellea (Vahl) P. Kumm.: A Phylogenetic Study and Comparative Analysis" International Journal of Molecular Sciences 27, no. 8: 3407. https://doi.org/10.3390/ijms27083407

APA Style

Jiang, Y., Li, Y., Zhang, Y., Jin, J., Cao, Y., Wang, Y., & Sun, Z. (2026). Characterization of Six Complete Mitochondrial Genomes and ITS Sequences from Armillaria mellea (Vahl) P. Kumm.: A Phylogenetic Study and Comparative Analysis. International Journal of Molecular Sciences, 27(8), 3407. https://doi.org/10.3390/ijms27083407

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop