Next Article in Journal
Host–Pathogen Crosstalk in Pediatric Peritoneal Dialysis-Associated Peritonitis: Molecular Mechanisms Driving Peritoneal Membrane Remodeling
Next Article in Special Issue
Suppression of Glucosylceramide Synthase Reverses Drug Resistance in Cancer Cells Harboring Homozygous p53 Mutants
Previous Article in Journal
Mitochondrial Graph-Based Pan-Genome Analysis of Hypsizygus marmoreus: Structural Variation, Adaptive Evolution, and Its Implications for Germplasm Resource Improvement
Previous Article in Special Issue
KRAS Copy Number Gain in Cell-Free DNA Analysis-Based Liquid Biopsy of Plasma and Bile in Patients with Various Pancreatic Neoplasms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 7
10.3390/ijms27073131
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tissue-Specific Expression of the EWSR1::FLI1 Fusion Protein Identifies col2a1a-Positive Cells as a Source of Ewing Sarcoma-like Tumors in Zebrafish

by
Rebecca A. Anderson
1,†,
Xin Chen
1,†,
Usua Oyarbide
1,
Nicolas J. Alvarez
1,
Aidan Sievers
1,
Gary K. Schwartz
2 and
Seth J. Corey
1,2,*
1
Departments of Pediatrics and Heart, Blood, Kidney Research, Cleveland Clinic Research, Cleveland, OH 44106, USA
2
Case Comprehensive Cancer Center, Cleveland, OH 44106, USA
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2026, 27(7), 3131; https://doi.org/10.3390/ijms27073131
Submission received: 17 February 2026 / Revised: 18 March 2026 / Accepted: 19 March 2026 / Published: 30 March 2026
(This article belongs to the Special Issue Cancer Biology: From Genetic Aspects to Treatment, 2nd Edition)
Browse Figures
Review Reports Versions Notes

Abstract

Ewing sarcoma (ES) is the second most common primary bone malignancy in children and adolescents and remains one of the most lethal pediatric cancers. Found in more than 85% of patients with ES, EWSR1::FLI1 results from the t(11;22)(q24;q12) chromosomal translocation. This fusion encodes an aberrant transcription factor that dysregulates gene expression and drives oncogenic transformation. Although this oncogene was identified over three decades ago, therapeutic progress has been limited, in part due to the lack of robust and permissive animal models. Prior efforts to generate transgenic mouse models have been unsuccessful, and while zebrafish have emerged as a promising system, a tissue context capable of supporting EWSR1::FLI1-driven tumorigenesis has not been defined. Here, we report that tissue-specific expression of EWSR1::FLI1 in zebrafish induces tumor formation that recapitulates the histologic and molecular hallmarks of human ES, including small round blue cell morphology and characteristic biomarker expression. Tumors were driven by the col2a1a promoter and resulted in ~70% incidence of notochord tumors within the first 72–96 h. Of the surviving fish, ~5% developed CD99-positive small round blue cell tumors at ~9 months post-fertilization. This work establishes a stable tissue-specific transgenic model of ES, providing a powerful in vivo platform to investigate disease pathogenesis and evaluate novel therapeutic strategies.

1. Introduction

Ewing sarcoma (ES) is the second most common bone cancer in children, and one of the most lethal pediatric cancers. Approximately 250 individuals in the US are annually diagnosed with ES [1]. Overall five-year survival with limited disease is 60%, and those with recurrent or relapsed disease is less than 20% [2]. Nearly 25% of patients have metastatic disease at time of diagnosis [3,4]. Current treatment includes an intensive regimen of five chemotherapeutic agents with a high level of toxicity [5]. Recurrent ES is currently incurable.
Nearly 90% of ES cases harbor the characteristic chromosomal translocation t(11;22)(q24;q12), which generates a fusion between the Ewing sarcoma breakpoint region 1 (EWSR1) gene and the Friend leukemia virus integration 1 (FLI1) gene (Figure 1A) [6,7]. EWSR1, a member of the TET family of RNA-binding proteins, is frequently involved in chromosomal translocations that fuse its N-terminal transactivation domain to the DNA-binding domains of various ETS family transcription factors, such as FLI1. The resulting EWSR1–ETS fusion proteins act as aberrant transcriptional regulators that drive oncogenic transformation in ES and related sarcomas. This leads to a ubiquitously expressed fusion protein that is believed to act as an aberrant transcription factor, promoting transformation through dysregulated gene expression and leading to cancer within bone and soft tissue [8,9].
ES is most often associated with the bone, with 40% of cases arising in the leg; approximately 15–20% of ES cases are extraosseous, with the paravertebral region being the most common site [10]. A histologic feature of all ES tumors is a small round blue cell tumor (SRBCT) morphology. Hematoxylin and eosin (H&E) staining of tumors show undifferentiated cells with little cytoplasm and small, round nuclei that stain deep blue [11]. A common characteristic of ES tumors, although not specific to ES, is diffuse membranous staining by the cell-surface glycoprotein CD99 [11]. ES tumors also typically stain positive for periodic acid Schiff (PAS) due to a high cytosolic glycogen content [11].
Despite the molecular identification of the oncogenic transcription factor in ES in 1993, there has been little progress in developing better therapies [12]. A major obstacle to developing new, more effective therapies against ES is the lack of animal models [5]. Prior attempts at producing a transgenic model of ES in the mouse have proved unsuccessful [13]. Leacock et al. [14] and Vasileva et al. [15] have shown the zebrafish to be a promising model to study ES, yet they have not identified a cell group permissible to EWSR1::FLI1 expression. Here, we report that tissue-specific expression of EWSR1:FLI1 drives the development of tumors, which recapitulate the characteristics of ES. This is the first reported tissue-specific stable transgenic model of ES.

2. Results

2.1. col2a1a-Expressing Cells Act as a Permissive Environment for EWSR1::FLI

To overcome early developmental toxicity associated with ubiquitous EWSR1::FLI1 expression, we selected the col2a1a promoter to drive expression of the fusion oncoprotein in the zebrafish. (The human ortholog is COL2A1.) Expression of col2a1 occurs in chondrocytes and is conserved from teleost (bony fish) to mammals [16,17,18]. In the zebrafish, col2a1a expression is first detected in the notochord at 10 h post-fertilization (hpf) [18,19]. Similarly to human development, the notochord in zebrafish is derived from axial mesodermal cells that undergo differentiation to form large vacuolated epithelial cells [20]. In both zebrafish and humans, the embryonic notochord organizes the development of the axial skeleton. Most bones in the human body are endochondral, i.e., they develop from a cartilage template. Consistent with human bone development, expression of col2a1a in the zebrafish is found within the resting and proliferating chondrocytes of the endochondral growth plates [19,21].
To compare the effects of tissue-specific EWSR1::FLI1 expression to that of ubiquitous expression, we injected the constructs Tg(col2a1a:EWSR1::FLI1:pA) (Figure 1B) and Tg(ubi:EWSR1::FLI1:pA) into wild-type zebrafish at the one-cell stage. The transgene backbone of each construct contains the cryaa:EGFP element, allowing for the identification of transgene-positive fish at 2 dpf by green lens fluorescence (Figure 1C,D). Approximately 97% of the Tg(ubi:EWSR1::FLI1:pA) larvae (292/300 injected embryos) were dead or grossly malformed by 3 dpf, indicating ubiquitous expression of EWSR1:FLI1 results in embryonic lethality [14,15]. Conversely, nearly all the Tg(col2a1a:EWSR1::FLI1:pA) injected embryos were alive at 3 dpf and showed no gross congenital malformations. To confirm transgene expression of the oncoprotein in viable Tg(col2a1a:EWSR1::FLI1:pA) larvae, we extracted RNA from green-eyed transgene-positive fish at 7 dpf and used semi-quantitative RT-PCR and human-specific primers (Table 1) to amplify the fusion construct (Figure 1E). Expression of EWSR1::FLI1 was detected in green-eyed larvae but not in non-green-eyed siblings with actin as a control (Figure 1F,G). Thus, selective tissue expression of EWSR1::FLI1 by col2a1a does not result in embryonic lethality, and col2a1a expression domains provide a permissive environment for the expression of the EWSR1::FLI1 oncoprotein.

2.2. Expression of EWSR1::FLI1 Within Cartilaginous Elements Results in DNA Damage and Craniofacial Defects During Early Development

While the Tg(col2a1a:EWSR1::FLI1:pA) larvae showed no gross deformities during the first seven days of development, they displayed morphological phenotypes (Figure 2 and Supplemental Figure S1). Beginning around 3 dpf, some fish displayed enlarged ears, affecting them unilaterally (Figure S1A) or bilaterally (Figure S1B). Although the ears were enlarged, patterning of the ear was not grossly abnormal. Craniofacial defects were highly penetrant, with most G0 fish showing some degree of malformation by 7 dpf (Figure 2B,C). Notably, close to 60% of transgenic fish did not develop a swim bladder by 7 dpf (Figure 2A,B versus Figure 2C). The fish that did not develop swim bladders by 7 dpf died. The lack of swim bladder development did not directly correlate with the presence of ear defects and/or craniofacial defects. Overall, transgenic fish were smaller than their non-transgenic siblings (Figure 2D). When comparing the transgenic fish that had swim bladders to the non-transgenic fish, the transgenic fish that developed swim bladders displayed no difference in swim bladder size (Figure 2E), indicating that their decreased size was unlikely due to a developmental delay.
To characterize the craniofacial skeletal defects, we used Alcian Blue to stain the craniofacial cartilage at 6 dpf (Figure S1C–H). Comparison of transgenic fish to non-transgenic siblings revealed patterning defects in the cartilaginous elements of the transgenic larvae. While there were no obvious fusions or deletions of elements, the angels of the ceratohyal (ch) and Meckel’s cartilage (mc) were noticeably narrowed (Figure S1E,H). The ethmoid plate (ep) appeared shortened (Figure S1F,G), with a severe shortening observed in mc (Figure S1G,H).
To investigate how expression of the EWSR1::FLI1 fusion protein in chondrocytes might cause severe compression or shortening of skeletal elements and associated cartilage defects, we examined DNA damage in craniofacial cartilage using the γ-H2AX antibody at 7 dpf (Figure 3A–F). Transgenic larvae exhibited a pronounced increase in DNA double-strand breaks within the cartilage, as evidenced by markedly elevated γ-H2AX staining in craniofacial structures such as the ep (Figure 3D), ch (Figure 3E,F), hyosymplectic (hs) (Figure 3E), ceratobranchials (cb), and mc (Figure 3F). Furthermore, γ-H2AX was also observed in the enlarged ear(s) of transgenic larvae (Figure 3D). These results indicate that expression of the fusion protein within cartilaginous elements during early development results in DNA damage and subtle patterning defects.

2.3. Tg(col2a1a:EWSR1::FLI1:pA) Larvae Develop Notochordal Neoplasms During Early Development

In addition to the cartilaginous elements of the skeleton, expression of col2a1a is also found within the notochord. In zebrafish, the detection of col2a1a is first seen within the notochord and strong notochordal expression continues throughout early development [19,23]. Intriguingly, the Tg(col2a1a:EWSR1::FLI1:pA) larvae developed multifocal notochordal growths detectable by microscopic examination (Figure 4A,D–F). Notochord growths represented a highly penetrant phenotype, with ~70% of transgenic larvae exhibiting notochord dysplasia by 5 dpf. The occurrence of notochord defects did not directly correlate with the absence of swim bladder inflation. To further characterize these lesions, larvae were stained with Alcian Blue, which labels negatively charged proteoglycans containing sulfated and/or carboxylated glycosaminoglycans (GAGs) such as heparan sulfate, chondroitin sulfate, and hyaluronic acid. The notochord growths showed intense Alcian Blue staining and were readily visible within the notochord (Figure 4A,F). The extracellular matrix of the notochord growths is enriched in negatively charged proteoglycans. To further examine the notochord architecture and the nature of the growths, we performed hematoxylin and eosin (H&E) staining on coronal (Figure 4B) and sagittal (Figure 4C) sections of 6 dpf larvae. In non-transgenic siblings, the notochord exhibited the typical organization of large vacuolated cells (Figure 4B). In contrast, transgenic larvae displayed focal regions of cellular hyperplasia, characterized by clusters of cells within a dysplastic notochordal structure (Figure 4C). No spatial bias toward either the anterior or posterior notochord was observed. While the growths appeared dysplastic, they did not resemble the SBRC morphology associated with ES.

2.4. Development and Characterization of ES-like Tumors Driven by EWSR1::FLI1 Fusion Protein

While the Tg(col2a1a:EWSR1::FLI1:pA) are fully viable during the first 7 dpf, only ~40% of transgenic fish were able to survive past 7 dpf due to defective swim bladder development (Figure 2C). Of the fish that survived past 7 dpf, approximately 5% (9 out of 185 adult fish) went on to develop grayish-white, fleshy, vascularized tumors near and around the bony tissues of the fins in adulthood (Figure 5A–F). ES often presents as a fleshy, gray-white, lobulated tumor with a somewhat soft surface [24]. Phenotypically, the tumors observed in adult Tg(col2a1a: EWSR1::FLI1:pA) zebrafish closely resembled those of human ES. To determine if the Tg(col2a1a: EWSR1::FLI1:pA) tumors met the histological criteria of ES, we performed H&E, PAS, and CD99 staining on paraffin sections of the zebrafish tumors. Histological analysis of the zebrafish tumors revealed a SRBC morphology upon H&E staining (Figure 5G), a positive PAS staining (Figure 5H), and positive CD99 staining (Figure 5I). These results indicate that the tumors that develop in adult Tg(col2a1a: EWSR1::FLI1:pA) zebrafish mimic those of ES. This suggests that expression of the fusion oncoprotein within col2a1a-expressing cells allows for the development of ES.
Immunohistochemical staining of the EWSR1::FLI1-driven tumors showed intense staining for the proliferating cell nuclear antigen (PCNA) marker with less intense staining for phospho-γH2AX (Figure 6A,B). Based on the development of notochord tumors, we speculated that adult ES-like tumors might be related to neural crest cells. In support of this, strong staining for the transcription factor Sox10, a sensitive marker for neural crest stem cell, was detected in the tumors (Figure 6C) [25]. Further work, such as scRNA-Seq, needs to be done to confirm this.

3. Discussion

Neither genetically engineered mouse models nor mammalian cell lines of ES generated through ectopic expression of the EWSR1::FLI1 fusion oncogene have been reliably established. This difficulty is widely attributed to the inherent toxicity of the fusion protein [13] and has hindered progress in developing new therapeutic strategies. The low tumor mutational burden and lack of additional genetic lesions at diagnosis support the notion that the fusion protein alone is sufficient to drive the development of ES [9]. Here, we report the establishment of a stable transgenic zebrafish strain, which expresses the human EWSR1::FLI1 fusion that developed multifocal notochord tumors within ~3 dpf and SRBCT encasing bone at ~9 mpf. The SRBCT stained positively for CD99, which is almost always expressed on human ES cells. Our work is novel in that it demonstrates the following: (1) col2a1a cells allow expression of the EWSR1::FLI1 and do not die; (2) expression in these cells leads to ES-like tumor formation.
We believe that the SRBCT emanate from a skeletal-associated lineage. This is supported by several observations: (1) The tumors arose in close proximity to regions of active bone growth. (2) As shown in Figure 5D, the tumor is wrapped around the bone. The skeletal rays (fins) of the fish are dermal bones. Directly below the rays are the distal and proximal radials (endoskeletal supports). This location is where the tumors are developing. (3) As shown Figure 3, increased DNA damage is accompanied by disruption of growth plate organization.
We first used the ubi promoter, which failed to produce viable zebrafish. Choosing to use the col2a1a promoter that is active in embryonic skeletal, neural crest, and notochord tissues [19], we were successful in generating transgenic fish that survived into adulthood. The EWSR1::FLI1 transgenic larvae demonstrated a high penetrance of multifocal notochord tumors beginning around 3 dpf. The lack of viability with the ubiquitous promoter suggests that the oncofusion protein is broadly toxic to the organism, although certain tissues appear able to tolerate its expression. The fate of these notochord tumors remains unclear, as adult zebrafish show neither persistent notochord abnormalities nor evidence of chordomas [23]. Moreover, the notochord tumors do not support a neural crest cell of origin as the notochord is not derived from neural crest cells. Instead, the neural crest cells migrate around the notochord to form neurons and glia [26].
There has been ongoing debate regarding the cell of origin for ES, with mesenchymal and neural crest lineages being favored [27,28]. The ear and notochordal defects seen in our transgenic fish are likely due to the strong expression of col2a1a in the otic vesicle and notochord [19] driving the oncofusion protein expression. The craniofacial defects are likely a result of col2a1a expression, driving EWSR1::FLI1 expression in the proliferating chondrocytes of the growth plates in the endochondral bones of the craniofacial skeleton. These results demonstrate that embryonic osteochondrogenic progenitors are a permissive environment for expression of the EWSR1::FLI1 oncoprotein. The development of ES-like tumors in our transgenic zebrafish model affirms that embryonic osteochondrogenic progenitors are permissive to ES [29]. Furthermore, multiple lines of evidence suggest that ES may arise from chondrocyte as followss: (1) expression of chondrocyte-associated genes such as SOX9 and COL2A1, (2) the ability of EWSR1::FLI1 to direct mesenchymal stem cells toward a chondrogenic program, and (3) the frequent occurrence of ES near growth plate regions, where chondrocytes reside. Col2a1a is a strong marker for resting and proliferating chondrocytes in the growth plate, with expression decreasing as cells undergo hypertrophic differentiation and becoming minimal in late-stage chondrocytes.
Using a different approach to develop ES tumors in zebrafish, Vasileva et al. showed that EWSR1::FLI1 can reprogram neural crest cells toward a mesenchymal state [30]. In this conditional transgenic zebrafish model, embryonic injection of a Cre recombinase, Tol2 transposase, and ubi-driven EWSR1::FLI1 produced SRBCT [15,30]. To demonstrate involvement of neural crest cell progenitors, the conditional expression was demonstrated by using the murine Sox10 promoter. Thus, zebrafish modeling can provide insights into which tissues can tolerate the EWSR1::FLI1 protein, but such insights would be tempered by the specific promoter. The cell of origin has been debated for some time, with sides favoring either neural crest or mesenchymal stem cell. Because of the Sox10 staining (Figure 6C), we cannot rule out a neural crest cell. However, SOX10 also marks differentiating chondrocytes in the growth plate and articular cartilage [31]. Altogether, the data presented here on our col2a1a-driven EWSR1::FLI1 transgenic model favors more a mesenchymal stem cell or chondrocyte/cartilage cell of origin. More definitive studies aiming to identify the ES cell of origin are proceeding with lineage tracing experiments, time-lapse imaging of the growth plates/tumors, and double in situ hybridization on the growth plates/tumors.
In transgenic zebrafish, the integration site and copy number of a transgene are not routinely determined because the construct can integrate essentially anywhere in the genome and may do so multiple times. As a result, each G0 fish may carry the transgene at a different genomic insertion site. In this study, we are not comparing this transgenic line to other lines. Rather, we report two observations: (1) cells expressing col2a1a permit expression of the fusion protein, and (2) expression of the fusion protein within col2a1a-expressing cells leads to tumor formation. Besides the use of promoters other than col2a1a that might drive tumor formation in other tissues, limitations to our model include the long latency period and low penetrance. ES arises with a median age of 15 years. Zebrafish typically live for two years, and ES-like tumors did not develop until ~9 mpf. Thus, aging may play a role in carcinogenesis. Although the penetrance of ES-like tumors in the transgenic zebrafish is low, ES is also a rare cancer in humans, with only ~1000 cases diagnosed annually throughout the world.
No molecularly targeted therapy currently exists for ES [32]. Conditional or stable transgenic zebrafish lines can be used to screen potential drugs to target EWSR1::FLI1 or its downstream targets. Because zebrafish acquire components of the adaptive immune response within 4–6 weeks post-fertilization [33,34,35], these organismal models can also be used to evaluate the efficacy of immunotherapy.

4. Materials and Methods

4.1. Creation of Transgenic Lines

The cDNA sequence of human EWSR1::FLI1 type 1 fusion was amplified from the pCDH-puro-EWSR1-FLI1 plasmid (Addgene #102813, Watertown, MA, USA) [36] using attB PCR primers (Table 1) and cloned using the Gateway BP reaction on the pDONOR221 plasmid. To create the Tg(ubi:EWSR1::FLI1:pA) and the Tg(col2a1a:EWSR1::FLI1:pA) lines, the cDNA sequence of EWSR1::FLI1 was cloned between the ubi and col2a1a promoters, respectively, and a polyA sequence in the pDestTol2pACryGFP vector was cloned using Gateway LR reactions. The constructs were confirmed by restriction enzyme analysis and sequencing. The col2a1a promoter on the p5E plasmid was a kind gift from Dr. Rodney Dale (Loyola University, Chicago, IL, USA). The other plasmids are available in the Tol2kit (Addgene, Watertown, MA, USA) [37]. The transgenic lines were created using the Tol2 transposase method [37]. Transgene-positive fish were identified at 2 days post-fertilization (dpf) by GFP-positive lens and PCR genotyping with genome DNA.

4.2. Semi-Quantitative RT-PCR

Twenty Tg(col2a1a:EWSR1::Fli1:pA) larvae with green eyes, as well as twenty non-transgenic siblings without green eyes, were collected at 7 dpf. The fish were pooled, and RNA was extracted using Trizol (ThermoFisher Scientific, Waltham, MA, USA). Using 175 ng RNA from each pool and primers specific to human EWSR1 and FLI1 (Table 1), PCR was performed using the Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (ThermoFisher Scientific, Waltham, MA, USA). The PCR products were separated using 3.5% Metaphor agarose and 1% agarose gels.

4.3. Alcian Blue Staining

Larval fish were euthanized and fixed overnight in phosphate-buffered 10% formalin. Cartilage staining was performed as previously described [38].

4.4. Histological Sections

Larvae and adult fish were euthanized and fixed overnight in phosphate-buffered 10% formalin. Adult fish were treated for eight hours with 0.5M EDTA prior to processing. Sectioning, H&E staining, and antibody staining were carried out in the Cleveland Clinic Histology Core. Slides were incubated with anti-CD99 antibody (ab108297, Abcam at 1:100, Cambridge, UK), phospho-γH2AX (GTX 127342, GeneTex at 1:1000, Irvine, CA, USA), PCNA (GTX 124496, GeneTex at 1:1000, Irvine, CA, USA), and Sox10 (GTX 128374, GeneTex at 1:250, Irvine, CA, USA). All images were taken using ZEISS (Oberkochen, Germany) stereoscopes (Stemi 508 and Discovery V8) and an AxioImager M2 microscope equipped with a camera (Axiocam, Oberkochen, Germany). H&E and PAS staining were performed using commercially available kits in the histology core at Cleveland Clinic.

4.5. Zebrafish Lines and Maintenance

The following wild-type and transgenic fish lines were used: AB (ZFIN ID: ZDB-BENO-960809-7), Tg(ubi:EWSR1::FLI1:pA), and Tg(col2a1a:EWSR1::FLI1:pA).

4.6. Statistical Analysis

Unpaired Student’s t-test was performed using GraphPad Prism Version 10.6.1.

5. Conclusions

A stable zebrafish line expressing the human EWSR1::FLI1 fusion gene under the control of the col2a1a promoter survives past adulthood, suggesting that chondrocytes represent a permissive cellular context for EWSR1::FLI1 expression. Bone-associated SRBCT form at around 9 mpf. These tumors express markers of human ES, such as CD99 and SOX10. We are currently breeding them with other zebrafish lines to accelerate tumor formation. Our transgenic zebrafish model can provide an organismal model to test direct or indirect targets of the oncofusion protein.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms27073131/s1.

Author Contributions

R.A.A. and S.J.C.; methodology, R.A.A., U.O. and X.C.; validation, R.A.A. and X.C.; formal analysis, R.A.A. and X.C.; investigation, R.A.A., X.C., N.J.A., A.S. and S.J.C.; data curation, R.A.A.; writing—original draft preparation, R.A.A. and S.J.C.; writing—review and editing, R.A.A., X.C., G.K.S. and S.J.C.; visualization, X.C. and U.O.; supervision, R.A.A., X.C. and S.J.C.; project administration, S.J.C.; funding acquisition, R.A.A., U.O., G.K.S. and S.J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from VeloSano Kids to U.O., a Phase I Centers of Excellence Award provided by Cleveland Clinic Research and Department of Defense Rare Cancer Idea HT9425-24-1-0713 to S.J.C. and NIH CTSC TL1 to R.A.A.

Institutional Review Board Statement

All zebrafish experiments were approved by the Cleveland Clinic Institutional Animal Care and Use Committee (IACUC # 2330, approved June 30, 2023) and were complied with National Institutes of Health standards provided in the ‘Guide for the Care and Use of Laboratory Animals’.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author(s).

Acknowledgments

The authors have reviewed and edited the output and take full responsibility for the content of this publication.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
bpbase pair
chceratohyal
dpfdays post-fertilization
epethmoid plate
ESEwing sarcoma
EWSR1Ewing sarcoma breakpoint region 1
FLI1Friend leukemia virus integration 1
G0generation 0
H&Ehematoxylin and eosin
hhour
hpfhours post-fertilization
mcMeckel’s cartilage
mpfmonths post-fertilization
pApolyA
PASperiodic acid Schiff
PCNAproliferating cell nuclear antigen
qRT-PCRquantitative reverse transcription polymerase chain reaction
SRBCTsmall round blue cell tumor
Tgtransgenic
ubiubiquitin

References

  1. Bernstein, M.; Kovar, H.; Paulussen, M.; Randall, R.L.; Schuck, A.; Teot, L.A.; Juergens, H. Ewing’s sarcoma family of tumors: Current management. Oncologist 2006, 11, 503–519. [Google Scholar] [CrossRef]
  2. Leavey, P.J.; Mascarenhas, L.; Marina, N.; Chen, Z.; Krailo, M.; Miser, J.; Brown, K.; Tarbell, N.; Bernstein, M.L.; Granowetter, L.; et al. Prognostic factors for patients with Ewing sarcoma (EWS) at first recurrence following multi-modality therapy: A report from the Children’s Oncology Group. Pediatr. Blood Cancer 2008, 51, 334–338. [Google Scholar] [CrossRef]
  3. Esiashvili, N.; Goodman, M.; Marcus, R.B., Jr. Changes in incidence and survival of Ewing sarcoma patients over the past 3 decades: Surveillance Epidemiology and End Results data. J. Pediatr. Hematol. Oncol. 2008, 30, 425–430. [Google Scholar] [CrossRef] [PubMed]
  4. Ladenstein, R.; Potschger, U.; Le Deley, M.C.; Whelan, J.; Paulussen, M.; Oberlin, O.; van den Berg, H.; Dirksen, U.; Hjorth, L.; Michon, J.; et al. Primary disseminated multifocal Ewing sarcoma: Results of the Euro-EWING 99 trial. J. Clin. Oncol. 2010, 28, 3284–3291. [Google Scholar] [CrossRef]
  5. Arnaldez, F.I.; Helman, L.J. New strategies in ewing sarcoma: Lost in translation? Clin. Cancer Res. 2014, 20, 3050–3056. [Google Scholar] [CrossRef] [PubMed][Green Version]
  6. Delattre, O.; Zucman, J.; Plougastel, B.; Desmaze, C.; Melot, T.; Peter, M.; Kovar, H.; Joubert, I.; de Jong, P.; Rouleau, G.; et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 1992, 359, 162–165. [Google Scholar] [CrossRef]
  7. May, W.A.; Lessnick, S.L.; Braun, B.S.; Klemsz, M.; Lewis, B.C.; Lunsford, L.B.; Hromas, R.; Denny, C.T. The Ewing’s sarcoma EWS/FLI-1 fusion gene encodes a more potent transcriptional activator and is a more powerful transforming gene than FLI-1. Mol. Cell. Biol. 1993, 13, 7393–7398. [Google Scholar]
  8. Fadul, J.; Bell, R.; Hoffman, L.M.; Beckerle, M.C.; Engel, M.E.; Lessnick, S.L. EWS/FLI utilizes NKX2-2 to repress mesenchymal features of Ewing sarcoma. Genes Cancer 2015, 6, 129–143. [Google Scholar] [CrossRef]
  9. Riggi, N.; Suva, M.L.; Stamenkovic, I. Ewing’s Sarcoma. N. Engl. J. Med. 2021, 384, 154–164. [Google Scholar] [CrossRef]
  10. Wright, A.; Desai, M.; Bolan, C.W.; Badawy, M.; Guccione, J.; Rao Korivi, B.; Pickhardt, P.J.; Mellnick, V.M.; Lubner, M.G.; Chen, L.; et al. Extraskeletal Ewing Sarcoma from Head to Toe: Multimodality Imaging Review. Radiographics 2022, 42, 1145–1160. [Google Scholar] [CrossRef]
  11. Yoshida, A. Ewing and Ewing-like sarcomas: A morphological guide through genetically-defined entities. Pathol. Int. 2023, 73, 12–26. [Google Scholar] [CrossRef] [PubMed]
  12. Daley, J.D.; Whiteway, S.L.; Heske, C.M.; Dela Cruz, F.S.; Whittle, S.B.; Cohen-Gogo, S.; Collier, A.B.; Gupta, A.; Ohm, J.; Clark, A.; et al. New Approaches to Investigate Novel Agents in Ewing Sarcoma: A Report From the Children’s Oncology Group Bone Tumor Committee. Pediatr. Blood Cancer 2025, 72, e31917. [Google Scholar] [CrossRef]
  13. Minas, T.Z.; Surdez, D.; Javaheri, T.; Tanaka, M.; Howarth, M.; Kang, H.J.; Han, J.; Han, Z.Y.; Sax, B.; Kream, B.E.; et al. Combined experience of six independent laboratories attempting to create an Ewing sarcoma mouse model. Oncotarget 2017, 8, 34141–34163. [Google Scholar] [CrossRef] [PubMed]
  14. Leacock, S.W.; Basse, A.N.; Chandler, G.L.; Kirk, A.M.; Rakheja, D.; Amatruda, J.F. A zebrafish transgenic model of Ewing’s sarcoma reveals conserved mediators of EWS-FLI1 tumorigenesis. Dis. Model. Mech. 2012, 5, 95–106. [Google Scholar] [CrossRef]
  15. Vasileva, E.; Warren, M.; Triche, T.J.; Amatruda, J.F. Dysregulated heparan sulfate proteoglycan metabolism promotes Ewing sarcoma tumor growth. eLife 2022, 11, e69734. [Google Scholar] [CrossRef]
  16. Cheah, K.S.; Lau, E.T.; Au, P.K.; Tam, P.P. Expression of the mouse alpha 1(II) collagen gene is not restricted to cartilage during development. Development 1991, 111, 945–953. [Google Scholar] [CrossRef]
  17. Kerney, R.; Hall, B.K.; Hanken, J. Regulatory elements of Xenopus col2a1 drive cartilaginous gene expression in transgenic frogs. Int. J. Dev. Biol. 2010, 54, 141–150. [Google Scholar] [CrossRef]
  18. Yan, Y.L.; Hatta, K.; Riggleman, B.; Postlethwait, J.H. Expression of a type II collagen gene in the zebrafish embryonic axis. Dev. Dyn. 1995, 203, 363–376. [Google Scholar] [CrossRef]
  19. Dale, R.M.; Topczewski, J. Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene. Dev. Biol. 2011, 357, 518–531. [Google Scholar] [CrossRef]
  20. Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
  21. Zhao, Q.; Eberspaecher, H.; Lefebvre, V.; De Crombrugghe, B. Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev. Dyn. 1997, 209, 377–386. [Google Scholar] [CrossRef]
  22. Gorthi, A.; Romero, J.C.; Loranc, E.; Cao, L.; Lawrence, L.A.; Goodale, E.; Iniguez, A.B.; Bernard, X.; Masamsetti, V.P.; Roston, S.; et al. EWS-FLI1 increases transcription to cause R-loops and block BRCA1 repair in Ewing sarcoma. Nature 2018, 555, 387–391, Erratum in Nature 2018, 559, E11. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  23. D’Agati, G.; Cabello, E.M.; Frontzek, K.; Rushing, E.J.; Klemm, R.; Robinson, M.D.; White, R.M.; Mosimann, C.; Burger, A. Active receptor tyrosine kinases, but not Brachyury, are sufficient to trigger chordoma in zebrafish. Dis. Model. Mech. 2019, 12, dmm039545. [Google Scholar] [CrossRef] [PubMed]
  24. Dehner, C.A.; Lazar, A.J.; Chrisinger, J.S.A. Updates on WHO classification for small round cell tumors: Ewing sarcoma vs. everything else. Hum. Pathol. 2024, 147, 101–113. [Google Scholar] [CrossRef]
  25. Yang, L.N.; Huang, W.K.; Li, X.L.; Bai, Y.Z.; Zhang, S.C. Sox10 Is a Specific Biomarker for Neural Crest Stem Cells in Immunohistochemical Staining in Wistar Rats. Dis. Markers 2020, 2020, 8893703. [Google Scholar] [CrossRef]
  26. Bernhardt, R.R.; Goerlinger, S.; Roos, M.; Schachner, M. Anterior-posterior subdivision of the somite in embryonic zebrafish: Implications for motor axon guidance. Dev. Dyn. 1998, 213, 334–347. [Google Scholar] [CrossRef]
  27. Miyagawa, Y.; Okita, H.; Nakaijima, H.; Horiuchi, Y.; Sato, B.; Taguchi, T.; Toyoda, M.; Katagiri, Y.U.; Fujimoto, J.; Hata, J.; et al. Inducible expression of chimeric EWS/ETS proteins confers Ewing’s family tumor-like phenotypes to human mesenchymal progenitor cells. Mol. Cell. Biol. 2008, 28, 2125–2137, Erratum in Mol. Cell. Biol. 2008, 28, 3882. [Google Scholar] [CrossRef]
  28. von Levetzow, C.; Jiang, X.; Gwye, Y.; von Levetzow, G.; Hung, L.; Cooper, A.; Hsu, J.H.; Lawlor, E.R. Modeling initiation of Ewing sarcoma in human neural crest cells. PLoS ONE 2011, 6, e19305. [Google Scholar] [CrossRef]
  29. Tanaka, M.; Yamazaki, Y.; Kanno, Y.; Igarashi, K.; Aisaki, K.; Kanno, J.; Nakamura, T. Ewing’s sarcoma precursors are highly enriched in embryonic osteochondrogenic progenitors. J. Clin. Investig. 2014, 124, 3061–3074. [Google Scholar] [CrossRef]
  30. Vasileva, E.; Arata, C.; Luo, Y.; Burgos, R.; Crump, J.G.; Amatruda, J.F. Origin of Ewing sarcoma by embryonic reprogramming of neural crest to mesoderm. Cell Rep. 2025, 44, 116376. [Google Scholar] [CrossRef]
  31. Giovannone, D.; Paul, S.; Schindler, S.; Arata, C.; Farmer, D.T.; Patel, P.; Smeeton, J.; Crump, J.G. Programmed conversion of hypertrophic chondrocytes into osteoblasts and marrow adipocytes within zebrafish bones. eLife 2019, 8, e42736. [Google Scholar] [CrossRef]
  32. Mancarella, C.; Scotlandi, K. Targeting EWS::FLI1 to Advance Ewing Sarcoma Therapy. J. Clin. Oncol. 2024, 42, 3735–3738. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, Y.; Wiest, D.L. Using the Zebrafish Model to Study T Cell Development. In T-Cell Development: Methods and Protocols; Methods in Molecular Biology; Springer: New York, NY, USA, 2016; Volume 1323, pp. 273–292. [Google Scholar]
  34. Rubin, S.A.; Baron, C.S.; Pessoa Rodrigues, C.; Duran, M.; Corbin, A.F.; Yang, S.P.; Trapnell, C.; Zon, L.I. Single-cell analyses reveal early thymic progenitors and pre-B cells in zebrafish. J. Exp. Med. 2022, 219, e20220038. [Google Scholar] [CrossRef]
  35. Lugo-Villarino, G.; Balla, K.M.; Stachura, D.L.; Banuelos, K.; Werneck, M.B.; Traver, D. Identification of dendritic antigen-presenting cells in the zebrafish. Proc. Natl. Acad. Sci. USA 2010, 107, 15850–15855. [Google Scholar] [CrossRef]
  36. Loganathan, S.N.; Tang, N.; Fleming, J.T.; Ma, Y.; Guo, Y.; Borinstein, S.C.; Chiang, C.; Wang, J. BET bromodomain inhibitors suppress EWS-FLI1-dependent transcription and the IGF1 autocrine mechanism in Ewing sarcoma. Oncotarget 2016, 7, 43504–43517. [Google Scholar] [CrossRef]
  37. Kwan, K.M.; Fujimoto, E.; Grabher, C.; Mangum, B.D.; Hardy, M.E.; Campbell, D.S.; Parant, J.M.; Yost, H.J.; Kanki, J.P.; Chien, C.B. The Tol2kit: A multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev. Dyn. 2007, 236, 3088–3099. [Google Scholar] [CrossRef]
  38. Detrich, H.W.; Westerfield, M.; Zon, L.I. The Zebrafish: 2nd Edition Cellular and Developmental Biology, 2nd ed.; Academic Press: San Diego, CA, USA, 2004; Volume 76. [Google Scholar]
Ijms 27 03131 g001
Figure 1. Generation and validation of transgenic EWSR1::FLI1 zebrafish. (A) Schematic of ES translocation t(11;22)(q24;12) in EWSR1::FLI1 fusion showing the N-terminal domain of EWSR1, which contains transactivation domain (TAD), and its fusing with the C-terminal DNA-binding domain of the ETS transcription factor FLI1. (B) The col2a1a promoter is used to drive expression of the human EWSR1::FLI1 fusion construct in transgenic zebrafish created using the Tol2 transposase method. (C,D) Identification of transgene-positive larvae by GFP expression in the lens driven by the cryaa:EGFP cassette at 2 days post-fertilization (dpf). (E) Schematic showing location of human-specific primer set used to amplify fusion construct from RNA using semi-quantitative RT-PCR. (F) Detection of the 1502 bp EWSR1::FLI1 fusion transcript in transgene-positive larvae and ES cell line A673. (G) β-actin was used as the internal control for qRT-PCR. Gr+, green eye positive. Gr−, green eye negative.
Figure 1. Generation and validation of transgenic EWSR1::FLI1 zebrafish. (A) Schematic of ES translocation t(11;22)(q24;12) in EWSR1::FLI1 fusion showing the N-terminal domain of EWSR1, which contains transactivation domain (TAD), and its fusing with the C-terminal DNA-binding domain of the ETS transcription factor FLI1. (B) The col2a1a promoter is used to drive expression of the human EWSR1::FLI1 fusion construct in transgenic zebrafish created using the Tol2 transposase method. (C,D) Identification of transgene-positive larvae by GFP expression in the lens driven by the cryaa:EGFP cassette at 2 days post-fertilization (dpf). (E) Schematic showing location of human-specific primer set used to amplify fusion construct from RNA using semi-quantitative RT-PCR. (F) Detection of the 1502 bp EWSR1::FLI1 fusion transcript in transgene-positive larvae and ES cell line A673. (G) β-actin was used as the internal control for qRT-PCR. Gr+, green eye positive. Gr−, green eye negative.
Ijms 27 03131 g001
Ijms 27 03131 g002
Figure 2. Morphologic characterization of transgenic EWSR1::FLI1 zebrafish. (A) Phenotypic characterization of non-transgenic siblings at 6 dpf. (B,C) Phenotypic characterization of Tg(col2a1a:EWSR1FLI1:pA) at 6 dpf. The white arrows indicate the swim bladder. The bubble characterizing the seim bladder is greatly diminished in panel (C). (D) Quantification of standard length (SL) in transgenic (n = 29) and non-transgenic (n = 25) larvae at 6 dpf. For non-transgenic fish, the SL is 3.82 ± 0.13 mm, and 3.70 ± 0.16 mm for transgenic fish; ** p < 0.01 by unpaired Student’s t-test. (E) Quantification of surface area (SA) of swim bladder in transgenic (n = 29) larvae with swim bladder and non-transgenic (n = 24) larvae at 6 dpf. Only living fish for each condition were studied. For non-transgenic fish, the SA is 0.147 ± 0.027 mm, and 0.143 ± 0.03 for transgenic fish; p = 0.423. The EWSR1::FLI1 transgenic fish were smaller in standard length. Because the immature swim bladders did not statistically differ between the lines at 6 dpf and the gross morphology showed no difference, we conclude that the smaller standard length was not due to a developmental factor.
Figure 2. Morphologic characterization of transgenic EWSR1::FLI1 zebrafish. (A) Phenotypic characterization of non-transgenic siblings at 6 dpf. (B,C) Phenotypic characterization of Tg(col2a1a:EWSR1FLI1:pA) at 6 dpf. The white arrows indicate the swim bladder. The bubble characterizing the seim bladder is greatly diminished in panel (C). (D) Quantification of standard length (SL) in transgenic (n = 29) and non-transgenic (n = 25) larvae at 6 dpf. For non-transgenic fish, the SL is 3.82 ± 0.13 mm, and 3.70 ± 0.16 mm for transgenic fish; ** p < 0.01 by unpaired Student’s t-test. (E) Quantification of surface area (SA) of swim bladder in transgenic (n = 29) larvae with swim bladder and non-transgenic (n = 24) larvae at 6 dpf. Only living fish for each condition were studied. For non-transgenic fish, the SA is 0.147 ± 0.027 mm, and 0.143 ± 0.03 for transgenic fish; p = 0.423. The EWSR1::FLI1 transgenic fish were smaller in standard length. Because the immature swim bladders did not statistically differ between the lines at 6 dpf and the gross morphology showed no difference, we conclude that the smaller standard length was not due to a developmental factor.
Ijms 27 03131 g002
Ijms 27 03131 g003
Figure 3. Increased DNA double-strand breaks in transgenic EWSR1::FLI1 zebrafish. γ-H2AX staining in craniofacial structures with the following: (A) Non-Tg dorsal view. (B) Non-Tg lateral view. (C) Non-Tg ventral view. (D) Tg dorsal view, with the white arrow identifying abnormal ear formation. (E) Tg lateral view. (F) Tg ventral view. These findings suggest that aberrant transcriptional activity driven by EWSR1::FLI1 induces genomic stress with R-loops and DNA double-strand breaks [22] during development, as reflected by increased γ-H2AX staining.
Figure 3. Increased DNA double-strand breaks in transgenic EWSR1::FLI1 zebrafish. γ-H2AX staining in craniofacial structures with the following: (A) Non-Tg dorsal view. (B) Non-Tg lateral view. (C) Non-Tg ventral view. (D) Tg dorsal view, with the white arrow identifying abnormal ear formation. (E) Tg lateral view. (F) Tg ventral view. These findings suggest that aberrant transcriptional activity driven by EWSR1::FLI1 induces genomic stress with R-loops and DNA double-strand breaks [22] during development, as reflected by increased γ-H2AX staining.
Ijms 27 03131 g003
Ijms 27 03131 g004
Figure 4. Development of notochord tumors in zebrafish. (A) Alcian Blue staining of non-Tg larvae at 6 dpf. (B) Coronal section of non-Tg larvae tail at 6 dpf with H&E staining. (C) Sagittal section of non-Tg larvae tail at 6 dpf with H&E staining. (D) Alcian Blue staining of Tg larvae at 6 dpf. The red circles denote notochordal neoplasms. Black arrows indicate the notochord in panels (A,D). (E) Coronal section of Tg larvae tail at 6 dpf with H&E staining. (F) Sagittal sections of Tg larvae tail at 6 dpf with H&E staining. These data show that expression of EWSR1::FLI1 in col2a1a-expressing cells disrupts normal notochord organization and induces dysplastic notochordal growths during early zebrafish development, as demonstrated by abnormal cellular proliferation and proteoglycan-rich lesions detected by Alcian Blue staining and histological analysis.
Figure 4. Development of notochord tumors in zebrafish. (A) Alcian Blue staining of non-Tg larvae at 6 dpf. (B) Coronal section of non-Tg larvae tail at 6 dpf with H&E staining. (C) Sagittal section of non-Tg larvae tail at 6 dpf with H&E staining. (D) Alcian Blue staining of Tg larvae at 6 dpf. The red circles denote notochordal neoplasms. Black arrows indicate the notochord in panels (A,D). (E) Coronal section of Tg larvae tail at 6 dpf with H&E staining. (F) Sagittal sections of Tg larvae tail at 6 dpf with H&E staining. These data show that expression of EWSR1::FLI1 in col2a1a-expressing cells disrupts normal notochord organization and induces dysplastic notochordal growths during early zebrafish development, as demonstrated by abnormal cellular proliferation and proteoglycan-rich lesions detected by Alcian Blue staining and histological analysis.
Ijms 27 03131 g004
Ijms 27 03131 g005
Figure 5. Characterization of ES-like tumors in adult zebrafish. (A) Lateral view of 15-month-old transgenic fish with tumor on dorsal fin. (B) Lateral view of 10-month-old transgenic fish with mass on caudal fin. (C) Lateral view of 12-month-old transgenic fish with mass near anal fin. Black arrows indicate ES-like tumors in (A–C). (D) Magnified image of dorsal fin tumor, dorsal view. (E) Magnified image of caudal fin tumor, lateral view. (F) Magnified image of anal fin tumor, ventral view. (G) Histological analysis of the zebrafish anal fin tumor with H&E staining. (H) PAS staining of the zebrafish anal fin. (I) Histological analysis of the zebrafish anal fin tumor upon CD99 staining, which was performed in two independent fish tumors. These findings indicate that a subset of adult Tg(col2a1a:EWSR1::FLI1:pA) zebrafish develop tumors with histological and immunophenotypic features consistent with ES neoplasms, including small round blue cell morphology on H&E staining, glycogen accumulation detected by PAS staining, and expression of the diagnostic cell-surface marker CD99.
Figure 5. Characterization of ES-like tumors in adult zebrafish. (A) Lateral view of 15-month-old transgenic fish with tumor on dorsal fin. (B) Lateral view of 10-month-old transgenic fish with mass on caudal fin. (C) Lateral view of 12-month-old transgenic fish with mass near anal fin. Black arrows indicate ES-like tumors in (A–C). (D) Magnified image of dorsal fin tumor, dorsal view. (E) Magnified image of caudal fin tumor, lateral view. (F) Magnified image of anal fin tumor, ventral view. (G) Histological analysis of the zebrafish anal fin tumor with H&E staining. (H) PAS staining of the zebrafish anal fin. (I) Histological analysis of the zebrafish anal fin tumor upon CD99 staining, which was performed in two independent fish tumors. These findings indicate that a subset of adult Tg(col2a1a:EWSR1::FLI1:pA) zebrafish develop tumors with histological and immunophenotypic features consistent with ES neoplasms, including small round blue cell morphology on H&E staining, glycogen accumulation detected by PAS staining, and expression of the diagnostic cell-surface marker CD99.
Ijms 27 03131 g005
Ijms 27 03131 g006
Figure 6. Development and characterization of ES-like tumors in adult zebrafish. Histological analysis of the zebrafish anal fin tumor upon (A) PCNA, (B) phospho-γH2AX, and (C) Sox10 staining. Altogether, these transgenic EWSR1::FLI1 zebrafish-driven, ES-like tumors are proliferative, display DNA damage, and possess a marker for neural crest cells.
Figure 6. Development and characterization of ES-like tumors in adult zebrafish. Histological analysis of the zebrafish anal fin tumor upon (A) PCNA, (B) phospho-γH2AX, and (C) Sox10 staining. Altogether, these transgenic EWSR1::FLI1 zebrafish-driven, ES-like tumors are proliferative, display DNA damage, and possess a marker for neural crest cells.
Ijms 27 03131 g006
Table 1. Primer sequences.
Table 1. Primer sequences.
attB_EWSR1::FLI_FGGGGACAAGTTTGTACAAAAAAGCAGGCTCACCATGGCGTCCACGGATTACAGTAC
attB_EWSR1:FLI_RGGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTAGTAGCTGCCTAAGTGTG
hEWSR1::FLI1_FCACCATGGCGTCCACGGATTACAG
hEWSR1::FLI1_RCCTAGTAGTAGCTGCCTAAGTGTG
beta-actin_FTGCTGTTTTCCCCTCCATTG
beta-actin_RTTCTGTCCCATGCCAACCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Anderson, R.A.; Chen, X.; Oyarbide, U.; Alvarez, N.J.; Sievers, A.; Schwartz, G.K.; Corey, S.J. Tissue-Specific Expression of the EWSR1::FLI1 Fusion Protein Identifies col2a1a-Positive Cells as a Source of Ewing Sarcoma-like Tumors in Zebrafish. Int. J. Mol. Sci. 2026, 27, 3131. https://doi.org/10.3390/ijms27073131

AMA Style

Anderson RA, Chen X, Oyarbide U, Alvarez NJ, Sievers A, Schwartz GK, Corey SJ. Tissue-Specific Expression of the EWSR1::FLI1 Fusion Protein Identifies col2a1a-Positive Cells as a Source of Ewing Sarcoma-like Tumors in Zebrafish. International Journal of Molecular Sciences. 2026; 27(7):3131. https://doi.org/10.3390/ijms27073131

Chicago/Turabian Style

Anderson, Rebecca A., Xin Chen, Usua Oyarbide, Nicolas J. Alvarez, Aidan Sievers, Gary K. Schwartz, and Seth J. Corey. 2026. "Tissue-Specific Expression of the EWSR1::FLI1 Fusion Protein Identifies col2a1a-Positive Cells as a Source of Ewing Sarcoma-like Tumors in Zebrafish" International Journal of Molecular Sciences 27, no. 7: 3131. https://doi.org/10.3390/ijms27073131

APA Style

Anderson, R. A., Chen, X., Oyarbide, U., Alvarez, N. J., Sievers, A., Schwartz, G. K., & Corey, S. J. (2026). Tissue-Specific Expression of the EWSR1::FLI1 Fusion Protein Identifies col2a1a-Positive Cells as a Source of Ewing Sarcoma-like Tumors in Zebrafish. International Journal of Molecular Sciences, 27(7), 3131. https://doi.org/10.3390/ijms27073131

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop