Zebrafish PRL-3 Regulates Yolk Syncytial Layer Integrity and Actomyosin Contractility During Epiboly

Abstract

Zebrafish epiboly is a critical morphogenetic event driven by the precise coordination of microtubule-mediated pulling forces and actomyosin-dependent constriction. While the phosphatase PRL-3 is known to regulate cytoskeletal remodeling in cancer metastasis, its physiological function during early vertebrate embryogenesis remains undefined. Here, we identify zfPRL-3 as an indispensable regulator of zebrafish epiboly. Morpholino-mediated depletion of zfPRL-3 resulted in severe developmental arrest, blastoderm destabilization, and mechanical rupture of the yolk cell. Time-lapse imaging revealed that zfPRL-3 morphants suffer from catastrophic structural failures, characterized by either blastoderm dispersion or excessive inward constriction. At the cellular level, we demonstrate that zfPRL-3 depletion disrupts the organization of the Yolk Syncytial Layer (YSL), evidenced by the irregular scattering of YSL nuclei—a hallmark of microtubule network collapse. Furthermore, zfPRL-3 morphants exhibit premature assembly of the contractile actomyosin ring at 60% epiboly, indicating a failure in the inhibitory mechanisms that normally restrain marginal constriction. We propose that zfPRL-3 functions as a molecular brake that couples YSL integrity with the timing of contractility. By maintaining microtubule stability and preventing premature actomyosin ring formation, zfPRL-3 ensures that the opposing physical forces driving epiboly are precisely balanced. Collectively, our findings define zfPRL-3 as a critical spatiotemporal regulator that orchestrates the successful progression of epiboly.

1. Introduction

Early zebrafish embryogenesis is driven by two prominent morphogenetic movements—epiboly and gastrulation—which are crucial for establishing the basic body plan of the embryo. Epiboly is the initial spreading and thinning of the blastoderm over the yolk cell, involving coordinated movements of several cell layers [1]. Gastrulation encompasses subsequent cell rearrangements (e.g., involution and convergence–extension) that internalize mesendoderm (mesoderm and endoderm) and pattern the ectoderm, while establishing the dorsal–ventral and anterior–posterior body axes, laying the groundwork for organized organogenesis [2]. Mechanistically, the successful progression of epiboly and gastrulation relies heavily on cytoskeletal dynamics, tissue tension, and tightly coordinated cell movements. Actomyosin-driven forces play a central role in these processes. For instance, a contractile actomyosin ring in the yolk syncytial layer (YSL) generates tension that pulls the enveloping cell layer (EVL) over the yolk, physically driving epiboly [3]. Concurrently, epithelial tissues undergoing rapid expansion deploy tension-regulating mechanisms, such as oriented cell divisions aligned with the main stress axis, to release anisotropic tissue tension and preserve epithelial integrity [4]. These dynamic cytoskeletal reorganizations and force-generating events ensure that cells migrate, intercalate, and shape the embryo in a timely and robust manner.

Phosphatase of regenerating liver-3 (PRL-3, also known as PTP4A3) is a member of the PTP4A family of dual-specificity protein tyrosine phosphatases. PRL-3 is best known for its roles in cancer, where it regulates cell migration through Rho GTPase and integrin signaling [5]. Structurally, it contains a classic protein tyrosine phosphatase active site motif (CX5R) capable of dephosphorylating tyrosine and serine/threonine residues, alongside a C-terminal CAAX prenylation motif. This prenylation anchors the protein to the plasma membrane and early endosomes, a localization critical for its function in cytoskeletal remodeling and signal transduction [6]. In mammalian models, PRL-3 directly binds and dephosphorylates key cytoskeletal regulators, including β3-tubulin and the microtubule-associated protein CRMP2. These interactions promote cytoskeletal assembly, reorganize actin networks, and increase cell stiffness thereby driving invasive migration [7,8].

Consistent with a potential role in driving morphogenetic movements, zebrafish PRL-3 (zfPRL-3) exhibits a spatiotemporal expression pattern that parallels early developmental events. zfPRL-3 mRNA is present from the 1-cell stage and persists through the 8-cell stage, indicating a strong maternal contribution. During early gastrulation, its expression localizes to the germ ring and embryonic shield, regions undergoing active cell rearrangement [9,10]. By 24–36 hpf, expression becomes enriched in the forebrain, midbrain, and transiently in somitic muscle; by 72 hpf and 96 hpf, it is restricted to specific tissues such as pharyngeal muscles, the notochord, and vasculature [9,10]. This dynamic pattern indicates a developmental switch from broad early involvement to more specialized tissue-specific functions.

Despite the suggestive overlap between zfPRL-3 expression and the timing of epiboly, the specific function of zfPRL-3 during early embryonic morphogenesis remains undefined. While its impact on cancer cell migration is well-documented, it is unclear whether these mechanisms are conserved in the context of embryonic development. Hypothesizing that zfPRL-3 acts as a critical regulator of the cytoskeletal dynamics driving morphogenesis, we investigated its requirement for early embryogenesis. We found that morpholino-mediated knockdown of zfPRL-3 caused a marked delay in epiboly and gastrulation, significantly reducing viability—a phenotype partially rescued by zfPRL-3 mRNA. By combining time-lapse imaging with molecular analyses, we uncovered specific morphogenetic disruptions associated with abnormal external YSL nuclei organization and premature actomyosin ring assembly. These results suggest that zfPRL-3 coordinates tissue dynamics essential for epiboly progression, establishing it as a key regulator of early morphogenesis in zebrafish.

2. Results

2.1. Morpholino-Mediated Zebrafish PRL-3 Depletion Impairs Early Embryonic Development and Viability

While previous studies have shown that zebrafish PRL-3 (zfPRL-3) is maternally expressed during early embryogenesis [9,10], we therefore assessed whether zfPRL-3 is required for normal early development by morpholino (MO)-mediated knockdown. Embryos were injected with a zfPRL-3 MO at 2, 4, 6, or 8 ng per embryo (2.3 nL injection volume), and survival was monitored over time in comparison with uninjected wild-type (WT) embryos and a standard control MO (4 ng/2.3 nL). At the low dose (2 ng), zfPRL-3 morphants exhibited survival rates comparable to WT and control MO groups throughout early development, indicating minimal toxicity or developmental impact at this dose (Figure 1A). In contrast, embryos injected with ≥4 ng zfPRL-3 MO showed a marked loss of viability by 24 hpf. Specifically, survival declined from 97–90% at 4–8 hpf to 23% at 24 hpf in the 4 ng group. Higher doses further reduced survival, reaching 14% at 24 hpf in both the 6 ng and 8 ng groups (Figure 1A).

As zfPRL-3 morphants showed a pronounced decrease in survival between 8 and 24 hpf, we next examined whether early developmental abnormalities could account for the subsequent lethality. To this end, embryos injected with different doses of zfPRL-3 morpholino were staged at 9 hpf based on morphology (Figure 1B; see Figure 2 for representative stage images). In the control MO group, embryos progressed predominantly to late epiboly (90% epiboly; 88%) by 9 hpf. In contrast, zfPRL-3 morphants showed a dose-dependent shift toward earlier developmental categories. At 4 ng zfPRL-3 MO, embryos were primarily distributed across intermediate staging intervals (86% in total; sum of the intervals from dome stage to 50% epiboly and from shield stage to 75% epiboly). At 8 ng, the distribution shifted further toward earlier categories (sphere stage; 47%), resulting in fewer embryos occupying intermediate staging intervals overall (49%), driven primarily by the near absence of embryos in the interval from dome stage to 50% epiboly (Figure 1B; percentages are shown on the stacked bars). Collectively, these stage distributions indicate a marked developmental delay in zfPRL-3 morphants.

At 24 hpf, zfPRL-3 morphants exhibited substantial lethality, whereas control MO embryos developed normally with clear somite segmentation and eye formation (Figure 1C). Among embryos injected with 4 ng zfPRL-3 MO that survived to 24 hpf, multiple phenotypic classes were observed (Figure 1D–G). The most frequent phenotype was an abnormal body axis morphology (Figure 1D), accounting for 42.9% of surviving morphants. A second group (26.5%) appeared grossly comparable to control MO embryos at this stage (Figure 1E). The remaining surviving embryos showed persistent developmental delay with arrest during epiboly: 24.5% remained at or before 75% epiboly (Figure 1F), and 6.1% were close to completion of epiboly but failed to progress further (Figure 1G). Collectively, these data indicate that, among embryos surviving to 24 hpf after zfPRL-3 knockdown, a substantial fraction (~30%) remain arrested during epiboly, while another major fraction exhibits body-axis abnormalities.

To validate the specificity and effectiveness of the translation-blocking zfPRL-3 MO, we performed mRNA rescue experiments and protein-level assessment. In the rescue assay, embryos injected with 2 ng zfPRL-3 MO showed epiboly delay in 57% of embryos at 8 hpf, and co-injection of zfPRL-3 mRNA reduced the fraction of delayed embryos in a dose-dependent manner (51% with 5.5 pg mRNA and 34% with 11 pg mRNA). In addition, we performed whole-mount immunostaining at ~60% epiboly using stage-matched embryos. The zfPRL-3 morphants with grossly normal morphology showed consistently weaker zfPRL-3 immunoreactivity than wild-type embryos (Figure S1), supporting reduced zfPRL-3 protein levels in vivo. Together, these validation data support that the phenotypes described above are attributable to MO-mediated reduction of zfPRL-3 and are associated with delayed early embryonic progression (epiboly/gastrulation) and subsequent defects in viability and morphology.

2.2. Zebrafish PRL-3 Knockdown Initiates Developmental Delay from the Sphere Stage

Based on the staging analysis (Figure 1B), zfPRL-3 MO injection caused a clear developmental delay; however, the onset of this delay was not defined. We therefore performed continuous morphological staging to determine when zfPRL-3 morphants first diverged from controls. Unless otherwise indicated, all analyses from this section onward were performed using 4 ng zfPRL-3 MO. At 3 hpf (Figure 2A,F; 1k-cell stage) and 4 hpf (Figure 2B,G; sphere stage), zfPRL-3 morphants and control morphants were morphologically indistinguishable based on the overall blastoderm morphology and stage appearance. By 5 hpf, control embryos had progressed to the dome stage, whereas zfPRL-3 morphants largely remained at the sphere stage (Figure 2C,H), indicating that the developmental delay first becomes apparent at the sphere stage or shortly thereafter. This delay persisted at 6 hpf, when control embryos had advanced to the shield stage but most zfPRL-3 morphants were still at the dome stage (Figure 2D,I). By 8 hpf, the divergence was more pronounced: control morphants had reached ~75% epiboly, whereas many zfPRL-3 morphants remained at the dome stage (Figure 2E,J).

Together, these observations demonstrate that zfPRL-3 knockdown initiates a delay beginning at the sphere stage and leads to prolonged residence at the dome stage, resulting in slower progression through gastrulation/epiboly. Because epiboly movements normally begin around the sphere stage, these data suggest that reduced zfPRL-3 expression interferes with early morphogenetic events that drive epiboly during early zebrafish embryogenesis.

2.3. Time-Lapse Imaging Reveals Aberrant Blastoderm Dynamics Preceding Lethality in Zebrafish PRL-3 Morphants

As embryo survival dropped sharply between 8 and 24 hpf, we sought to identify proximate morphological events associated with lethality in zfPRL-3 morphants. To minimize artifacts from non-specific injection damage, embryos were first screened at the 1k-cell stage and overtly dead or severely dysmorphic embryos were removed. The remaining zfPRL-3 morphants were then monitored by time-lapse imaging under a stereomicroscope until death (Figure 3).

Time-lapse imaging revealed that the earliest abnormalities could be detected as early as the sphere stage (0 min; Figure 3A). By 60 min, the representative embryo failed to advance to the next stage, and the blastoderm began to lose cohesion with outward dispersion of cells (Figure 3B). This dissociation became more pronounced by 90 min (Figure 3C) and severe by 117 min, with extensive spreading and no apparent epiboly progression (Figure 3D). The embryo subsequently died by 152 min (Figure 3E), indicating that prolonged arrest at the sphere stage is accompanied by blastoderm destabilization and rapid lethality. A distinct failure mode was captured in embryos imaged from the dome stage (0 min; Figure 3F). Epiboly initially proceeded, with continued vegetal expansion at 60 min (Figure 3G) and progression to approximately 50% epiboly by 168 min (Figure 3H). However, by 186 min, epiboly progression stalled and the blastoderm began to constrict inward with a waist-like narrowing (Figure 3I). By 213 min, excessive inward constriction led to blastoderm–yolk separation, followed by embryo death (Figure 3J). A further failure mode was observed when imaging began at ~50% epiboly (0 min; Figure 3K). By 99 min, epiboly advanced toward ~60% epiboly with mild inward constriction (Figure 3L). By 174 min, vegetal progression ceased and inward constriction became evident (Figure 3M). Constriction intensified by 231 min, markedly compressing the yolk and producing a pronounced bulge (Figure 3N). By 243 min, the yolk ruptured and the embryo died (Figure 3O).

Collectively, the time-lapse analyses suggest at least two major routes to lethality following zfPRL-3 depletion. One involves prolonged arrest at the sphere stage with progressive blastoderm destabilization and disintegration. The other emerges during/after epiboly, where abnormal inward constriction of the blastoderm mechanically disrupts blastoderm–yolk integrity, culminating in separation or yolk rupture. Together, these findings indicate that zfPRL-3 contributes to proper epiboly progression and is required for normal morphogenetic movements during gastrulation.

2.4. Whole-Mount In Situ Hybridization at 8 hpf Reveals Altered ntl and hgg1 Expression Patterns in zfPRL-3 Morphants

To molecularly relate the observed epiboly delay to gastrulation progression, we performed whole-mount in situ hybridization at 8 hpf (time-matched) in control and zfPRL-3 morphants using probes for no tail (ntl), a mesendodermal marker, and hatching gland 1 (hgg1), an anterior hatching gland marker. In control morphants, ntl expression formed a prominent marginal domain with a clear extension toward the animal pole (Figure 4A). In zfPRL-3 morphants, an ntl-positive marginal domain was still evident; however, the internal extension appeared reduced and the staining remained more confined to the margin (Figure 4B). Given the developmental delay observed at matched chronological time points (Figure 1B and Figure 2), this altered ntl distribution is more consistent with delayed and/or perturbed gastrulation morphogenetic movements (e.g., internalization and convergence–extension) rather than a complete loss of mesendodermal specification, which would be expected to markedly diminish ntl expression. For hgg1, control morphants showed a compact, localized anterior domain (Figure 4C), whereas zfPRL-3 morphants retained a detectable hgg1 signal that was often visually weaker and less sharply defined (Figure 4D). Given the time-matched design and the epiboly delay in zfPRL-3 morphants, the hgg1 staining differences are most consistent with delayed/altered anterior tissue organization and/or migration.

2.5. Zebrafish PRL-3 Depletion Disrupts Yolk Syncytial Layer Organization and Accelerates Actomyosin Ring Formation During Epiboly

To examine cytoskeletal organization and nuclear distribution that are not readily discernible by bright-field imaging, we performed whole-mount staining for F-actin and nuclei in control and zfPRL-3 morphants at defined developmental stages. We specifically assessed the spatial distribution of the external yolk syncytial layer (YSL) and the timing of actomyosin (actin–myosin) ring formation during epiboly.

At the 1k-cell stage, control morphants displayed external YSL-associated nuclei positioned close to the blastoderm margin (Figure 5A). In contrast, zfPRL-3 morphants exhibited a broader, more ventrally dispersed distribution of external YSL nuclei extending further over the yolk (Figure 5E). This difference became more apparent during epiboly: at ~60% epiboly, external YSL nuclei in control morphants remained concentrated near the blastoderm margin (Figure 5B), whereas in zfPRL-3 morphants they appeared scattered across the yolk surface (Figure 5F). Because coordinated YSL–blastoderm movements are integral to epiboly [11], the abnormal dispersion of external YSL nuclei in zfPRL-3 morphants suggests disrupted YSL organization that could underlie the observed epiboly delay.

In addition to dispersion of external YSL nuclei, zfPRL-3 morphants also showed an altered timing of actomyosin ring assembly. In control morphants, a prominent actomyosin ring was not evident at ~60% epiboly (Figure 5C) but became apparent by ~75% epiboly (Figure 5D). In contrast, zfPRL-3 morphants displayed a clearly detectable actomyosin ring already at ~60% epiboly (Figure 5G), which remained prominent at ~75% epiboly (Figure 5H). Consistent with this, phalloidin staining at ~60% epiboly showed a more sharply enriched marginal F-actin band in zfPRL-3 morphants compared with controls (Figure S2), supporting an earlier onset of marginal actomyosin assembly. Physiologically, the actomyosin ring generates contractile forces essential for closing the blastopore [12]. Consequently, the premature assembly of this contractile machinery in zfPRL-3 morphants likely generates distinct mechanical stress, providing a cellular explanation for the abnormal inward constriction (“waist-like’’ narrowing) and yolk rupture observed in our time-lapse imaging analysis (Figure 3). Overall, the combined abnormalities in external YSL nuclei distribution and actomyosin ring timing provide a plausible cellular basis for the epiboly delay and early lethality observed in zfPRL-3 morphants.

3. Discussion

Despite the ubiquitous maternal expression of zfPRL-3 during early zebrafish embryogenesis, its functional requirement has long remained undefined. In this study, we establish zfPRL-3 as an indispensable regulator of early morphogenesis, specifically governing the progression of epiboly (Figure 6). We demonstrate that zfPRL-3 depletion does not simply arrest development nonspecifically but induces precise morphogenetic failures characterized by stalled epiboly, blastoderm destabilization, and mechanical rupture. By integrating time-lapse imaging with cytoskeletal analysis, our data suggest that zfPRL-3 is required for proper epiboly progression, potentially through two linked mechanisms: maintaining YSL structural integrity and preventing premature formation of the contractile actomyosin ring.

The first major defect we identified is the aberrant dispersion of YSL nuclei. Physiologically, the YSL acts as a supracellular engine that drives the vegetal movement of the EVL via a microtubule-dependent pulling mechanism [1]. Our data reveal that in zfPRL-3 morphants, external YSL nuclei fail to maintain their marginal clustering and instead scatter across the yolk surface (Figure 5E,F). Since the positioning of external YSL nuclei is tightly linked to the organization of the microtubule network, this scattering implies a fundamental defect in cytoskeletal architecture. Specifically, external YSL nuclei act as cargo, transported vegetally along yolk microtubules via motor proteins [13]. Importantly, these nuclei are intimately associated with centrosomes that function as microtubule organizing centers, creating a reciprocal structural link between nuclear positioning and cytoskeletal architecture [14]. Previous studies using microtubule-destabilizing agents, such as nocodazole, have demonstrated that disrupting this network abolishes coordinated vegetal movement, directly resulting in the irregular scattering of nuclei [15]. Therefore, the failure of marginal clustering observed in the morphants serves as a functional readout indicating the disorganization of the underlying microtubule machinery. We speculate that the knockdown of zfPRL-3 compromises the microtubule-YSL network, thereby abolishing the “pulling force” required for epiboly progression. This mechanistic failure likely accounts for the significant epiboly delay observed in the zfPRL-3 morphants (Figure 2). This also aligns with mammalian studies showing that PRL-3 dephosphorylates tubulin and microtubule-associated proteins to regulate cytoskeletal dynamics [7]. It is highly probable that a conserved PRL-3-dependent mechanism operates in the zebrafish embryo to organize the microtubule arrays essential for YSL function. However, because microtubule organization was not directly assessed in this study, future studies assessing yolk/YSL microtubule organization will be important to test whether microtubule alterations contribute to the dispersed distribution of external YSL nuclei observed in zfPRL-3 morphants.

A striking finding of our study is the premature formation of the actomyosin ring in zfPRL-3 morphants. In zebrafish, actomyosin structures at the EVL–YSL margin generate contractile tension and have been implicated in coordinating epiboly progression and late-stage margin closure [3]. The premature constriction of the actomyosin ring observed in zfPRL-3 morphants indicates a catastrophic failure in the inhibitory mechanisms that normally restrain contractility until the completion of epiboly. This phenotype mirrors the defects reported in slc3a2- and nrz-depleted embryos, where the loss of YSL integrity triggers aberrant actomyosin contraction [16,17]. Notably, in slc3a2 morphants, the premature contractility was explicitly linked to the disassembly of the YSL microtubule network, demonstrating that microtubules function to suppress RhoA-dependent constriction during early epiboly [17].

As mentioned above, the irregular scattering of YSL nuclei observed in zfPRL-3 morphants (Figure 5E,F) is likely due to microtubule disorganization, indicating that zfPRL-3 plays a critical role in stabilizing the YSL microtubule network. It is well-established that an intact microtubule array acts as a negative regulator of RhoA activity, likely by sequestering RhoGEFs such as GEF-H1 [17,18]. In mammalian systems, PRL-3 has been shown to enhance Src kinase activity by downregulating C-terminal Src kinase (Csk), the primary negative regulator of Src [19,20]. In the zebrafish YSL, Src activity is indispensable for cytoskeletal stability; it phosphorylates and activates p190RhoGAP, which in turn suppresses RhoA activity to maintain the microtubule network [17]. Furthermore, the phosphatase activity of zfPRL-3 may also regulate calcium homeostasis. Given that PRL-3 acts as a phosphatase that can regulate phosphoinositide metabolism [21], the depletion of zfPRL-3 likely leads to an accumulation of phosphatidylinositol 4,5-bisphosphate (PIP2). This excess PIP2 provides an increased substrate pool for Phospholipase C, generating the second messenger IP3, which subsequently triggers Ca²⁺ efflux from the ER stores [22]. The resulting elevation in cytosolic Ca²⁺ directly fuels actomyosin contractility [16], thereby synergizing with the aforementioned RhoA overactivation.

We propose that the loss of zfPRL-3 leads to concurrent aberrant accumulation of Csk and dysregulated calcium dynamics. This signaling failure would unleash RhoA activity and contractile forces, triggering both the disassembly of the microtubule array—evident from the scattered YSL nuclei—and the premature formation of the actomyosin ring. This model places zfPRL-3 as a critical regulator coordinating the Src-p190RhoGAP-RhoA pathway and calcium signaling, ensuring that cytoskeletal tension is kept in check during epiboly. However, further experimental validation, particularly regarding intracellular calcium dynamics and kinase activity levels, is required to substantiate this proposed mechanism. In summary, our work defines zfPRL-3 as a critical temporal and spatial regulator of zebrafish epiboly. By preventing premature actomyosin contraction and maintaining YSL integrity, zfPRL-3 ensures that the physical forces driving embryogenesis are precisely orchestrated.

4. Materials and Methods

4.1. Zebrafish Maintenance and Injection of Morpholinos

Zebrafish Danio rerio AB strains were maintained at 28 °C with a 14 h/10 h dark/light cycle. Set-up for breeding and embryo collection were performed as described previously [23]. Antisense Morpholino oligonucleotides (MOs) were designed and synthesized by Gene Tools, LLC (Philomath, OR, USA). zfPRL-3 MO (ATAGTTGTGCTTCCTTCCGACTCAA) was designed to target translational start site of zfPRL-3 mRNA (ptp4a3a; NM_213181). The standard control MO (CCTCTTACCTCAGTTACAATTTATA) which targets a human beta-globin intron mutation were injected into embryos to serve a widely used negative control [24]. The specific amount of MO was injected into yolk of the 1-cell stage embryo using Nanoject II instrument (Drummond Scientific, Broomall, PA, USA). Injected embryos were maintained and raised under the standard condition as those for the adult zebrafish. Observations regarding phenotype were made at indicated time points and images were captured by using an Olympus SZX7 stereomicroscope (Olympus Corporation, Tokyo, Japan) equipped with a CMOS camera (E3ISPM08300KPC, Tekfar Science, Taichung, Taiwan).

4.2. Time-Lapse Imaging of Zebrafish Embryos

Embryos were maintained in E3 medium at 28 °C and screened at the 1k-cell stage to exclude dead or severely dysmorphic embryos prior to imaging. For time-lapse imaging, embryos were immobilized and oriented in 1% low-melting agarose (prepared in E3 medium), which held embryos in place throughout image acquisition. After the agarose solidified, E3 medium was added to cover the agarose and prevent dehydration. Time-lapse imaging was performed on an Olympus SZX7 stereomicroscope (Olympus Corporation, Tokyo, Japan) equipped with a CMOS camera (E3ISPM08300KPC, Tekfar Science, Taichung, Taiwan). Images were acquired under transmitted light at 1-min intervals. The temperature was maintained at 28 °C throughout imaging.

4.3. In Situ Hybridization

Whole-mount in situ hybridization was performed as previously described [25], using probes targeting no tail (ntl; NM_131162) [26] and hatching gland 1 (hgg1; BC108031) [27]. Briefly, digoxigenin (DIG)-labeled antisense RNA probes were synthesized from linearized plasmids containing ntl or hgg1 cDNA using a DIG RNA Labeling Kit (Cat. No. 11175025910, Roche Diagnostics, Mannheim, Germany). Control and zfPRL-3 morphant embryos were collected at 8 hpf and fixed in 4% paraformaldehyde (PFA) for 4 h at 25 °C. Following fixation, embryos were dechorionated, dehydrated, rehydrated, and washed in phosphate-buffered saline (PBS). Prehybridization, hybridization, and detection steps were carried out using the DIG Nucleic Acid Detection Kit II (Cat. No. 11585614910, Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

4.4. Whole-Mount Staining of Embryos

Embryos at the desired developmental stages were selected and fixed in 4% paraformaldehyde in PBS at 4 °C for 14–16 h. After fixation, chorions were removed and embryos were washed three times for 20 min each in PBSTx (PBS containing 0.5% Triton X-100). To enhance permeabilization, embryos were incubated in PBSTx at 4 °C for 14–16 h. For zfPRL-3 immunostaining (Figure S1), embryos were incubated with a custom rabbit polyclonal anti-zfPRL-3 antibody generated against full-length zfPRL-3 (1:800 dilution in PBSTx) at 4 °C overnight. Embryos were then washed in PBSTx six times for 15–20 min each at room temperature and incubated with an Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody (1:200 dilution; Thermo Fisher Scientific, Invitrogen, Waltham, MA, USA; Cat. No. A11008) for 2 h at room temperature in the dark, followed by PBSTx washes six times for 15–20 min each. For visualization of F-actin and nuclei (Figure 5 and Figure S2), embryos were incubated in PBSTx containing TRITC or FITC-conjugated phalloidin (1:200 dilution; Sigma-Aldrich, St. Louis, MO, USA; Cat. No. P1951 or P5282) and DAPI (1:1000 dilution; Sigma-Aldrich; Cat. No. MBD0015) at 4 °C overnight. After staining, embryos were washed three times in PBSTx for 10 min each. Embryos were mounted in an anti-fade mounting solution and imaged using a Nikon A1+ confocal microscope (Nikon Corporation, Tokyo, Japan).

4.5. Graph Generation and Figure Preparation

Graphs (Figure 1A,B) were generated in R using the ggplot2 package (version 4.0.0). Microscopy images were assembled for presentation using Inkscape (version 1.4.3).

5. Conclusions

In this study, we provide evidence that zfPRL-3 is essential for the mechanical integrity during zebrafish early embryogenesis. We conclude that zfPRL-3 does not merely participate in development as a passive component but acts as a pivotal checkpoint for cytoskeletal dynamics during epiboly. By integrating time-lapse imaging with cytoskeletal analysis, our study suggests that zfPRL-3 is required to balance two opposing physical forces: the vegetal pulling force mediated by the YSL microtubule network and the circumferential constrictive force generated by the actomyosin ring. We propose that zfPRL-3 exerts this control by functioning as a signaling node that couples cytoskeletal stability with the timing of contractility. The depletion of zfPRL-3 leads to cytoskeletal dysregulation, manifested as YSL nuclei mislocalization and premature actomyosin contraction, culminating in the mechanical rupture of the embryo. This work supports a role for PRL-3 in governing cell motility and mechanical tension, suggesting that the metastasis-associated phosphatase may be rooted in a fundamental function in the precise orchestration of physiological embryonic morphogenesis.