Deleterious NKAP Mutations Are Associated with Musculoskeletal Abnormalities in Hemizygous Males and Skewed X Chromosome Inactivation in Heterozygous Females

Abstract

NKAP (NF-kappa-B-activating protein) is a ubiquitously expressed nuclear protein involved in multiple biological processes. Males with missense NKAP mutations have been reported to present with marfanoid features and behavioral and musculoskeletal abnormalities. We have previously reported that a disruptive NKAP mutation resulted in extremely skewed X chromosome inactivation (XCI), leading to phenotypic manifestation of hemophilia A (HA) in a HA carrier. In this study, with the aim of exploring the phenotypic manifestations of deleterious NKAP mutations in males, as well as their involvement in the mechanism of XCI regulation in females, we generated NKAP mutant mice using CRISPR/Cas9 technology. Gait analysis studies conducted in male mice hemizygous for mutant NKAP by the CatWalk XT system revealed significant alterations in gait parameters, consistent with hypotonia reported in human mutant NKAP patients. By breeding mutant NKAP mice with HA mice, we generated a double heterozygous mutant NKAP/HA mouse model, i.e., female mice carrying mutant NKAP with a WT F8 copy on one X chromosome, and WT NKAP with a mutant F8 copy on the other X chromosome. XCI pattern analysis using methylation-sensitive restriction enzymes demonstrated that mutant NKAP/HA females exhibited significant XCI skewing of the X chromosome bearing the mutant NKAP copy. Furthermore, these females exhibited significantly reduced F8 mRNA levels and FVIII (factor VIII) antigen levels, as demonstrated by quantitative RT-PCR and ELISA, respectively. Murine embryonic fibroblasts (MEFs) derived from a hemizygous mutant NKAP embryo exhibited markedly reduced proliferation rate and increased senescence compared to WT NKAP MEFs, suggesting that XCI skewing induced by mutant NKAP results from secondary selection against cells with an active X chromosome bearing the mutant NKAP copy.

1. Introduction

NKAP (NF-kappa-B-activating protein) is a ubiquitously expressed, highly conserved nuclear protein involved in multiple biological processes, including activation of the transcription factor NF-kappa B, transcriptional regulation, mRNA splicing, and cell proliferation [1,2,3,4]. NKAP deficiency was reported to reduce hematopoiesis and increase apoptosis of stem cells; conditional knockout of NKAP in mice resulted in perinatal lethality observed 1–3 days after birth, resulting from significant hematopoiesis blockade [5]. Males with missense mutations in NKAP (p.Arg330Cys, p.Arg330His, p.Arg333Gln, p.Ile337Thr, and p.Arg361Gln) have been reported to present with marfanoid features, developmental delay, and behavioral and musculoskeletal abnormalities [6,7].

Hemophilia A (HA) is an X-linked bleeding disorder resulting from factor VIII (FVIII) deficiency, which is caused by mutations in the F8 gene. In general, female HA carriers exhibit normal hemostasis enabled by FVIII levels corresponding to about half of the normal FVIII levels [8]. However, in rare cases, HA carriers may exhibit moderate to severe HA due to various reasons, including homozygosity or compound heterozygosity for F8 mutations, Turner syndrome, or skewed inactivation of the X chromosome bearing the normal F8 copy [9]. Based on a retrospective, multicenter study of symptomatic HA carriers, skewed X chromosome inactivation (XCI) accounted for the majority of cases of females presenting with moderate to severe HA [9]. We have previously reported that a HA carrier presenting with HA symptoms due to extremely skewed XCI of her non-hemophilic X chromosome was diagnosed with a nonsense mutation in exon 1 of the NKAP gene, which was inherited from her mother, who was also diagnosed with skewed XCI. None of the patient’s siblings (two healthy brothers and one sister, who is a HA carrier exhibiting normal phenotype with respect to FVIII level and a normal random XCI pattern) was found to carry the mutant NKAP gene [10]. Taken together, these findings indicated a significant association between mutant NKAP and extreme XCI skewing.

To the best of our knowledge, no viable mouse model of germline NKAP mutations has been reported to date. Furthermore, NKAP has not been investigated in the context of genetic processes involved in XCI skewing. In the present study, we generated a male mouse model of mutant NKAP, which recapitulates the musculoskeletal abnormalities observed in human patients with missense NKAP mutations, as well as a female mouse model combining heterozygosity for F8 deficiency with heterozygosity for a deleterious NKAP mutation, i.e., a HA carrier carrying a mutant NKAP copy on the X chromosome harboring the normal F8 gene. The double heterozygous murine female model enabled us to explore the impacts of abnormal NKAP on XCI by monitoring F8 mRNA and FVIII protein expression as a marker of XCI extent. Using this model, reflecting the genetic composition of the symptomatic HA carrier carrying a deleterious NKAP mutation, we provide proof of concept that mutant NKAP can lead to non-random XCI. Moreover, we suggest that XCI skewing induced by mutant NKAP results from secondary selection against cells with an active X chromosome bearing the mutant NKAP copy.

2. Results

2.1. Generation of Mutant NKAP Mice and Double Heterozygous Carriers of F8 and NKAP Mutations

Mutant NKAP mice were generated by CRISPR/Cas9 technology using a single guide RNA targeted to exon 1 of murine NKAP, encoding part of the N-terminal RS domain [2]. Two mutant mice were obtained: 1 male with an in-frame deletion of 123 bp (c.5_127del; p.Ala2Glydel3_43) and 1 female with a 70 bp deletion including the initiation codon (c.-10_60del) (Figure 1). The cDNA and protein sequences of WT and mutant NKAP are presented in Figure S1.

To generate mutant NKAP males, the original NKAP^Δ123bp male was bred with NKAP^WT/WT females, who were further bred with NKAP^WT males to yield NKAP^Δ123bp males, and the NKAP^WT/Δ70bp female was bred with NKAP^WT males. To generate double heterozygous carriers of F8 and NKAP mutations, the NKAP^Δ123bp male and the NKAP^WT/Δ70bp female were bred with homozygous F8^−/− females and hemizygous F8⁻ males, respectively. As expected, double heterozygous F8^+/−/NKAP^WT/Δ123bp females were obtained from the NKAP^Δ123bp male. However, neither male nor female mutant NKAP^Δ70bp offspring could be obtained from the NKAP^WT/Δ70bp female over 18 months of breeding with either hemophilic or non-hemophilic males. We initially hypothesized that the failure of the NKAP^WT/Δ70bp female to produce NKAP^Δ70bp offspring might be attributed to potential lack of NKAP^Δ70bp oocytes in her ovaries due to mosaicism, which has been reported at a relatively high incidence in CRISPR-generated founder mice [11]. To explore this hypothesis, we evaluated the NKAP^WT/Δ70bp founder for possible mosaicism by examining various tissues for the presence of NKAP^Δ70bp mutation following euthanasia at the age of 20 months. The NKAP^Δ70bp mutation has been detected in DNA samples derived from blood, liver, and skin of the NKAP^WT/Δ70bp founder. Importantly, mutant NKAP^Δ70bp oocytes have been detected in her ovaries (Figure S2). Taken together, these findings exclude mosaicism as a possible reason for the failure of the heterozygous NKAP^Δ70bp founder to produce mutant NKAP^Δ70bp offspring.

2.2. Phenotypic Characterization of NKAP^Δ123bp Males Reveals Reduced Muscle Strength and Gait Abnormalities

In view of the musculoskeletal abnormalities reported in human patients with mutant NKAP, we conducted a series of studies aimed at examining the musculoskeletal system of NKAP^Δ123bp males, including analysis of forelimb muscle strength and investigation of gait characteristics using the CatWalk XT system.

Normalized forelimb muscle strength was evaluated by grip strength measurement divided by body weight, as described by Munier et al. [12]. NKAP^Δ123bp males demonstrated a significantly reduced forelimb grip strength compared to NKAP^WT males (mean ± SEM: 1.81 ± 0.25 vs. 2.65 ± 0.12, respectively; N = 15 in each group; p = 0.005; Figure 2A), indicating forelimb muscle weakness, which may be consistent with hypotonia reported in patients with mutant NKAP [6].

Significantly altered gait parameters demonstrated by NKAP^Δ123bp compared to NKAP^WT males in CatWalk XT studies are presented in Figure 2. NKAP^Δ123bp mice exhibited decreased forelimb stride length (the distance between successive placements of the same paw measured in cm) (mean ± SEM: 5.75 ± 0.18 vs. 6.74 ± 0.23; p = 0.002; Figure 2B); decreased forelimb percent maximal contact area accompanied by increased hindlimb percent maximal contact area (percentage of the stride cycle during which maximal contact with the walking surface is observed) (mean ± SEM: forelimbs −34.37 ± 1.55 vs. 39.77 ± 1.33; p = 0.013; hindlimbs −27.66 ± 1.19 vs. 21.45 ± 1.32; p = 0.002; Figure 2C); increased duty cycle (percentage of the stride cycle during which a specific paw is on the ground, i.e., in the stance phase) in both forelimbs and hindlimbs (mean ± SEM: forelimbs −60.04 ± 0.74 vs. 55.47 ± 0.86; p = 0.0006; hindlimbs −62.04 ± 1.07 vs. 54.71 ± 1.25; p = 0.0004; Figure 2D); decreased swing time (the duration of a limb being in the air during the stride cycle measured in seconds) in both forelimbs and hindlimbs (mean ± SEM: forelimbs −0.106 ± 0.004 vs. 0.122 ± 0.004; p = 0.022; hindlimbs −0.095 ± 0.002 vs. 0.115 ± 0.004, p = 0.026; Figure 2E); and increased percentage of three limb support (mean ± SEM: 37.02 ± 1.57 vs. 24.19 ± 2.62; p = 0.00015; Figure 2F).

Both NKAP^Δ123bp and WT mice were maintained under identical conditions and were electively euthanized at the predefined study endpoint of 18 months of age. Based on our records of 80 NKAP^Δ123bp and 85 WT mice collected during the observation period from birth to 18 months, the rates of spontaneous mortality were 6/80 in the mutant group and 7/85 in the WT group. Thus, although we cannot draw conclusions regarding natural lifespan beyond 18 months, our data indicate that NKAP mutant mice do not exhibit reduced survival up to 18 months of age under standard housing conditions. No notable phenotypic abnormalities have been revealed in NKAP^Δ123bp males by weight and size measurements. X-ray studies conducted in NKAP^Δ123bp males exhibited normal bone length and structure, with no gross structural abnormalities compared to WT males.

2.3. Females Heterozygous for NKAP Mutations Exhibit XCI Skewing

To investigate the XCI pattern in females carrying NKAP mutations, we developed an XCI assay analogous to the HUMARA assay [13], based on digestion with two methylation-sensitive enzymes, HpaII and BstuI, followed by PCR amplification of DNA fragments encompassing the relevant NKAP deletions and analysis of PCR product intensities by sequence analyzer and GeneMapper software version 3.5.

The restriction maps used for assay design and representative PCR results are presented in Figure 3.

Based on analysis of blood DNA samples, heterozygous female carriers of NKAP^Δ123bp and NKAP^Δ70bp mutations demonstrated 90% (Figure 3A) and 97% (Figure 3B) inactivation, respectively, of the X chromosome bearing the mutant NKAP copy. DNA samples extracted from the liver and skin of the heterozygous NKAP^WT/^Δ70bp female exhibited complete inactivation of the X chromosome bearing the mutant NKAP copy (Figure 3B). With respect to the NKAP^Δ123bp mutation, the assay was validated using a control DNA sample derived from a hemizygous NKAP^Δ123bp male, which demonstrated no PCR product following digestion with HpaII and BstuI (Figure 3A). As detailed above, no NKAP^Δ70bp male was available for analogous validation of the assay with respect to the NKAP^Δ70bp mutation.

The average extent of inactivation of the X chromosome bearing the mutant NKAP^Δ123bp in the population of heterozygous female carriers of the NKAP^Δ123bp mutation was 83.1% ± 9.4% (mean ± SD; N = 15).

2.4. Double Heterozygous F8^+/−/NKAP^WT/Δ123bp Females Exhibit Reduced F8 mRNA and FVIII Protein Levels

We further investigated the XCI patterns in HA carriers with mutant NKAP compared to HA carriers with WT NKAP by analyzing F8 mRNA and FVIII protein levels.

qRT-PCR analysis of F8 mRNA expression in RNA samples derived from murine livers revealed significantly reduced F8 mRNA levels in double heterozygous F8^+/−/NKAP^WT/Δ123bp females compared to F8^+/−/NKAP^WT/WT females (mean ΔCt (ΔCt = F8 Ct − mean value of GAPDH Ct and ACTB Ct) ± SD: 12.41 ± 4.33 vs. 8.61 ± 1.78, respectively; N = 15; p = 0.003) (Figure 4A,B). Based on these values, the relative F8 expression detected in F8^+/−/NKAP^WT/Δ123bp females, compared to that detected in F8^+/−/NKAP^WT/WT females, calculated by the 2^−ΔΔCt formula, is 0.072, indicating a 13.9-fold reduction in F8 mRNA expression. Both GAPDH and ACTB exhibited similar expression levels in F8^+/−/NKAP^WT/Δ123bp and F8^+/−/NKAP^WT/WT females, with no statistically significant differences in Ct between the two groups.

Analysis of FVIII protein levels by ELISA demonstrated significantly reduced FVIII levels in plasma samples of double heterozygous F8^+/−/NKAP^WT/Δ123bp females compared to F8^+/−/NKAP^WT/WT females (mean FVIII concentration (ng/mL) ± SD: 9.60 ± 10.64 vs. 33.67 ± 19.61, respectively; N = 15; p = 0.0004) (Figure 4C).

The dispersion of FVIII values in the mutant group suggests that the data may not follow a normal distribution. To test this, we used the Shapiro–Wilk test and found that FVIII values significantly deviated from normality in both groups (p < 0.05). Therefore, we analyzed the between-group difference using a two-sided non-parametric Mann–Whitney U test. The statistical analysis summary is presented in Table S1.

2.5. Cell Proliferation Is Inhibited by Mutant NKAP Due to Senescent Phenotype Induction

Reports published in the literature suggest that NKAP plays a significant role in the regulation of cell proliferation in several cell types, among them invariant natural killer T cells [3], neuroblastoma cells [4], and MCF-7 breast cancer cells [14]. Based on these reports, combined with our findings indicating induction of XCI skewing by the NKAP^Δ123bp mutation, we hypothesized that this mutation may impair cell proliferation, thus leading to secondary XCI skewing. To explore this hypothesis, we examined cell proliferation in mutant NKAP MEFs compared to WT NKAP MEFs. As shown in Figure 5A, the cell proliferation rate observed in mutant NKAP MEFs was 3.4-fold lower compared to that of WT NKAP MEFs. To explore the mechanism of cell proliferation suppression induced by mutant NKAP, we analyzed mRNA expression of genes associated with apoptosis and cell cycle arrest in NKAP^WT and NKAP^Δ123bp MEFs. No significant differences between WT and mutant cells were observed with respect to the expression of genes associated with apoptosis. However, gene expression of the cyclin-dependent kinase inhibitors (CKIs) p27 and p57, which play critical roles in the regulation of cell cycle progression [15,16], was significantly increased in NKAP^Δ123bp compared to NKAP^WT MEFs (Figure 5B). Furthermore, NKAP^Δ123bp cells exhibited significantly increased mRNA expression of IL-1β and IL-6, which are the principal components of senescence-associated secretory phenotype (SASP) [17]. Expression of Myc, a transcription factor promoting cell proliferation, was slightly but not significantly reduced in NKAP^Δ123bp compared to NKAP^WT MEFs.

Upregulation of senescence-associated β-galactosidase (SA-β-gal) activity is the hallmark of cell senescence [18]. We, therefore, further investigated cell senescence induced by mutant NKAP using SA-β-gal staining, which is a widely used method for identifying senescence. The percentage of SA-β-gal-positive cells was significantly increased in NKAP^Δ123bp MEFs compared to WT MEFs (Figure 5C,D), supporting the RT-PCR results indicating increased cell senescence exhibited by NKAP^Δ123bp MEFs.

3. Discussion

NKAP is a highly conserved, ubiquitously expressed nuclear protein, playing important roles in diverse biological processes, including activation of the transcription factor NF-Kappa-B [1], transcriptional regulation mediated by interactions with HDAC3 and spliceosomal proteins [2,19], T-cell development [20,21], maintenance and survival of hematopoietic stem cells [5], RNA splicing and processing [22], and cell proliferation [3,4,14].

Based on a comprehensive study conducted in a cohort of 10 patients, Fiordaliso et al. [6] have reported that hemizygous missense mutations in the NKAP gene cause X-linked syndromic intellectual disability associated with marfanoid habitus, musculoskeletal, and cognitive impairments. Xu et al. [23] have recently identified a missense NKAP mutation in two fetuses diagnosed with congenital heart defects, indicating that NKAP may play a significant role in cardiac development. In addition, a frameshift mutation in exon 8 of NKAP, leading to C-terminal NKAP truncation, was reported to cause severe developmental defects in zebrafish [6]. All the mutations reported in the aforementioned studies are located in exons 8 and 9 of NKAP encoding the C-terminal region of the NKAP protein, which mediates the interaction of NKAP with HDAC3 and spliceosomal complex proteins [6,23]. In the current study, we investigated the effects of a large in-frame deletion located in the N-terminal region of NKAP on musculoskeletal function of hemizygous NKAP^Δ123bp mice. Based on the results of forelimb grip strength test, NKAP^Δ123bp mice exhibited prominent forelimb muscle weakness, consistent with hypotonia reported in human patients with NKAP mutations [6]. Significantly altered gait parameters observed in NKAP^Δ123bp mice in the CatWalk XT gait analysis system, specifically reduced forelimb stride length, and decreased forelimb maximal contact area accompanied by increased hindlimb maximal contact area (Figure 2B,C), are consistent with impaired forelimb motor function, with possible compensatory hindlimb loading [24,25]. Increased duty cycle in all four limbs (Figure 2D), indicating prolongation of the stance phase, may represent a compensatory adaptation to gait impairment, reflecting an attempt to enhance stability and postural control during locomotion. Increased duty cycle is considered a sensitive indicator of motor dysfunction and altered weight-bearing in rodent models of central and peripheral nervous system disorders, such as spinal cord injury, stroke, and neurodegenerative diseases [24,25]. Decreased swing time in both forelimbs and hindlimbs (Figure 2E), indicating a decrease in the duration that each paw spends in the air during the stride cycle, reflects an attempt to minimize the period of single-limb support, thereby increasing stability. Decreased swing time has been associated with a compensatory mechanism for muscle weakness, impaired coordination, pain, or instability in rodent models of neuromuscular and central nervous system disorders, including muscular dystrophy, spinal cord injury, and arthritis [25,26,27]. Increased percentage of three-limb support might reflect slower, more cautious gait due to muscle weakness, postural imbalance, or pain. This gait abnormality, reported in models of traumatic brain injury and multiple sclerosis, indicates an attempt to increase overall support and compensate for musculoskeletal weakness and gait instability [28,29]. Taken together, the above findings observed in NKAP^Δ123bp mice consistently reflect forelimb weakness or neuromuscular dysfunction, with compensatory alterations in the hindlimbs and gait adaptations to maintain balance and mobility.

We have previously identified a nonsense mutation in exon 1 of NKAP, which resulted in complete inactivation of the X chromosome bearing the mutant NKAP copy in a HA carrier presenting with HA symptoms [10]. To the best of our knowledge, NKAP has not been studied in the context of XCI regulation. Therefore, with the aim of exploring the potential involvement of NKAP in the process of XCI skewing, we generated NKAP mutant mice using CRISPR/Cas9 and a single guide RNA targeting exon 1 of NKAP, analogous to the location of the mutation identified in the female HA patient originally diagnosed with a nonsense mutation in exon 1 of NKAP [10]. We obtained two mutant NKAP mice: a female heterozygous for a frameshift NKAP mutation (NKAP^Δ70bp; Figure 1) and a male hemizygous for a large in-frame deletion (NKAP^Δ123bp; Figure 1). The female mouse carrying the frameshift NKAP mutation exhibited extremely skewed XCI of the X chromosome carrying the mutant NKAP copy (Figure 3B). Notably, this female produced neither hemizygous mutant NKAP males nor heterozygous mutant NKAP females, despite the presence of mutant NKAP^Δ70bp oocytes in her ovaries (Figure S2), excluding mosaicism as a possible reason for the lack of mutant offspring. This finding was unexpected in view of our previous observation that heterozygosity for the nonsense NKAP mutation was not lethal in women [10]. Thus, the lack of any offspring carrying the NKAP^Δ70bp mutation implies that a severely deleterious NKAP mutation may impair oocyte function. Li et al. [30] have reported that siRNA-induced knockdown of NKAP in mouse oocytes resulted in pronounced defects during meiotic maturation, including spindle disorganization and failure of proper chromosome congression. These abnormalities were accompanied by increased kinetochore–microtubule misattachments during meiosis I, resulting in unstable chromosome biorientation. In addition, polar body extrusion was significantly reduced in NKAP-depleted oocytes, indicating defective maturation [30]. Based on this evidence, we suggest that complete NKAP deficiency in mutant NKAP^Δ70bp oocytes resulted in impaired meiotic maturation, thus leading to compromised oocyte function and fertilization potential. Thus, despite the presence of mutant NKAP^Δ70bp oocytes in the ovaries of the heterozygous NKAP^WT/Δ70bp female, no mutant NKAP^Δ70bp offspring could be generated.

Breeding of the male hemizygous for the large in-frame NKAP^Δ123bp deletion with homozygous HA females resulted in generation of double heterozygous F8^+/−/NKAP^WT/Δ123bp females, who exhibited skewed XCI of the X chromosome carrying the mutant NKAP copy, although to a lesser extent compared to the XCI skewing caused by the frameshift NKAP^Δ70bp mutation (Figure 3A,B), and by the nonsense mutation identified in our original patient [10]. In this context, a double heterozygous mouse carrying both the NKAP^Δ70bp and F8 mutations would have more closely recapitulated the condition of our original patient. However, in view of the crucial role of NKAP in meiotic maturation as discussed above, complete NKAP deficiency in the NKAP^Δ70bp oocytes has most probably led to their dysfunction, eventually resulting in failure to undergo fertilization. Nevertheless, despite the limitation associated with the significant difference between the human nonsense mutation and the murine NKAP^Δ123bp mutation, the NKAP^Δ123bp mutation recapitulates the human condition of female hemophilia A to a significant extent, as demonstrated by significantly reduced F8 mRNA and FVIII protein levels in the double heterozygous F8^+/−/NKAP^WT/Δ123bp females, compared to F8^+/−/NKAP^WT/WT females. It should be noted that unlike the NKAP mutations identified by Fiordaliso et al. [6] and Xu et al. [23] in human patients, all of which are clustered in the C-terminal HDAC3 binding domain, the large deletion investigated by us in this study is located in the N-terminal RS domain mediating the nuclear localization of NKAP [2]. Thus, our results suggest that partial truncation of the N-terminal RS domain of NKAP may be involved in dysregulation of cellular processes, eventually leading to XCI skewing.

Data published in the literature suggest significant involvement of NKAP in the regulation of crucial cellular processes, including cell proliferation [3,4,14]. Our findings demonstrate significant inhibition of cell proliferation by mutant NKAP (Figure 5A), which is mediated by induction of cell senescence, as indicated by increased mRNA expression of the CKIs p27 and p57 mediating cell cycle arrest [15,16], and the cytokines IL-1β and IL-6 associated with cell senescence [17]. Senescent phenotype induction by mutant NKAP is in accord with the findings reported by Shapiro et al. [31], demonstrating that NKAP deficiency is associated with cell cycle arrest and senescence in hematopoietic progenitor cells. In addition, our findings suggest that double heterozygous F8^+/−/NKAP^WT/Δ123bp mice exhibit secondary XCI skewing [32] driven by proliferative disadvantage experienced by cells that inactivated the WT NKAP copy rather than the mutant NKAP copy, thus eventually leading to reduced proliferation and enhanced senescence of cells that inactivated WT NKAP copy, along with accelerated proliferation of cells that inactivated the mutant NKAP copy. This difference in proliferative capacity results in clonal selection amplifying XCI skewing (Figure 6).

In conclusion, we generated a murine mutant NKAP model that recapitulates the musculoskeletal abnormalities observed in human patients with missense mutations in the NKAP gene. In addition, the results of our study show that NKAP is involved in molecular and cellular mechanisms regulating XCI patterns. Furthermore, we demonstrate the potential feasibility of the murine HA model, which provides a valuable methodological framework for investigating non-random XCI in vivo, based on monitoring F8 mRNA/FVIII protein expression levels as robust markers of XCI skewing, for investigations of other genes implicated in XCI regulation.

4. Materials and Methods

4.1. Generation of Mutant NKAP Mice and Double Heterozygous Mutant NKAP/HA Mice

Mutant NKAP mice were generated using CRISPR/Cas9 and single guide RNA targeting NKAP exon 1 (NCBI Reference Sequence: NM_025937.4) at the Department of Veterinary Resources, Weizmann Institute of Science (Rehovot, Israel). The RNA guide was designed using the CHOPCHOP software version 2 (https://chopchop.cbu.uib.no/; accessed on 26 July 2022). Based on CHOPCHOP analysis for off-target effects, the selected guide was predicted to have no potential off-target sites with 0–2 mismatches.

Two mutant mice identified by Sanger sequencing were bred with hemophilia A mice (F8^tm1Kaz mice purchased from Jackson Laboratory, Bar Harbor, ME, USA).

All offspring males and females were genotyped by PCR analysis of the NKAP and F8 mutation regions. Genotyping was performed on ear punches taken from the mice, lysed with lysis buffer (Viagen Biotech Inc., Los Angeles, CA, USA).

Mice were bred and maintained under specific pathogen-free conditions in the Laboratory Animal Experimental Center at Sheba Medical Center, which is affiliated with Tel Aviv University. The Institutional Review Board (IRB) for animal trials at Sheba Medical Center approved these mice studies (approval number: ANIM-1352-22 on 24 July 2022).

4.2. Behavioral Studies in Mutant NKAP Males

4.2.1. Grip Test

The forelimb grip strength was measured with Grip Strength Meter (Ugo Basile, Gemonio, Italy), which determines the forelimb neuromuscular function as maximal muscle strength of forelimbs. The technique exploits the instinctive resistance of rodents to backward movements and their consequent tendency to grasp (grip) against the pull-back movement that the operator applies. Five forepaw grip measurements were conducted for each mouse, and the three highest measurements were averaged and divided by body weight to obtain weight-normalized grip strength values [12].

4.2.2. CatWalk Gait Analysis

Gait analysis was monitored by CatWalk XT, Noldus (https://noldus.com/catwalk-xt; first accessed on 1 August 2025). A minimum of three runs was recorded for each mouse. As an animal voluntarily runs across a glass walkway, its feet reflect green light every time they touch the glass. This reflected green light is captured by a high-speed camera underneath the walkway. Besides footprints, a myriad of other gait and locomotion parameters are automatically detected [33,34].

4.3. DNA Extraction

Murine blood samples were collected from the facial vein into 0.5 mL tubes pre-coated with 0.109M sodium citrate, with a final blood–anticoagulant ratio of 1:1 (vol/vol). DNA was extracted using the QIAGEN DNeasy blood and tissue kit (Qiagen, Hilden, Germany).

4.4. XCI Pattern Analysis

DNA fragments encompassing the NKAP^Δ123bp (forward primer: TAGGACCCTAGGTGTCCGGG; Fam-labeled reverse primer: GGCTGAAGCCACTCAGCGAA) and NKAP^Δ70bp (forward primer: TAGGACCCTAGGTGTCCGGG; Fam-labeled reverse primer: GCGGGAAGATTTGATGGATTTG) mutations were subjected to restriction mapping using the NEBcutter^® v3.0.20 software. Based on this analysis, two methylation-sensitive enzymes were selected: HpaII and BstUI. For each DNA sample, two PCR reactions were performed using the above primers. In one reaction, the template contained DNA digested with HpaII and BstUI (New England Biolabs, Inc., Ipswich, MA, USA), whereas the other reaction contained undigested genomic DNA. PCR products were subjected to electrophoresis in a sequence analyzer (3500xL Genetic Analyzer, Applied Biosystems, Hitachi, Foster City, CA USA), followed by analysis using the GeneMapper software version 3.5 (Applied Biosystems). The degree of skewing was calculated using the equation: (d1/u1)/[(d1/u1) + (d2/u2)], where d1 and d2 represent the peak intensities of the PCR products derived from the digested DNA template and u1 and u2 represent the peak intensities of the PCR products derived from the undigested DNA template [35].

4.5. RNA Extraction and RT-PCR

Total RNA was extracted from homogenized murine livers using Rneasy Mini Kit (Qiagen, Hilden, Germany) and reverse-transcribed into cDNA using cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Vilnius, Lithuania) according to the manufacturer’s instructions. cDNA samples were analyzed for F8 RNA levels by quantitative real-time PCR analysis using the ABI 7500 Fast device (Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA). GAPDH and ACTB (beta-actin) genes were used as housekeeping genes. Statistical analyses of PCR data were performed on ΔCt values [36], calculated by subtracting the mean Ct of GAPDH and ACTB from the F8 Ct [37]. Relative gene expression was calculated by the commonly used 2^−ΔΔCt formula.

4.6. FVIII ELISA

Murine FVIII antigen levels were measured in murine plasma samples obtained from citrated blood using a commercial ELISA (LSBio, Seattle, WA, USA; Cat. No. LS-F5831) based on colorimetric detection at 450 nm, according to the manufacturer’s instructions. FVIII antigen levels were determined according to the standard curve samples provided with the kit.

4.7. MEFs Generation

MEFs were generated according to the method described by Huang et al. [38]. Male and female mice were housed together for mating, and every female was monitored for a copulatory plug daily. Then, 12 to 14 days after detection of a copulatory plug, pregnant females were euthanized, and the embryos (usually 7–9 embryos) were collected into PBS supplemented with penicillin (100 I.U./mL)/streptomycin (100 μg/mL). Each embryo was subsequently transferred to a 1.5 mL Eppendorf tube containing 1 mL of 0.25% trypsin/0.53 mM EDTA solution and incubated at 37°C for 10 min. Following incubation, the tissue was mechanically disrupted by pipetting multiple times using a 1 mL pipettor and transferred to a cell culture dish containing DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin (100 I.U./mL)/streptomycin (100 μg/mL). The medium was replaced after 24 h, and the MEFs were maintained in the above medium. MEFs maintained up to passage 4 were used for the experiments performed in the study.

4.8. Cell Proliferation Assay

Cell proliferation was assessed using the CCK-8 assay (RayBiotech, Peachtree Corners, GA, USA) [39]. MEFs (3000 cells/well) were seeded in a 96-well plate and incubated for 12 h at 37°C. CCK-8 solution (10 μL) was added to each well and incubated for 2 h at 37°C. Absorbance was then measured at 450 nm using a microplate ELISA reader (Infinite 200 PRO; Tecan Group Ltd., Männedorf, Switzerland). This procedure was subsequently repeated 24, 48, and 72 h following seeding.

4.9. Senescence-Associated β-Galactosidase (SA-β-gal) Staining

MEFs were seeded in a 24-well plate at a density of 10,000 cells per well. SA-β-gal staining was performed 24 h following seeding using the SA-β-gal kit (MedChemExpress, Monmouth Junction, NJ, USA) according to the manufacturer’s instructions.

Quantitation of SA-β-gal positive cells was performed by visual counting of positive cells in microscope field images. Total cell numbers were assessed by the Fiji software version 2.9.0 (https://imagej.net/software/fiji, first accessed on 10 January 2026) [40]. In each experiment, nine fields representing three separate wells were analyzed for WT and NKAP^Δ123bp MEFs each.

4.10. Statistical Analyses

Statistical analyses were performed using GraphPad Prism (v. 11.0.0 for Windows, GraphPad Software, Boston, MA, USA, www.graphpad.com). Normality was assessed using the Shapiro–Wilk test. Data were presented as mean ± standard deviation (SD) for normally distributed variables or as median with interquartile range (IQR) for non-normally distributed variables. Two-group comparisons were performed using a two-tailed unpaired t-test or the Mann–Whitney U test, as appropriate to the data. Outliers were defined as values below Q1 − 1.5 × IQR or above Q3 + 1.5 × IQR. No data points were excluded from any analysis. p < 0.05 was considered statistically significant.