Next Article in Journal
Poly-D,L-Lactic Acid Filler Restores Hair Thickness and Shine by Ameliorating Age-Associated Follicular Decline
Previous Article in Journal
Genetically Encoded CB2R-Based Fluorescent Sensor Enables Rapid Screening and Functional Assessment of Cannabinoid Modulators
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 5
10.3390/ijms27052094
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Novel Role of the LINC01270/miR-326/LDOC1 Axis in Proinflammatory Response Regulation via STAT1 Modulation in THP-1 Cells

by
Imene Arab
1,2,
Young Jae Lim
1,2,
Su-Geun Lim
1,2,
Kyoungho Suk
3,4,
Dong Kyu Choi
1,2 and
Won-Ha Lee
1,2,3,*
1
School of Life Sciences, Kyungpook National University, Daegu 41566, Republic of Korea
2
BK21 Plus KNU Creative BioResearch Group, Kyungpook National University, Daegu 41566, Republic of Korea
3
Brain Science & Engineering Institute, Kyungpook National University, Daegu 41944, Republic of Korea
4
Department of Pharmacology, School of Medicine, Kyungpook National University, Daegu 41944, Republic of Korea
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2026, 27(5), 2094; https://doi.org/10.3390/ijms27052094
Submission received: 24 November 2025 / Revised: 2 February 2026 / Accepted: 20 February 2026 / Published: 24 February 2026
(This article belongs to the Section Molecular Immunology)
Browse Figures
Versions Notes

Abstract

LINC01270 is a long intergenic noncoding RNA implicated in the progression of various cancers. In our previous study, we demonstrated that LINC01270 plays a role in regulating the pro-inflammatory response in the THP-1 monocytic cell line, partly through modulation of NF-κB activation. Given the multifaceted nature of inflammation and the ability of noncoding RNAs to influence this process at multiple levels, we further investigated the potential role of LINC01270 in modulating additional inflammatory signaling pathways in lipopolysaccharide (LPS)-stimulated THP-1 cells. We found that attenuation of LINC01270 levels led to increased transcription and phosphorylation of STAT1, accompanied by elevated expression of the genes under STAT1 regulation. Further investigation revealed that LINC01270 regulates STAT1 expression via the miR-326/leucine zipper downregulated in cancer 1 (LDOC1) axis. Notably, inhibition of the interaction between LINC01270 and miR-326 effectively reversed the effects of LINC01270 knockdown on STAT1 expression and its downstream targets. Interestingly, both gain- and loss-of-function experiments with LDOC1 resulted in a consistent upregulation of STAT1 transcription. Taken together, our findings highlight a pleiotropic role of the LINC01270 in regulating the pro-inflammatory response through modulation of STAT1 signaling, in addition to its previously established role in NF-κB regulation. Furthermore, this study uncovers a novel function of the LDOC1 in inflammation through its regulation of STAT1. These findings provide new mechanistic insights into lncRNA–microRNA–protein interactions in inflammatory signaling and may open avenues for developing novel therapeutic strategies targeting chronic inflammatory diseases.

1. Introduction

Inflammation is a fundamental immune response essential for host survival during infection and tissue injury [1]. Upon recognition of harmful stimuli such as lipopolysaccharides (LPS), macrophages activate multiple transcription factors, including nuclear factor kappa B (NF-κB), mitogen-activated protein kinases (MAPKs), and the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway, which collectively drive the expression of diverse inflammatory genes [2,3,4]. While NF-κB represents the central mediator of LPS–TLR4 signaling, the JAK–STAT1 pathway also plays a critical role in LPS-induced inflammation. Specifically, LPS stimulation triggers JAK phosphorylation, leading to STAT1 phosphorylation, dimerization, and nuclear translocation, where STAT1 induces the transcription of pro-inflammatory mediators such as iNOS, COX-2, CCL5, and CXCL10 [5,6,7]. Notably, inhibition of JAK/STAT signaling has been shown to attenuate LPS-induced inflammation [8]. Thus, a balanced and tightly regulated inflammatory response is essential for efficient pathogen clearance while preventing excessive activation that may result in pathological outcomes, including chronic inflammation and autoimmunity [9,10,11].
Long noncoding RNAs (lncRNAs) are a class of noncoding transcripts longer than 200 nucleotides [12]. Initially considered transcriptional byproducts without functional relevance, lncRNAs are now recognized as important regulators of inflammatory responses. They exert their functions by modulating diverse cellular processes, including transcription factor activity and signaling pathways [13,14]. For example, LINC0168 regulates LPS-induced inflammation in THP-1 cells by sponging miR-18a-5p, thereby influencing A20 expression and STAT1 activation [15]. Similarly, knockdown of lincRNA-Cox2 in RAW264.7 macrophages attenuates inflammation by modulating IL-6/JAK3/STAT3 and NF-κB p65 signaling pathways [16]. In our previous work, we were the first to demonstrate that LINC01270 regulates pro-inflammatory responses in THP-1 cells by sponging miR-326, which in turn controls the expression of leucine zipper downregulated in cancer 1 (LDOC1), thereby negatively regulating NF-κB signaling pathway [17].
Although studies on the role of LINC01270 in inflammation remain limited, its regulatory functions in cancer progression have been the primary focus of recent research. Li et al. demonstrated that LINC01270 modulates GSTP1 methylation, thereby conferring resistance to 5-fluorouracil chemotherapy in esophageal cancer [18]. In lung cancer, LINC01270 promotes tumor progression through the miR-326/LARP1 axis [19]. Furthermore, Liu et al. reported elevated serum levels of LINC01270 in glioma patients, with expression correlating with disease severity, suggesting its potential utility as a diagnostic biomarker [20].
Given the complexity of inflammatory signaling and the diverse functions of lncRNAs, we sought to determine whether LINC01270 modulates inflammatory responses in LPS-stimulated THP-1 cells through pathways beyond NF-κB. In this study, we provide, to our knowledge, the first evidence that LINC01270 regulates STAT1 activity in THP-1 cells via the miR-326/LDOC1 axis. Moreover, our findings suggest a novel scaffolding function of LDOC1 in the transcriptional regulation of STAT1.

2. Results

2.1. LINC01270 Attenuation Upregulates STAT1 Expression in LPS-Treated THP-1 Cells

In our previous study, we demonstrated that LPS stimulation of THP-1 cells increases LINC01270 levels, and that siRNA-mediated knockdown of LINC01270 (siLINC01270) modulates NF-κB activity [17]. In the present work, we explored whether LINC01270 also regulates other inflammatory signaling pathways. We found that silencing LINC01270 in LPS-treated THP-1 cells markedly enhanced STAT1 mRNA and protein expression, accompanied by increased STAT1 phosphorylation (Figure 1A,B and Supplementary Figure S1). Moreover, prolonged exposure to LPS or stimulation with alternative agents such as IFNγ both resulted in pronounced STAT1 protein expression (Figure S1A,B), indicating that STAT1 upregulation in siLINC01270-transfected THP-1 cells is primarily driven by LINC01270 depletion.
During the initiation of inflammatory responses, STAT1 drives the transcription of chemokine genes such as CCL5 and CXCL10 [21,22]. Consistent with this, LINC01270 knockdown led to elevated expression of both CCL5 and CXCL10 in LPS-stimulated THP-1 cells (Figure 1C,D). These findings suggest that LINC01270 regulates STAT1 transcription and activation, thereby modulating downstream chemokine expression.

2.2. Interrupting the Interaction Between miR-326 and LINC01270 Mitigates STAT1 Upregulation in LINC01270-Attenuated THP-1 Cells

LncRNAs regulate cellular processes through diverse mechanisms, most commonly by acting as competitive endogenous RNAs (ceRNAs) or microRNA (miRNA) sponges. In this capacity, they bind miRNAs through sequence complementarity, thereby preventing the miRNAs from repressing their mRNA targets [23].
Database predictions from LncRNASNP and miRNet identified miR-326 as a potential target of LINC01270 (Figure 2A). Consistent with this, our previous work demonstrated that miR-326 mediates LINC01270 regulation of NF-κB activation in LPS-stimulated THP-1 cells [17]. Based on these findings, we hypothesized that miR-326 might also participate in LINC01270-mediated regulation of STAT1. To test this, THP-1 cells were co-transfected with a miR-326 inhibitor and siLINC01270. Inhibition of miR-326 reduced the elevated STAT1 mRNA and protein levels induced by siLINC01270 transfection (Figure 2B–E). Furthermore, treatment with the miR-326 inhibitor reversed the siLINC01270-driven increase in CXCL10 and CCL5 mRNA following LPS stimulation (Figure 2F,G). As expected, transfection of miR-326 inhibitor alone also downregulated STAT1 mRNA levels (Figure S2A).
To further confirm the role of miR-326, we designed a decoy RNA mimicking the miR-326 binding site within LINC01270. Introduction of this decoy into siLINC01270-transfected THP-1 cells significantly suppressed the previously enhanced STAT1 mRNA levels (Figure 3A) as well as STAT1 and phospho-STAT1 protein levels (Figure 3B–D).
Taken together, these findings provide strong evidence that LINC01270 modulates STAT1 signaling in THP-1 cells by sequestering miR-326.

2.3. miR-326 Targets LDOC1 mRNA to Regulate STAT1 Expression in LINC01270-Attenuated THP-1 Cells

miRNA–mRNA interaction prediction databases identified multiple potential targets of miR-326 (Table S1), among which LDOC1 emerged as a strong candidate for regulating STAT1 (Figure 4A). LDOC1 is well known for its role in suppressing NF-κB activation [24,25]. Structurally, LDOC1 contains a leucine zipper-like motif and an Src-homology (SH3)-binding domain, features typically associated with transcriptional regulation and intracellular signaling [26]. Given that LINC01270 appears to regulate STAT1 at the transcriptional level, LDOC1 was selected for further investigation within this regulatory axis.
In our previous work, we demonstrated the interaction between miR-326 and LDOC1 mRNA using a 3′UTR dual-luciferase assay, and further showed that inhibition of miR-326 restored LDOC1 mRNA and protein expression in siLINC01270-transfected THP-1 cells [17]. As expected, transfection of miR-326 inhibitor upregulated LPS-induced expression of LDOC1 mRNA (Figure S2B). Because knockdown of LINC01270 increases miR-326, which in turn reduces LDOC1 levels, we hypothesized that silencing LDOC1 would lead to STAT1 upregulation. To test this, we attenuated LDOC1 levels in THP-1 cells and examined the effects on STAT1. As expected, LDOC1 knockdown significantly increased STAT1 mRNA levels (Figure 4B,C), along with elevated STAT1 and phospho-STAT1 protein levels compared to scramble-transfected controls (Figure 4D).
To demonstrate that these observations are not restricted to THP-1 cells, a second human monocytic cell line, U937, was examined following the suppression of LINC01270 or LDOC-1 expression (Figure S3). In LPS-treated U937 cells, inhibition of miR-326 reversed the effects of siLINC01270 on STAT1 and LDOC-1 expression. Moreover, LDOC-1 suppression enhanced STAT1 expression.
Together, these findings confirm that LDOC1 downregulation contributes to the upregulation of STAT1 in LINC01270-attenuated THP-1 cells, supporting the existence of a LINC01270/miR-326/LDOC1/STAT1 regulatory axis.

2.4. LDOC1 Overexpression Also Upregulates STAT1 Expression in LINC01270-Attenuated THP-1 Cells

The observation that STAT1 expression increased upon LDOC1 knockdown, consistent with our hypothesis that LINC01270 regulates STAT1 via the miR-326/LDOC1 axis, prompted us to investigate whether LDOC1 overexpression could exert the opposite effect. To this end, THP-1 cells were transiently transfected with either an LDOC1 overexpression vector or an empty vector as a control. Successful overexpression was confirmed by qPCR (Figure 5A). LDOC1 is known to be downregulated in various cancer cell lines, and a similar expression pattern is observed in THP-1 cells. Consequently, the pronounced overexpression of LDOC1 following plasmid transfection is attributable to its extremely low basal expression in the control group. Interestingly, ectopic expression of LDOC1 in siLINC01270-transfected THP-1 cells resulted in markedly elevated LDOC1 levels (Figure 5B) compared to cells transfected with the overexpression vector alone (Figure 5A). We have previously demonstrated that LINC01270 regulates LDOC1 through miR-326, which sponges LDOC1 mRNA. The enhanced LDOC1 induction, despite LINC01270 downregulation, is likely due to saturation of miR-326 by excess ectopic LDOC1 transcripts, thereby relieving miR-326-mediated repression of endogenous LDOC1 mRNA.
Unexpectedly, LDOC1 overexpression did not suppress STAT1 expression; instead, it further enhanced the siLINC01270-induced increase in STAT1 mRNA levels (Figure 5C). Consistently, STAT1 and phospho-STAT1 protein levels were also elevated (Figure 5D).
Taken together, these results reveal that both LDOC1 knockdown and overexpression lead to enhanced STAT1 transcription and activation, suggesting that LDOC1 exerts a complex regulatory effect on STAT1 expression rather than functioning as a simple negative regulator.

2.5. LDOC1 Has a Biphasic Effect on STAT1 Expression Across Different Concentrations

The finding that both LDOC1 knockdown and overexpression enhanced STAT1 expression suggested that LDOC1 may function as a scaffold protein in STAT1 transcriptional regulation. The activity of scaffold proteins is known to depend on precise expression levels, which ensure the proper assembly of signaling complexes at specific cellular locations [27].
To test this hypothesis, we titrated LDOC1 expression in LINC01270-attenuated THP-1 cells and measured STAT1 expression. Our results showed that both high and low levels of LDOC1 led to increased STAT1 mRNA levels (Figure 6A,B), a pattern mirrored by STAT1 protein levels as detected by Western blotting (Figure 6C). By contrast, intermediate LDOC1 concentrations (100–250 ng/mL) appeared to suppress STAT1 expression.
Together, these findings support a possible scaffolding role for LDOC1, in which the relative abundance of the protein determines its regulatory effect on STAT1 expression.

3. Discussion

Inflammation is a tightly regulated biological process coordinated by a complex network of signaling pathways that mediate immune responses to infection and tissue injury. Among these, the NF-κB and JAK/STAT pathways are central regulators of pro-inflammatory gene expression. Dysregulation of these pathways can drive pathological outcomes, including chronic inflammation and autoimmune disorders [28].
LncRNAs, once considered transcriptional noise, are now recognized as important regulators of immune responses, functioning through epigenetic modification, transcriptional regulation, or post-transcriptional interactions with miRNAs [29]. LINC01270 has recently attracted attention for its role in cancer progression [18,19,30], yet its function in inflammation remains largely unexplored. In our previous study, we identified LINC01270 as a novel regulator of NF-κB-mediated inflammatory signaling in THP-1 monocytic cells, acting through the miR-326/LDOC1 axis [17]. Given the multifactorial nature of inflammation and the pleiotropic actions of lncRNAs, we hypothesized that LINC01270 may also modulate additional inflammatory pathways beyond NF-κB.
In this study, we demonstrate that LINC01270 attenuates STAT1 signaling during LPS-induced inflammation in THP-1 cells. STAT1 is a key transcription factor activated upon LPS stimulation and is responsible for driving the expression of chemokines such as CCL5 and CXCL10 [21,22]. Knockdown of LINC01270 led to increased STAT1 mRNA and protein levels, along with enhanced phosphorylation, under both basal and LPS-stimulated conditions. This was accompanied by elevated expression of STAT1-dependent chemokines, indicating that LINC01270 acts as a regulator of STAT1 and its downstream inflammatory response.
Mechanistically, this regulation is mediated through a ceRNA mechanism, in which LINC01270 functions as a molecular sponge for miR-326, preventing it from repressing its target mRNA. Inhibition of miR-326 reversed the effects of LINC01270 knockdown, restoring STAT1 levels to baseline and reducing chemokine production. Importantly, our findings provide the first evidence that miR-326 regulates STAT1 activity through repression of LDOC1, thereby establishing a novel LINC01270/miR-326/LDOC1 axis in STAT1-mediated inflammatory signaling (Figure 7).
Several studies have highlighted the role of miR-326 in regulating inflammation. For instance, miR-326 suppresses inflammation and promotes autophagy in silica-induced pulmonary fibrosis by targeting TNFSF14 and PTBP1 mRNAs [31]. Zhang et al. demonstrated that miR-326 modulates cardiac hypertrophy by targeting and inhibiting MDK, thereby attenuating JAK/STAT3 signaling [32]. In our previous work, we also showed that miR-326 regulates NF-κB activity in THP-1 cells through modulation of LDOC1 mRNA [17]. The present study is the first, to our knowledge, to implicate miR-326 in the regulation of STAT1 via sequestration of LDOC1 mRNA. Bioinformatic analysis using the LncRNASNP and miRNet databases identified several putative miRNAs predicted to interact with LINC01270 (Figure 2A), among which miR-326 was selected for experimental validation. This selection was based on previously documented roles of miR-326 in modulating inflammation and immune responses through various mechanisms. However, we acknowledge that other candidate miRNAs identified in the Venn diagram may also be sponged by LINC01270 and could contribute to STAT1 regulation via alternative downstream targets. Given the pleiotropic nature of lncRNA–miRNA networks, it is likely that LINC01270 coordinates multiple regulatory modules that collectively shape inflammatory transcriptional programs. To fully delineate the broader regulatory landscape governed by LINC01270 in inflammatory signaling, future studies involving systematic screening of additional candidate miRNAs and their respective target mRNAs will be necessary.
LDOC1 has been traditionally characterized as a negative regulator of NF-κB [24,25,33] and, more recently, as an inhibitor of STAT3 signaling through promotion of JAK2 degradation in lung cancer cells [34]. Here, we expand its functional repertoire by identifying a previously unrecognized role of LDOC1 in regulating STAT1 transcription. To our knowledge, this is the first study to propose a regulatory effect of LDOC1 on STAT1 activity. Further biochemical analyses and interactome profiling will be necessary to confirm this hypothesis and to identify potential protein partners involved in STAT1 regulation.
Unexpectedly, both silencing and overexpression of LDOC1 led to upregulation of STAT1 expression and phosphorylation, indicating a non-linear, possibly concentration-dependent mode of regulation. Such biphasic behavior is a hallmark of scaffold proteins, which modulate signal transduction by either assembling or sequestering signaling components depending on their relative abundance [27,35]. For example, both inhibition and overexpression of Serine/arginine protein kinase 1 (SRPK1) result in sustained Akt phosphorylation by disrupting its interaction with pleckstrin homology (PH) domain leucine-rich repeat protein phosphatase (PHLPP1). Reduced SRPK1 levels impair PHLPP1 recruitment to Akt, while elevated SRPK1 sequesters PHLPP1 away from Akt; in both cases, the outcome is hyperphosphorylated Akt [35]. Similarly, kinase suppressor of Ras (KSR), a well-characterized scaffold protein, regulates the Ras/MEK/ERK kinase cascade. In Drosophila, KSR facilitates ERK/MAPK activation by assembling Raf, MEK, and ERK into a functional complex, while its loss disrupts complex formation and impairs ERK/MAPK activation [36]. In mammalian systems, KSR knockout mice exhibit attenuated ERK/MAPK signaling [37], whereas overexpression of KSR in COS-7 cells also inhibits MAPK activation by sequestering MEK and preventing its productive interaction with ERK [38]. Collectively, these findings illustrate the critical scaffolding function of KSR in modulating ERK/MAPK signaling and highlight the dual capacity of scaffold proteins to either assemble or sequester kinases, depending on their expression levels [39].
Our titration experiments demonstrated that mid-range LDOC1 expression levels suppress, whereas both low and high LDOC1 protein levels enhance STAT1 transcription and activation. This biphasic response suggests that LDOC1 may act as a scaffold protein in STAT1 signaling, where precise expression levels are essential for its regulatory function. Structurally, LDOC1 contains an SH3-binding domain and a leucine zipper motif [40], both of which are commonly associated with protein–protein interactions and scaffolding activity [41,42]. Supporting this possibility, LDOC1 has been reported to interact with transcriptional regulators such as MZF1 to influence apoptosis in leukemia cell lines [43], indicating its capacity to participate in multiprotein complexes. Moreover, its predominant nuclear localization is consistent with a role in transcriptional regulation through interactions with transcription factors and cofactors [40].
Although our titration experiments reveal a biphasic, concentration-dependent effect of LDOC1 on STAT1 expression and phosphorylation, the proposed scaffolding function of LDOC1 remains, at present, a mechanistic model based on functional behavior and structural inference rather than direct biochemical evidence. The presence of an SH3-binding domain and a leucine zipper motif in LDOC1, together with its non-linear regulatory profile, is consistent with the behavior of classical scaffold proteins such as KSR and SRPK1; however, we have not yet demonstrated physical interactions between LDOC1 and components of the STAT1 signaling pathway. Therefore, the scaffolding model should be regarded as a working hypothesis. Alternative mechanisms may also account for the observed biphasic regulation, including titration of limiting regulatory factors, indirect transcriptional feedback loops, or cellular stress responses induced by extreme perturbations of LDOC1 expression. For example, excessive LDOC1 expression may sequester transcriptional cofactors or regulatory phosphatases required for STAT1 repression, whereas LDOC1 depletion may impair the assembly of inhibitory complexes, leading in both cases to enhanced STAT1 activation. Moreover, this study was conducted using the monocytic cell lines THP-1 and U937, both of which are transformed and may exhibit inherently altered signaling networks. Such alterations can affect cellular responses, including the potential activation of unfolded protein responses or other stress pathways in response to extreme changes in LDOC1 expression. These stress-induced effects may indirectly influence STAT1 transcription and, consequently, complicate the interpretation of observed outcomes. Therefore, findings derived from these cell lines may not fully reflect the physiological regulation occurring in primary cells. These limitations should be carefully considered when assessing the biological relevance of the findings. Nevertheless, the biphasic effects of LDOC1 observed in this context may still indicate a context-dependent mode of biological modulation. To determine whether this biphasic response reflects a genuine physiological scaffolding mechanism or is instead an artifact of cellular transformation, more refined experimental models that closely mimic in vivo conditions are necessary. In addition, future studies employing co-immunoprecipitation, proximity ligation assays, or interactome profiling will be required to define the LDOC1 protein interaction network and to determine how LDOC1 participates in STAT1 regulatory complexes.
Our recent work established the LINC01270/miR-326/LDOC1 regulatory axis as a negative modulator of NF-κB-mediated inflammatory signaling in LPS-stimulated THP-1 cells [17]. The present study extends this axis to STAT1 regulation using a parallel experimental framework, including siRNA-mediated knockdown, miRNA inhibition, and decoy-based validation. While this experimental strategy is necessarily similar, it reflects the biological reality that pleiotropic lncRNA–miRNA networks often coordinate multiple inflammatory transcriptional programs simultaneously. Importantly, our data reveal that the same LINC01270/miR-326/LDOC1 axis exerts fundamentally distinct regulatory logic on STAT1 compared with NF-κB. Whereas LDOC1 functions as a classical suppressor of NF-κB activation, STAT1 regulation displays a biphasic, concentration-dependent response in which both LDOC1 depletion and overexpression enhance STAT1 transcription and phosphorylation, suggesting a non-linear mode of control. This behavior is not compatible with a simple inhibitory model and instead implicates LDOC1 as a regulatory protein whose functional output depends on stoichiometric balance with downstream effectors. In this regard, our findings are mechanistically distinct from those reported by Baek et al. [15], who demonstrated that LINC01686 regulates STAT1 activation via the miR-18a-5p/A20 axis in THP-1 cells through modulation of a classical inhibitory signaling node. Together, these studies highlight that lncRNAs can converge on STAT1 regulation through fundamentally different molecular architectures—either via canonical suppressor pathways or, as suggested here, through a concentration-sensitive mechanism. Thus, the present work provides new insight into how a single lncRNA–miRNA axis can exert pleiotropic and pathway-specific control over inflammatory transcriptional networks.
While our current data clearly demonstrate that LINC01270 regulates STAT1 expression and activation via the miR-326/LDOC1 axis, it is important to acknowledge the pleiotropic nature of miRNAs. A single miRNA can bind to and repress multiple targets, thereby coordinating the regulation of specific pathways or cellular responses [44,45,46]. Thus, we cannot exclude the possibility that miR-326 may also regulate STAT1 expression in THP-1 cells by targeting additional genes beyond LDOC1.
Collectively, our findings indicate that LINC01270 modulates inflammatory activation of both NF-κB and STAT1 in THP-1 cells via the miR-326/LDOC1 axis. Regulation of NF-κB activity appears to depend on the suppressive function of LDOC1, whereas STAT1 regulation involves a concentration-dependent role for LDOC1. While the present data establish a LINC01270/miR-326/LDOC1 axis that governs STAT1-mediated inflammation, it is likely that both LINC01270 and miR-326 influence additional mRNAs and proteins. Given the pleiotropic nature of lncRNAs and miRNAs [44,45,46], further studies are required to identify additional targets of this regulatory network and to fully delineate the broader mechanisms by which LINC01270 and miR-326 modulate inflammatory responses.

4. Materials and Methods

4.1. Cell Lines and Cell Culture

The human monocytic leukemia cell line THP-1 (ATCC, Manassas, VA, USA) was maintained in RPMI-1640 medium (WELGENE, Daegu, Korea) supplemented with 10% fetal bovine serum (FBS), 0.05 mM β-mercaptoethanol, 25 µg/mL glucose, 100 U/mL penicillin–streptomycin, 1 mM sodium pyruvate, and 10 mM HEPES. Cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2.

4.2. Cell Transfection

LINC01270 silencing was performed using two siRNA sequences targeting LINC01270 (Table 1), purchased from Bioneer (Daejeon, Korea). THP-1 cells were seeded at a density of 2 × 105 cells/mL in antibiotic-free RPMI-1640 medium. Transfection was carried out using DharmaFECT 1 transfection reagent (Dharmacon, Lafayette, CO, USA). Cells were transfected with either scrambled siRNA (control) or a mixture of siLINC01270-1 and siLINC01270-2 at a final concentration of 100 nM. Following transfection, cells were incubated for 40–48 h before further experimental processing.
To analyze the interaction between lncRNA, miRNA, and mRNA, THP-1 cells were co-transfected with siLINC01270 siRNAs and either a miR-326 inhibitor or scrambled inhibitor (Bioneer, Daejeon, Korea) at a final concentration of 300 nM. Cells were incubated for 48 h post-transfection. For comparison, cells were also transfected with synthetic RNA decoys (Table 1) designed to mimic the binding sites within the LINC01270/miR-326/LDOC1 regulatory axis (Bioneer, Daejeon, Korea). All transfections were performed using DharmaFECT 1 transfection reagent (Dharmacon, Lafayette, CO, USA).

4.3. RNA Isolation and qTR-PCR

Total RNA was extracted using TRIzol reagent (Bioscience Technology, Daegu, Korea) according to the phenol–chloroform method. For cDNA synthesis, 1 μg of RNA was reverse transcribed using 5× Reverse Transcriptase mix (Elpis Biotech, Daejeon, Korea) at 45 °C for 1 h, followed by enzyme inactivation at 70 °C for 10 min. Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green Premix (Enzynomics, Daejeon, Korea) on either a qTOWER3 thermocycler (Jena Analytik, Jena, Germany) or a StepOne™ Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences are listed in Table 2. Gene expression levels were calculated using the 2−ΔΔCt method, with β-actin and GAPDH serving as housekeeping controls.

4.4. Western Blot

Cells were lysed in NP-40 buffer supplemented with protease and phosphatase inhibitor cocktails, sonicated, and incubated on ice for 10 min. Lysates were centrifuged at 12,000 rpm for 15 min at 4 °C, and the resulting supernatant was collected, mixed with Laemmli buffer containing 100 mM DTT, and boiled for 5 min. Proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes using a wet transfer system. Membranes were blocked with 5% nonfat skimmed milk or 5% BSA (for phosphorylated proteins) for 1 h at room temperature, followed by overnight incubation at 4 °C with the appropriate primary antibodies (Table 3) diluted in 5% BSA. After washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) kit (GenDEPOT, Baker, TX, USA) and detected with a DAVINCH-K Chemi-Fluoro Imager (Seoul, Republic of Korea). Proteins were resolved on independent gels, which were run simultaneously using the same set of samples.

4.5. LDOC1 Overexpression

For LDOC1 overexpression, an LDOC1 expression plasmid was purchased from OriGene (Rockville, MD, USA) and prepared according to the manufacturer’s instructions. THP-1 cells were seeded at a density of 2 × 105 cells/mL in antibiotic-free RPMI-1640 medium and transfected with either the LDOC1 overexpression plasmid or an empty vector control at a final concentration of 500 ng/mL using DharmaFECT 1 transfection reagent (Dharmacon, Lafayette, CO, USA). Transfected cells were incubated for 40–48 h before further experimental procedures.

4.6. Prediction of the Interaction Sites

Bioinformatic analyses were performed to predict potential interactions among lncRNA, miRNA, and mRNA. The lncRNASNP and miRNet databases were used to identify putative miRNA targets of LINC01270, while the miRDB and TargetScan databases were employed to predict possible interaction sites between miR-326 and LDOC1.

4.7. Statistical Analysis

All data are presented as mean ± SEM from at least three independent experiments. Statistical analyses and data visualization were performed using GraphPad Prism version 5 (GraphPad Software, San Diego, CA, USA). Comparisons between two independent groups were conducted using unpaired Student’s t-tests, while multiple group comparisons were assessed by two-way ANOVA followed by Bonferroni post hoc tests. A p-value < 0.05 was considered statistically significant.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms27052094/s1.

Author Contributions

Conceptualization W.-H.L., D.K.C. and K.S.; formal analysis I.A.; investigation I.A., Y.J.L. and S.-G.L.; resources, W.-H.L.; writing—original draft preparation, I.A.; writing—review and editing, W.-H.L. and D.K.C.; funding acquisition, W.-H.L.; Supervision, W.-H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (Ministry of Science and ICT) (No. 2022R1A2C1010005) and Global—Learning & Academic research institution for Master’s and PhD students, and Postdocs(LAMP) Program of the National Research Foundation of Korea(NRF) grant funded by the Ministry of Education (No. RS-2023-00301914).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data used in this article are sourced from materials mentioned in the References section.

Conflicts of Interest

The authors declare that they have no conflicts of interest. The funders had no role in the design of this study; collection, analyses, or interpretation of data; writing of the manuscript, or decision to publish the results.

Abbreviations

CCL5, C-C Motif Chemokine Ligand 5 (RANTES); CXCL10, C-X-C Motif Chemokine Ligand 10 (IP-10); ERK, Extracellular Signal-Regulated Kinase; GSTP1, Glutathione S-Transferase Pi 1; THP-1, Human Monocytic Cell Line (derived from acute monocytic leukemia); JAK, Janus Kinase; KSR, Kinase Suppressor of Ras; LARP1, La-Related Protein 1; LDOC1, Leucine Zipper, Down-Regulated in Cancer 1; LPS, Lipopolysaccharide; LINC01270, Long Intergenic Non-Protein Coding RNA 1270; lncRNA, Long Non-Coding RNA; MEK, MAPK/ERK Kinase (MAP2K); miRNA, MicroRNA; MAPK, Mitogen-Activated Protein Kinase; MZF1, Myeloid Zinc Finger 1; NF-κB, Nuclear Factor Kappa-light-chain-enhancer of Activated B Cells; STAT1, Signal Transducer and Activator of Transcription 1; STAT3, Signal Transducer and Activator of Transcription 3; SH3, Src Homology 3 Domain; TLR4, Toll-Like Receptor 4.

References

  1. Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar] [CrossRef]
  2. Mogensen, T.H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 2009, 22, 240–273. [Google Scholar] [CrossRef] [PubMed]
  3. Ciesielska, A.; Matyjek, M.; Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell. Mol. Life Sci. 2021, 78, 1233–1261. [Google Scholar] [CrossRef] [PubMed]
  4. Park, E.J.; Kim, Y.M.; Kim, H.J.; Chang, K.C. Degradation of histone deacetylase 4 via the TLR4/JAK/STAT1 signaling pathway promotes the acetylation of high mobility group box 1 (HMGB1) in lipopolysaccharide-activated macrophages. FEBS Open Bio 2018, 8, 1119–1126. [Google Scholar] [CrossRef] [PubMed]
  5. Sikorski, K.; Chmielewski, S.; Olejnik, A.; Wesoly, J.Z.; Heemann, U.; Baumann, M.; Bluyssen, H. STAT1 as a central mediator of IFNgamma and TLR4 signal integration in vascular dysfunction. JAKSTAT 2012, 1, 241–249. [Google Scholar] [CrossRef]
  6. Toshchakov, V.; Jones, B.W.; Perera, P.Y.; Thomas, K.; Cody, M.J.; Zhang, S.; Williams, B.R.; Major, J.; Hamilton, T.A.; Fenton, M.J.; et al. TLR4, but not TLR2, mediates IFN-beta-induced STAT1alpha/beta-dependent gene expression in macrophages. Nat. Immunol. 2002, 3, 392–398. [Google Scholar] [CrossRef]
  7. Tomita, K.; Kabashima, A.; Freeman, B.L.; Bronk, S.F.; Hirsova, P.; Ibrahim, S.H. Mixed Lineage Kinase 3 Mediates the Induction of CXCL10 by a STAT1-Dependent Mechanism During Hepatocyte Lipotoxicity. J. Cell. Biochem. 2017, 118, 3249–3259. [Google Scholar] [CrossRef]
  8. Ma, C.; Wang, Y.; Dong, L.; Li, M.; Cai, W. Anti-inflammatory effect of resveratrol through the suppression of NF-kappaB and JAK/STAT signaling pathways. Acta Biochim. Biophys. Sin. 2015, 47, 207–213. [Google Scholar] [CrossRef]
  9. Mosser, D.M.; Hamidzadeh, K.; Goncalves, R. Macrophages and the maintenance of homeostasis. Cell. Mol. Immunol. 2021, 18, 579–587. [Google Scholar] [CrossRef]
  10. Guan, Q.; Gao, X.; Wang, J.; Sun, Y.; Shekhar, S. Cytokines in Autoimmune Disease. Mediat. Inflamm. 2017, 2017, 5089815. [Google Scholar] [CrossRef]
  11. Chauhan, S.; Jena, K.K.; Mehto, S.; Chauhan, N.R.; Sahu, R.; Dhar, K.; Yadav, R.; Krishna, S.; Jaiswal, P.; Chauhan, S. Innate immunity and inflammophagy: Balancing the defence and immune homeostasis. FEBS J. 2022, 289, 4112–4131. [Google Scholar] [CrossRef]
  12. Arab, I.; Park, J.; Shin, J.J.; Shin, H.S.; Suk, K.; Lee, W.H. Macrophage lncRNAs in cancer development: Long-awaited therapeutic targets. Biochem. Pharmacol. 2023, 218, 115890. [Google Scholar] [CrossRef] [PubMed]
  13. Shin, H.S.; Shin, J.J.; Park, J.; Arab, I.; Suk, K.; Lee, W.H. Role of Macrophage lncRNAs in Mediating Inflammatory Processes in Atherosclerosis and Sepsis. Biomedicines 2023, 11, 1905. [Google Scholar] [CrossRef] [PubMed]
  14. Shin, J.J.; Park, J.; Shin, H.S.; Arab, I.; Suk, K.; Lee, W.H. Roles of lncRNAs in NF-kappaB-Mediated Macrophage Inflammation and Their Implications in the Pathogenesis of Human Diseases. Int. J. Mol. Sci. 2024, 25, 2670. [Google Scholar] [CrossRef] [PubMed]
  15. Baek, J.; Shin, H.S.; Suk, K.; Lee, W.H. LINC01686 affects LPS-induced cytokine expression via the miR-18a-5p/A20/STAT1 axis in THP-1 cells. Immun. Inflamm. Dis. 2024, 12, e1234. [Google Scholar] [CrossRef]
  16. Zhu, Y.; Lu, Y.; Yuan, L.; Ling, W.; Jiang, X.; Chen, S.; Hu, B. LincRNA-Cox2 regulates IL6/JAK3/STAT3 and NF-kappaB P65 pathway activation in Listeria monocytogenes-infected RAW264.7 cells. Int. J. Med. Microbiol. 2021, 311, 151515. [Google Scholar] [CrossRef]
  17. Arab, I.; Lim, S.G.; Suk, K.; Lee, W.H. LINC01270 Regulates the NF-kappaB-Mediated Pro-Inflammatory Response via the miR-326/LDOC1 Axis in THP-1 Cells. Cells 2024, 13, 2027. [Google Scholar] [CrossRef]
  18. Li, N.; Zhao, Z.; Miao, F.; Cai, S.; Liu, P.; Yu, Y.; Wang, B. Correction: Silencing of long non-coding RNA LINC01270 inhibits esophageal cancer progression and enhances chemosensitivity to 5-fluorouracil by mediating GSTP1methylation. Cancer Gene Ther. 2022, 29, 1299–1300, Erratum in Cancer Gene Ther. 2022, 29, 1299–1300. PMID: 33199829.. [Google Scholar] [CrossRef]
  19. Zhang, W.; Cao, C.; Shen, J.; Shan, S.; Tong, Y.; Cai, H.; Han, Z.; Chai, H. Long non-coding RNA LINC01270 is an onco-promotor in lung adenocarcinoma by upregulating LARP1 via sponging miR-326. Bioengineered 2022, 13, 14472–14488. [Google Scholar] [CrossRef]
  20. Liu, Y.; Zhang, Y.; Zhang, X.; Ma, H.; Dong, F. Abnormal expression of long non-coding RNA LINC01270 in glioma and its correlation with X-ray computed tomography signs. Acta Neurobiol. Exp. 2024, 84, 43–50. [Google Scholar] [CrossRef]
  21. Ohmori, Y.; Hamilton, T.A. Requirement for STAT1 in LPS-induced gene expression in macrophages. J. Leukoc. Biol. 2001, 69, 598–604. [Google Scholar] [CrossRef] [PubMed]
  22. Chmielewski, S.; Olejnik, A.; Sikorski, K.; Pelisek, J.; Blaszczyk, K.; Aoqui, C.; Nowicka, H.; Zernecke, A.; Heemann, U.; Wesoly, J.; et al. STAT1-dependent signal integration between IFNgamma and TLR4 in vascular cells reflect pro-atherogenic responses in human atherosclerosis. PLoS ONE 2014, 9, e113318. [Google Scholar] [CrossRef] [PubMed]
  23. Mattick, J.S.; Amaral, P.P.; Carninci, P.; Carpenter, S.; Chang, H.Y.; Chen, L.L.; Chen, R.; Dean, C.; Dinger, M.E.; Fitzgerald, K.A.; et al. Long non-coding RNAs: Definitions, functions, challenges and recommendations. Nat. Rev. Mol. Cell Biol. 2023, 24, 430–447. [Google Scholar] [CrossRef] [PubMed]
  24. Nagasaki, K.; Schem, C.; von Kaisenberg, C.; Biallek, M.; Rosel, F.; Jonat, W.; Maass, N. Leucine-zipper protein, LDOC1, inhibits NF-kappaB activation and sensitizes pancreatic cancer cells to apoptosis. Int. J. Cancer 2003, 105, 454–458. [Google Scholar] [CrossRef]
  25. Zhao, S.; Wang, Q.; Li, Z.; Ma, X.; Wu, L.; Ji, H.; Qin, G. LDOC1 inhibits proliferation and promotes apoptosis by repressing NF-kappaB activation in papillary thyroid carcinoma. J. Exp. Clin. Cancer Res. 2015, 34, 146. [Google Scholar] [CrossRef]
  26. Chen, H.; Chen, S.; Chen, C.; Li, A.; Wei, Z. Leucine zipper downregulated in cancer 1 may serve as a favorable prognostic biomarker by influencing proliferation, colony formation, cell cycle, apoptosis, and migration ability in hepatocellular carcinoma. Front. Genet. 2022, 13, 900951. [Google Scholar] [CrossRef]
  27. Frodyma, D.; Neilsen, B.; Costanzo-Garvey, D.; Fisher, K.; Lewis, R. Coordinating ERK signaling via the molecular scaffold Kinase Suppressor of Ras. F1000Res 2017, 6, 1621. [Google Scholar] [CrossRef]
  28. Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204–7218. [Google Scholar] [CrossRef]
  29. Zhang, Y.; Liu, H.; Niu, M.; Wang, Y.; Xu, R.; Guo, Y.; Zhang, C. Roles of long noncoding RNAs in human inflammatory diseases. Cell Death Discov. 2024, 10, 235. [Google Scholar] [CrossRef]
  30. Jiang, B.; Yang, K.; Tang, C.; Chen, R.; Wang, C. LncRNA LINC01270 aggravates the progression of gastric cancer through modulation of miR-326/EFNA3 axis. Bioengineered 2022, 13, 8994–9005. [Google Scholar] [CrossRef]
  31. Xu, T.; Yan, W.; Wu, Q.; Xu, Q.; Yuan, J.; Li, Y.; Li, P.; Pan, H.; Ni, C. MiR-326 Inhibits Inflammation and Promotes Autophagy in Silica-Induced Pulmonary Fibrosis through Targeting TNFSF14 and PTBP1. Chem. Res. Toxicol. 2019, 32, 2192–2203. [Google Scholar] [CrossRef]
  32. Zhang, J.; Wei, X.; Zhang, W.; Wang, F.; Li, Q. MiR-326 targets MDK to regulate the progression of cardiac hypertrophy through blocking JAK/STAT and MAPK signaling pathways. Eur. J. Pharmacol. 2020, 872, 172941. [Google Scholar] [CrossRef] [PubMed]
  33. Thoompumkal, I.J.; Rehna, K.; Anbarasu, K.; Mahalingam, S. Leucine Zipper Down-regulated in Cancer-1 (LDOC1) interacts with Guanine nucleotide binding protein-like 3-like (GNL3L) to modulate Nuclear Factor-kappa B (NF-kappaB) signaling during cell proliferation. Cell Cycle 2016, 15, 3251–3267. [Google Scholar] [CrossRef] [PubMed]
  34. Lee, C.H.; Yang, J.R.; Chen, C.Y.; Tsai, M.H.; Hung, P.F.; Chen, S.J.; Chiang, S.L.; Chang, H.; Lin, P. Novel STAT3 Inhibitor LDOC1 Targets Phospho-JAK2 for Degradation by Interacting with LNX1 and Regulates the Aggressiveness of Lung Cancer. Cancers 2019, 11, 63. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, P.; Zhou, Z.; Hu, A.; Ponte de Albuquerque, C.; Zhou, Y.; Hong, L.; Sierecki, E.; Ajiro, M.; Kruhlak, M.; Harris, C.; et al. Both decreased and increased SRPK1 levels promote cancer by interfering with PHLPP-mediated dephosphorylation of Akt. Mol. Cell 2014, 54, 378–391. [Google Scholar] [CrossRef]
  36. Roy, F.; Laberge, G.; Douziech, M.; Ferland-McCollough, D.; Therrien, M. KSR is a scaffold required for activation of the ERK/MAPK module. Genes Dev. 2002, 16, 427–438. [Google Scholar] [CrossRef]
  37. Ingersoll, M.A.; Lutze, R.D.; Kelmann, R.G.; Kresock, D.F.; Marsh, J.D.; Quevedo, R.V.; Zuo, J.; Teitz, T. KSR1 Knockout Mouse Model Demonstrates MAPK Pathway’s Key Role in Cisplatin- and Noise-induced Hearing Loss. J. Neurosci. 2024, 44, e2174232024. [Google Scholar] [CrossRef]
  38. Yu, W.; Fantl, W.J.; Harrowe, G.; Williams, L.T. Regulation of the MAP kinase pathway by mammalian Ksr through direct interaction with MEK and ERK. Curr. Biol. 1998, 8, 56–64. [Google Scholar] [CrossRef]
  39. Neilsen, B.K.; Frodyma, D.E.; Lewis, R.E.; Fisher, K.W. KSR as a therapeutic target for Ras-dependent cancers. Expert. Opin. Ther. Targets 2017, 21, 499–509. [Google Scholar] [CrossRef]
  40. Nagasaki, K.; Manabe, T.; Hanzawa, H.; Maass, N.; Tsukada, T.; Yamaguchi, K. Identification of a novel gene, LDOC1, down-regulated in cancer cell lines. Cancer Lett. 1999, 140, 227–234. [Google Scholar] [CrossRef]
  41. Lee, J.H.; Kang, E.; Lee, J.; Kim, J.; Lee, K.H.; Han, J.; Kang, H.Y.; Ahn, S.; Oh, Y.; Shin, D.; et al. Protein grafting of p53TAD onto a leucine zipper scaffold generates a potent HDM dual inhibitor. Nat. Commun. 2014, 5, 3814. [Google Scholar] [CrossRef]
  42. Kashef, K.; Lee, C.M.; Ha, J.H.; Reddy, E.P.; Dhanasekaran, D.N. JNK-interacting leucine zipper protein is a novel scaffolding protein in the Galpha13 signaling pathway. Biochemistry 2005, 44, 14090–14096. [Google Scholar] [CrossRef]
  43. Inoue, M.; Takahashi, K.; Niide, O.; Shibata, M.; Fukuzawa, M.; Ra, C. LDOC1, a novel MZF-1-interacting protein, induces apoptosis. FEBS Lett. 2005, 579, 604–608. [Google Scholar] [CrossRef]
  44. Faraoni, I.; Antonetti, F.R.; Cardone, J.; Bonmassar, E. miR-155 gene: A typical multifunctional microRNA. Biochim. Biophys. Acta 2009, 1792, 497–505. [Google Scholar] [CrossRef]
  45. Zhu, S.; Wu, H.; Wu, F.; Nie, D.; Sheng, S.; Mo, Y.Y. MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008, 18, 350–359. [Google Scholar] [CrossRef]
  46. Li, J.Z.; Gao, W.; Lei, W.B.; Zhao, J.; Chan, J.Y.; Wei, W.I.; Ho, W.K.; Wong, T.S. MicroRNA 744-3p promotes MMP-9-mediated metastasis by simultaneously suppressing PDCD4 and PTEN in laryngeal squamous cell carcinoma. Oncotarget 2016, 7, 58218–58233. [Google Scholar] [CrossRef]
Ijms 27 02094 g001
Figure 1. LINC01270 attenuation enhances STAT1 expression and activation. (A) STAT1 mRNA levels were measured by qRT-PCR in siLINC01270-transfected THP-1 cells following stimulation with 1 µg/mL LPS for the indicated time points. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (B) Western blot analysis of STAT1 and phospho-STAT1 in siLINC01270-transfected THP-1 cells stimulated with 1 µg/mL LPS for the indicated durations. (C,D) mRNA levels of CXCL10 (C) and CCL5 (D) were assessed by qRT-PCR in siLINC01270-transfected THP-1 cells following stimulation with 1 µg/mL LPS for the indicated time points. The data normalization was done same as in (A). Data are presented as mean ± SEM (n = 3). * p < 0.05, ** p <  0.01, *** p <  0.001.
Figure 1. LINC01270 attenuation enhances STAT1 expression and activation. (A) STAT1 mRNA levels were measured by qRT-PCR in siLINC01270-transfected THP-1 cells following stimulation with 1 µg/mL LPS for the indicated time points. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (B) Western blot analysis of STAT1 and phospho-STAT1 in siLINC01270-transfected THP-1 cells stimulated with 1 µg/mL LPS for the indicated durations. (C,D) mRNA levels of CXCL10 (C) and CCL5 (D) were assessed by qRT-PCR in siLINC01270-transfected THP-1 cells following stimulation with 1 µg/mL LPS for the indicated time points. The data normalization was done same as in (A). Data are presented as mean ± SEM (n = 3). * p < 0.05, ** p <  0.01, *** p <  0.001.
Ijms 27 02094 g001
Ijms 27 02094 g002
Figure 2. LINC01270 sponges miR-326 to regulate STAT1 signaling in THP-1 cells. (A) Prediction of miRNA targets of LINC01270 presented as a Venn diagram, with miR-326 identified as a candidate and its predicted binding site with LINC01270 shown. (B–D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells co-transfected with siLINC01270 and a miR-326 inhibitor, followed by stimulation with 1 µg/mL LPS for 1 h. Band intensities were quantified by densitometry using ImageJ (version 1.54a) with β-actin bands serving as internal control. (E–G) mRNA levels of STAT1 (E) and CXCL10, CCL5 (F,G) were measured by qRT-PCR in THP-1 cells co-transfected with siLINC01270 and a miR-326 inhibitor, followed by stimulation with 1 µg/mL LPS for 1 (E) and 4 h (F,G). Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. Data are presented as mean ± SEM (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 2. LINC01270 sponges miR-326 to regulate STAT1 signaling in THP-1 cells. (A) Prediction of miRNA targets of LINC01270 presented as a Venn diagram, with miR-326 identified as a candidate and its predicted binding site with LINC01270 shown. (B–D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells co-transfected with siLINC01270 and a miR-326 inhibitor, followed by stimulation with 1 µg/mL LPS for 1 h. Band intensities were quantified by densitometry using ImageJ (version 1.54a) with β-actin bands serving as internal control. (E–G) mRNA levels of STAT1 (E) and CXCL10, CCL5 (F,G) were measured by qRT-PCR in THP-1 cells co-transfected with siLINC01270 and a miR-326 inhibitor, followed by stimulation with 1 µg/mL LPS for 1 (E) and 4 h (F,G). Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. Data are presented as mean ± SEM (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 27 02094 g002
Ijms 27 02094 g003
Figure 3. A decoy RNA mimicking the miR-326 binding site of LINC01270 reverses siLINC01270-mediated STAT1 upregulation. (A) STAT1 mRNA levels were measured by qRT-PCR in THP-1 cells co-transfected with siLINC01270 and the decoy RNA, followed by stimulation with 1 µg/mL LPS. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (B–D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells co-transfected with siLINC01270 and the decoy RNA. Band intensities were quantified by densitometry using ImageJ with β-actin bands serving as internal control. Data are presented as mean ± SEM (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 3. A decoy RNA mimicking the miR-326 binding site of LINC01270 reverses siLINC01270-mediated STAT1 upregulation. (A) STAT1 mRNA levels were measured by qRT-PCR in THP-1 cells co-transfected with siLINC01270 and the decoy RNA, followed by stimulation with 1 µg/mL LPS. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (B–D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells co-transfected with siLINC01270 and the decoy RNA. Band intensities were quantified by densitometry using ImageJ with β-actin bands serving as internal control. Data are presented as mean ± SEM (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 27 02094 g003
Ijms 27 02094 g004
Figure 4. LDOC1 knockdown upregulates STAT1 expression in THP-1 cell line. (A) Predicted binding sites between LINC01270 and miR-326, and between miR-326 and the LDOC1 3′UTR. (B,C) LDOC1 (B) and STAT1 (C) mRNA levels measured by qRT-PCR in THP-1 cells transfected with siLDOC1 and stimulated with 1 µg/mL LPS. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells transfected with siLDOC1 and stimulated with 1 µg/mL LPS. Data are presented as mean ± SEM (n = 3). * p < 0.05.
Figure 4. LDOC1 knockdown upregulates STAT1 expression in THP-1 cell line. (A) Predicted binding sites between LINC01270 and miR-326, and between miR-326 and the LDOC1 3′UTR. (B,C) LDOC1 (B) and STAT1 (C) mRNA levels measured by qRT-PCR in THP-1 cells transfected with siLDOC1 and stimulated with 1 µg/mL LPS. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells transfected with siLDOC1 and stimulated with 1 µg/mL LPS. Data are presented as mean ± SEM (n = 3). * p < 0.05.
Ijms 27 02094 g004
Ijms 27 02094 g005
Figure 5. LDOC1 overexpression enhances STAT1 expression in LINC01270-attenuated THP-1 cells. (A) THP-1 cells were transfected with an LDOC1 overexpression vector (OE) or empty vector (EV), and LDOC1 mRNA levels were analyzed by qRT-PCR. (B,C) THP-1 cells were co-transfected with siLINC01270 and the LDOC1 overexpression vector, followed by stimulation with 1 µg/mL LPS for 1 h. LDOC1 (B) and STAT1 (C) mRNA levels were analyzed by qRT-PCR. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells treated as in (B). Data are presented as mean ± SEM (n = 3). * p < 0.05, *** p < 0.001.
Figure 5. LDOC1 overexpression enhances STAT1 expression in LINC01270-attenuated THP-1 cells. (A) THP-1 cells were transfected with an LDOC1 overexpression vector (OE) or empty vector (EV), and LDOC1 mRNA levels were analyzed by qRT-PCR. (B,C) THP-1 cells were co-transfected with siLINC01270 and the LDOC1 overexpression vector, followed by stimulation with 1 µg/mL LPS for 1 h. LDOC1 (B) and STAT1 (C) mRNA levels were analyzed by qRT-PCR. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (D) Western blot analysis of STAT1 and phospho-STAT1 in THP-1 cells treated as in (B). Data are presented as mean ± SEM (n = 3). * p < 0.05, *** p < 0.001.
Ijms 27 02094 g005
Ijms 27 02094 g006
Figure 6. LDOC1 titration in LINC01270-attenuated THP-1 cells. (A,B) THP-1 cells were co-transfected with siLINC01270 and decreasing concentrations of the LDOC1 overexpression vector (OE) or empty vector (EV), followed by stimulation with 1 µg/mL LPS for 1 h. LDOC1 (A) and STAT1 (B) mRNA levels were analyzed by qRT-PCR. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (C) STAT1 protein levels were assessed by Western blot in THP-1 cells treated as in (A,B). Data are presented as mean ± SD.
Figure 6. LDOC1 titration in LINC01270-attenuated THP-1 cells. (A,B) THP-1 cells were co-transfected with siLINC01270 and decreasing concentrations of the LDOC1 overexpression vector (OE) or empty vector (EV), followed by stimulation with 1 µg/mL LPS for 1 h. LDOC1 (A) and STAT1 (B) mRNA levels were analyzed by qRT-PCR. Relative mRNA levels were indicated in comparison to the 0 h scramble, which was set to 1 and the data were normalized using the 2−ΔΔCt method. (C) STAT1 protein levels were assessed by Western blot in THP-1 cells treated as in (A,B). Data are presented as mean ± SD.
Ijms 27 02094 g006
Ijms 27 02094 g007
Figure 7. Proposed model illustrating the regulation of STAT1 signaling by LINC01270 via the miR-326/LDOC1 axis. LINC01270 functions as a ceRNA by sequestering miR-326, thereby preventing miR-326 from binding to the 3′UTR of LDOC1 mRNA. This inhibition relieves miR-326–mediated repression of LDOC1, leading to increased LDOC1 expression. Altered LDOC1 protein levels subsequently modulate STAT1 signaling activity. Depending on the relative stoichiometry between LDOC1 and its interacting downstream effector(s), the transcription of STAT1 and its target genes may be either enhanced or suppressed. Blocked black arrows indicate inhibition, whereas pointed black arrows indicate activation. Green upward arrows denote increased RNA levels, and red downward arrow indicates reduced RNA–RNA interactions.
Figure 7. Proposed model illustrating the regulation of STAT1 signaling by LINC01270 via the miR-326/LDOC1 axis. LINC01270 functions as a ceRNA by sequestering miR-326, thereby preventing miR-326 from binding to the 3′UTR of LDOC1 mRNA. This inhibition relieves miR-326–mediated repression of LDOC1, leading to increased LDOC1 expression. Altered LDOC1 protein levels subsequently modulate STAT1 signaling activity. Depending on the relative stoichiometry between LDOC1 and its interacting downstream effector(s), the transcription of STAT1 and its target genes may be either enhanced or suppressed. Blocked black arrows indicate inhibition, whereas pointed black arrows indicate activation. Green upward arrows denote increased RNA levels, and red downward arrow indicates reduced RNA–RNA interactions.
Ijms 27 02094 g007
Table 1. The list of siRNAs anddecoy RNA. 
Table 1. The list of siRNAs anddecoy RNA. 
Name Sequence (5′ → 3′)
LINC01270 siRNA 1Sense
Antisense		GGGUCACAUAGCGAGAGUUAU
AUAACUCUCGCUAUGUGACCC
LINC01270 siRNA 2Sense
Antisense		GGUCACAUAGCGAGAGUUAUU
AAUAACUCUCGCUAUGUGACC
Decoy fragment UUCCCAGAGAA
Table 2. The list of qPCR primers. 
Table 2. The list of qPCR primers. 
NameSequence (5′ → 3′)
β-ACTINForward
Reverse		TGA GAT GCG TTG TTA CAG GAA GTC
GAC TGG GCC ATT CTC CTT AGA GA
LINC01270Forward
Reverse		CGACGCTGTCTCAGACTCTC
GTGCTGCAGCTCTATAGGACA
LDOC1Forward
Reverse		GAA CCG ATT CTG CAA CGA CG
ACT GTT TCA TCT CAT CGA GGA
STAT1Forward
Reverse		GCTCGTTTGTGGAAAGAC
TCACAGTGAACTGGACCT
CXCL10Forward
Reverse		GAAATTATTCCTGCAAGCCAA
CAGACATCTCTTACCCTTCT
CCL5Forward
Reverse		GCTGTCATCCTCATTGCTACTG
TGGTGTAGAAATACTCCTTGATGT
Table 3. Primary antibodies used for the Western blots. 
Table 3. Primary antibodies used for the Western blots. 
Antibody NameCompanyDilution
β-Actin Santa Cruz Biotechnology1:1000
STAT1Cell Signaling1:1000
Phosphor-STAT1 (Y701)Cell Signaling1:1000
GAPDHCell Signaling1:1000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Arab, I.; Lim, Y.J.; Lim, S.-G.; Suk, K.; Choi, D.K.; Lee, W.-H. A Novel Role of the LINC01270/miR-326/LDOC1 Axis in Proinflammatory Response Regulation via STAT1 Modulation in THP-1 Cells. Int. J. Mol. Sci. 2026, 27, 2094. https://doi.org/10.3390/ijms27052094

AMA Style

Arab I, Lim YJ, Lim S-G, Suk K, Choi DK, Lee W-H. A Novel Role of the LINC01270/miR-326/LDOC1 Axis in Proinflammatory Response Regulation via STAT1 Modulation in THP-1 Cells. International Journal of Molecular Sciences. 2026; 27(5):2094. https://doi.org/10.3390/ijms27052094

Chicago/Turabian Style

Arab, Imene, Young Jae Lim, Su-Geun Lim, Kyoungho Suk, Dong Kyu Choi, and Won-Ha Lee. 2026. "A Novel Role of the LINC01270/miR-326/LDOC1 Axis in Proinflammatory Response Regulation via STAT1 Modulation in THP-1 Cells" International Journal of Molecular Sciences 27, no. 5: 2094. https://doi.org/10.3390/ijms27052094

APA Style

Arab, I., Lim, Y. J., Lim, S.-G., Suk, K., Choi, D. K., & Lee, W.-H. (2026). A Novel Role of the LINC01270/miR-326/LDOC1 Axis in Proinflammatory Response Regulation via STAT1 Modulation in THP-1 Cells. International Journal of Molecular Sciences, 27(5), 2094. https://doi.org/10.3390/ijms27052094

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop