Next Article in Journal
Analysis of Consensus Molecular Subtypes of Colorectal Cancer in Oman with Clinicopathologic Correlation
Next Article in Special Issue
Structural Remodeling and Enzymatic Replacement Shape the Evolution of Organellar Group II Introns in Ulva
Previous Article in Journal
Baseline β-Cell Secretory Reserve and Its Association with Glycaemic Control and Long-Term Outcomes Across Diabetes Phenotypes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 4
10.3390/ijms27042034
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Impact of Mitochondrial DNA Depletion on Mitochondrial Ultrastructure, Photosynthesis, and the mTERF Gene Family in Chlamydomonas reinhardtii

by
Asadullah Khan
1,2,
Ye Ziyi
1,
Faiz Ur Rahman
3,
Haolin Luo
1 and
Zhangli Hu
1,4,*
1
Guangdong Technology Research Center for Marine Algal Bioengineering, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518055, China
2
College of Physics and Optoelectronic Engineering, Shenzhen University, Shenzhen 518060, China
3
Guangdong Provincial Key Laboratory of Postharvest Science of Fruits and Vegetables Engineering Research Center for Postharvest Technology of Horticultural Crops in South China, Ministry of Education, College of Horticulture, South China Agricultural University, Guangzhou 510642, China
4
Guangdong Provincial Key Laboratory of Functional Substances in Medicinal Resources and Healthcare Products, School of Life Sciences and Food Engineering, Hanshan Normal University, Chaozhou 521041, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2026, 27(4), 2034; https://doi.org/10.3390/ijms27042034
Submission received: 21 January 2026 / Revised: 15 February 2026 / Accepted: 17 February 2026 / Published: 21 February 2026
(This article belongs to the Special Issue Evolutionary Drivers and Adaptive Mechanisms in Algal Organellar Genomes)
Browse Figures
Versions Notes

Abstract

Mitochondrial biogenesis requires coordinated expression from both nuclear and mitochondrial genomes. To understand the consequences of mitochondrial genome loss, we generated a mitochondrial DNA-depleted line (crm−) in Chlamydomonas reinhardtii via long-term ethidium bromide treatment. We then examined how mtDNA disruption affects mitochondrial ultrastructure, chloroplast function, and the mitochondrial transcription termination factor (mTERF) gene family. Our results reveal that mitochondrial dysfunction is associated with severe organelle remodeling, including mitochondrial elongation, matrix condensation, and cristae collapse. Consequently, mitochondria reduce the electron sink capacity which appears to over-reduce the chloroplast electron transport chain, correlating with causing damage to photosystem II (PSII), as indicated by higher plastoquinone PQ redox state and PSII excitation pressure and lower non-photochemical quantum yield [Y(NPQ)]. Furthermore, we identified and characterized eight nuclear-encoded mTERF genes in C. reinhardtii (CrmTERFs). Phylogenetic analysis grouped them into three clades with potential functional conservation. Collinearity analysis suggested potential evolutionary relationships between mTERF genes in Chlamydomonas and Marchantia polymorpha. Gene ontology annotation linked CrmTERFs to transcription termination and RNA biosynthesis regulation. Additionally, in silico prediction identified twelve putative miRNAs targeting seven of the eight CrmTERFs, with CrmTERF3 as the only exception, providing candidates for future experimental validation. This study provides the first comprehensive analysis of the nuclear encoded mTERF gene family in Chlamydomonas and demonstrates that mtDNA loss is correlated with mTERF genes expression, as well as mitochondrial structure and chloroplast photoprotective impairments. These findings suggest a potential role for CrmTERFs in mitochondrial retrograde signaling and organellar crosstalk, though functional validation is required to establish causality.

1. Introduction

In eukaryotic cells, genetic information is shared between the nucleus and organellar genomes such as chloroplasts and mitochondria. However, with the passage of time, most organellar genomes have become shorter over time, mainly through gene loss during their evolution from their bacterial ancestors or mass transfer of genetic material to the nuclear genome [1,2,3]. Consequently, only a limited number of genes associated with electron transport chains, photosynthesis and respiration persist in organellar genomes and the expression of the remaining organellar functions, largely dependent on nucleus-encoded proteins [4,5]. Among these are the mitochondrial transcription termination factor (mTERF), a family characterized by a conserved mTERF motif, encoded by a nuclear gene [6]. This protein functions in mitochondria and is known to regulate mitochondrial gene expression by binding nucleic acids to carry out replication, transcription, and translation.
The mTERF gene family, characterized by a unique and conserved protein motif of approximately 30–32 amino acids that often includes three leucine zipper-like structures, is central to organellar gene regulation [7,8]. Initially identified in humans (Homo sapiens), where mTERF1 was shown to bind a specific 28-nucleotide sequence to terminate transcription of the mitochondrial 16S rRNA gene, research has since revealed a family of proteins with diverse and critical functions [9,10]. A previous study suggested that mTERF proteins may play multiple roles in intracellular regulation. In metazoans, the knockout of mTERF2 [11] and tissue-specific inactivation of mTERF3 [12] in mice resulted in severe mitochondrial abnormalities arising from aberrant transcription of the organellar genome, potentially at the stage of transcription initiation. However, plant mTERFs have been implicated in a wide array of processes, from organellar transcription and RNA processing to plant groCKh and stress responses. For instance, in Arabidopsis, the loss of mTERF5 alters Abscisic Acid (ABA) sensitivity and salt tolerance, while the mitochondrial mTERF18 is crucial for heat tolerance [13,14]. The SLmTERF13 gene was reported to regulate the abiotic stress response in tomato [15]. Differential expression patterns were observed in the grape mTERF gene in response to various biotic stressors and phytohormone treatments [16]. In addition to mammals and higher plants, a nuclear mTERF-like gene of Chlamydomonas reinhardtii (MOC1) has been identified, which contributes to the regulation of mitochondrial transcription in response to light variations [17].
The importance of mTERF genes in various species and their functions in controlling mitochondrial gene expression have drawn a lot of interest. [18]. Bioinformatic analysis have revealed that plants and metazoan share a huge and complicated family of mTERF genes [19]. There are at least 35 mTERFs identified in Arabidopsis thaliana [14], capsicum (Capsicum annuum L.) [20], 31 potential mTERF genes in maize (Zea mays L.) [21], 25 mTERF genes in grape [16] and 28 mTERF [15] genes in the tomato genome. Clearly, these studies have demonstrated the importance of the identification of genome-wide mTERF genes to study their role in plant groCKh and stress response.
A commonly used approach to study the nuclear response to impaired mitochondrial function is the use of ρ0 (rho0) cell lines. These cells are depleted of mitochondrial DNA (mtDNA) through long-term treatment with low, non-lethal concentrations of ethidium bromide (EthBr). For instance, Affymetrix technology was employed to study profile changes in nuclear gene expression of Nawalma cells resulting from the absence of mtDNA [22]. Similarly, radioactive microarrays were employed to compare the transcriptome of a human breast cancer cell line and its ρ0 derivative [23]. More recently, mtDNA-depleted cells (crm− cells) in Chlamydomonas were used to study the comparison of retrograde signaling with Antimycin A-inhibited cells [24]. This approach can be used to investigate the nuclear mTERF genes’ response to the impairment of mitochondrial function, as well as their impact on mitochondria and chloroplast.
This study directly investigates the effects of Ethidium Bromide (EB)-induced mitochondrial DNA (mtDNA) depletion on three interconnected levels in Chlamydomonas: organelle structure, cellular physiology, and nuclear gene regulation. We hypothesize that the loss of mtDNA will initiate a cascading failure that (1) severely disrupts mitochondrial ultrastructure (e.g., cristae integrity), which in turn (2) impairs chloroplast photoprotection and compromises photosynthetic efficiency due to a breakdown in inter-organellar energy and signaling homeostasis. Furthermore, given their primary role in mitochondrial gene expression, we hypothesize that (3) the nuclear-encoded mTERF gene family will undergo significant transcriptional and/or post-transcriptional reprogramming in response to the loss of its functional target, since they play primary roles in regulating mitochondrial transcription, replication, and translation. We predict this response will not be a simple, uniform downregulation but a selective adaptation, potentially indicative of a stress-induced re-wiring of organelle-targeted genetic programs, positioning mTERFs as potential regulatory nodes in the retrograde signaling network that maintains mitochondrial–chloroplast energy balance under stress.

2. Results

2.1. EB Treatment to Eliminate mtDNA from Chlamydomonas reinhardtii

The use of ethidium bromide (EB) to generate mtDNA-depleted (ρ0) lines is a long-established methodology in mitochondrial research, having been successfully applied in diverse eukaryotic systems including yeast, mammalian cells, and algae to study the nuclear response to mitochondrial dysfunction [25,26,27,28]. In Chlamydomonas reinhardtii, the specific elimination of mtDNA by intercalating dyes like acriflavine and ethidium bromide has been rigorously characterized, confirming that the primary effect is mtDNA loss without pervasive, nonspecific nuclear toxicity under the employed conditions [25]. While we acknowledge that high concentrations or prolonged exposure to intercalating agents can have off-target effects, our protocol uses a low, non-lethal concentration (6 µM) and a defined treatment period (five days) based on these established models and our previous study [29], where we generated crm− cells depleting mtDNA using three different chemicals, including the treatment of cells with ethidium bromide (EB), dideoxydidehydrocytidine (ddC) and acriflavine (AF). In this study we created crm− cells by treating algae with EB to study the impact of EB on mitochondrial structure, photosynthesis and mTERF gene family. Quantitative PCR confirmed that a five-day treatment with 6 µM EB reduced the mtDNA copy number from approximately 4500 copies in wild-type cells to fewer than 10 copies, representing a >99.9% depletion (Figure 1). Thus, the EB treatment protocol significantly produced cells with near-complete mtDNA loss, enabling the subsequent functional analyses (Figure 1).

2.2. Effect of mtDNA Elimination on Mitochondrial Structure and Ultimately on Photosynthesis

Transmission electron microscopy (TEM) was employed to examine the alterations in the subcellular ultrastructure of EB-treated cells compared with CK (Figure 2). The mitochondria of EB-treated cells or crm− cells seem to have abnormal morphology with elongated size, condensed matrix and collapsed cristae.
In mitochondria, the transfer of electrons from the substrates NADH and succinate is catalyzed by the enzymatic complexes I, II, III, and IV, with molecular oxygen being the final acceptor. The mitochondrial genome comprises seven protein-coding genes of the respiratory chain (nad1, nad2, nad4, nad5, nad6, cob, and cox1) and the partial elimination of mtDNA affects the expression of these genes. These genes belong to Complex I, Complex III and Complex IV of the mitochondrial electron transport chain (mETC). This reduction in mETC activity is predicted to diminish the mitochondrial electron sink capacity, which is known to be critical for preventing the over-reduction of the chloroplast electron transport chain (cETC) under illumination. To confirm whether this disruption in the mitochondrial electron flow directly impacts chloroplast function, we compared photosynthetic parameters of CK and EB-treated cells across a range of measurement irradiances (0–1162 PPFD). In control, the effective photochemical quantum yield of PSII [Y(II)] declined with increasing irradiance and was similar to the trend for EB treatment but lower than CK from 33 to 365 PPFD (Figure 3A). In CK, the regulated non-photochemical quantum yield of PSII [Y(NPQ)] increased with irradiance and showed a similar trend to EB but lower all the way along the irradiance (Figure 3B). The PSII excitation pressure [1-qP; the fraction of closed (reduced) PSII reaction centers], the redox state of the Qa pool and the non-regulated non-photochemical quantum yield of PSII [Y(NO)] showed a similar trend to that seen after treatment; they increased with measurement irradiance as compared to CK, but became closer to CK as it reached 621 PPFD (Figure 3C–E). The light response curve of the photosystem II electron transport rate (ETRII) in the wild type increases up to 200 PPFD with irradiance and then keeps falling until 1162 PPFD; moreover, a similar trend was observed for EB but lower as compared to CK.

2.3. Identification and Characterization of CrmTERF Genes

We identified eight nuclear-encoded CrmTERF genes in C. reinhardtii (Table 1). Protein length varied considerably, from 212 amino acids (CrmTERF7) to 986 amino acids (CrmTERF5), with corresponding molecular weights ranging from 22.7 kDa to 102.5 kDa. Most CrmTERF proteins were acidic (pI 5.28–6.18), except for CrmTERF3, CrmTERF7, and CrmTERF8, which exhibited basic pI values (>9.0). Hydrophilicity analysis indicated predominantly hydrophilic proteins, though CrmTERF3, CrmTERF4, and CrmTERF8 were predicted to be more hydrophobic. The instability index suggested that CrmTERF7 is stable (26.98), whereas CrmTERF3 is likely unstable (58.20). Chromosomal mapping revealed an uneven distribution across the genome, with two genes located on chromosome 12 (CrmTERF3 and CrmTERF4) and the others dispersed on chromosomes 3, 6, 9, 10, 14, and 16. All CrmTERF genes exhibited Ka/Ks ratios below 1, indicating they have primarily undergone purifying selection during evolution.

2.4. Phylogenetic Relation, Gene Structure Analysis and Distributions of Conserved Motifs in CrmTERFs

A phylogenetic tree was constructed to explore the evolutionary relationships among the CrmTERF proteins, which grouped the eight members into four distinct clades (Figure 4A), reflecting sequence divergence and potential functional specialization. Analysis of exon–intron structures revealed considerable diversity among CrmTERF genes (Figure 4B). CrmTERF1, CrmTERF2, and CrmTERF5 contained a higher number of exons, consistent with their longer coding sequences, whereas CrmTERF3, CrmTERF7, and CrmTERF8 exhibited fewer exons, reflecting their shorter gene lengths. Intron numbers and lengths also varied, suggesting structural divergence within the family.
To investigate conserved protein domains, motif composition analysis identified ten conserved motifs across the CrmTERF proteins (Figure 4C). Motif distribution varied notably among members, indicating possible functional diversification. CrmTERF1 and CrmTERF4 displayed the highest motif diversity, containing Motifs 1, 2, 3, and 4 in different arrangements. CrmTERF5 and CrmTERF8 shared a similar motif architecture (Motifs 4, 5, and 10), suggesting functional similarity, while CrmTERF7 contained only Motif 1, implying it may represent a more specialized member. Motifs 1 and 4 were the most widely distributed across the family, suggesting they represent core functional domains. Overall, these structural and motif analyses indicate that CrmTERF proteins share conserved domains essential for their function, while variations in motif composition may underlie functional divergence and specialization.

2.5. Chromosomal Location and 3D Protein Structures

Chromosomal mapping revealed that the eight CrmTERF genes are distributed across seven chromosomes in C. reinhardtii (Figure 5A). CrmTERF3 and CrmTERF4 are both located on chromosome 12, suggesting a possible local duplication event, while the remaining genes are dispersed singly across chromosomes 3, 6, 9, 10, 14, and 16.
Computational 3D structural models were generated to predict the tertiary organization of CrmTERF proteins (Figure 5B). All models exhibited well-folded, α-helix-rich structures, consistent with transcription-associated DNA-binding proteins. Despite variations in protein length, the core folding pattern was conserved. The largest protein, CrmTERF5, displayed an extended conformation with additional helices and loops, potentially indicating extra functional domains. In contrast, CrmTERF6, CrmTERF7, and CrmTERF8 adopted simpler, more compact folds, which may reflect functional specialization. These in silico predictions provide a preliminary structural framework suggesting that CrmTERF proteins are structurally conserved but exhibit variations that could underlie functional diversification.

2.6. Phylogenetics and Collinearity Analysis

Phylogenetic analysis of mTERF proteins from C. reinhardtii and five other species (Marchantia polymorpha, Coccomyxa subellipsoidea, Volvox carteri, Physcomitrella patens, and Arabidopsis thaliana) placed the proteins into three major clades (Figure 6A). The eight CrmTERF genes were distributed across all three clades—five in the green clade, two in the gray clade, and one in the blue clade—indicating both conservation and diversification within the gene family across lineages.
Collinearity analysis revealed extensive syntenic relationships, with the strongest conservation observed between C. reinhardtii and bryophytes (M. polymorpha and P. patens), suggesting shared ancestral mTERF genes (Figure 6B). In contrast, fewer syntenic connections were detected with A. thaliana, highlighting the divergence of the mTERF family in higher plants. These results indicate that while mTERF genes have diversified during evolution, a core set has remained conserved from algae to early land plants.

2.7. Gene Ontology (GO) Annotation and miRNAs Analysis

The GO enrichment analysis primarily linked CrmTERF proteins to DNA-templated transcription termination and regulation of RNA biosynthesis (Figure 7A,B), supporting their predicted role in transcriptional control. In addition, 12 putative miRNAs were identified as targeting seven of the eight CrmTERF genes (Figure 8). CrmTERF5 and CrmTERF6 were each targeted by four miRNAs, indicating particularly tight post-transcriptional regulation. Only CrmTERF3 lacked predicted miRNA targets. Notably, cre-miR1145.1 targeted both CrmTERF1 and CrmTERF5, suggesting potential coordinated regulation of these genes. These miRNA-CrmTERF interactions highlight a layer of potential post-transcriptional control that may fine-tune CrmTERF expression under stress.

2.8. mTERF Genes Expression Patterns After mtDNA Depletion

The transcript levels of mTERF genes in C. reinhardtii after five days of EB treatment were investigated using qRT-PCR. CrmTERF2 showed a significantly lower gene expression while CrmTERF4, CrmTERF7 and CrmTERF8 showed significantly higher gene expression while the expression of CrmTERF1 was lower but not significantlly. CrmTERF3, CrmTERF5 and CrmTERF6 were higher but not significantly (Figure 9).

3. Discussion

Mitochondrial transcription termination factor (mTERF) is a nuclear encoded DNA-binding protein, that typically functions in mitochondria and is implicated in gene expression regulation. EB intercalates into mtDNA and inhibits its replication, leading to a reduced copy number, a well-established method for generating ρ0 (mtDNA-depleted) lines in diverse eukaryotic systems, including Chlamydomonas. It was established that low-concentration EB treatment in Chlamydomonas specifically eliminates mtDNA while chloroplast and nuclear DNA remain intact. This selectivity is attributed to preferential mitochondrial dye accumulation, limited nuclear permeability, and absence of mtDNA repair factors not applicable to chloroplasts under these conditions [25]. Nevertheless, we acknowledge chemical approaches cannot fully exclude off-target effects. To address this, we validated our findings through multi-chemical replication in our previous study [29] where we generated crm− cells using EB, acriflavine, and ddC, all yielding consistent mtDNA depletion and comparable phenotypes. Three chemically distinct compounds producing identical effects strongly supports the conclusion that observed phenotypes arise from mtDNA loss itself rather than non-specific toxicity.
Fewer mtDNA copies are associated with reduced transcription of mitochondrial-encoded genes, which are essential subunits of the Electron Transport Chain (ETC) complexes I, III and IV. Depletion of mtDNA with EB, resulted in impaired mitochondrial function, consistent with the classical ρ0 phenotype observed in yeast, mammalian, and algal models [26,28]. It is hypothesized that the mitochondrion senses this stress and sends signals to the nucleus to alter gene expression, potentially activating specific transcription factors that bind to the promoters of nuclear genes, including mTERF genes. The primary role of mTERF proteins is thought to be the regulation of mitochondrial transcription, replication, and translation. Thus, mtDNA depletion may act as a signal to the nucleus, possibly triggering increased expression of factors like mTERFs to modulate the remaining mtDNA.
Interestingly, we observed a significant four-fold decrease in mTERF3 gene (MOC1) expression in crm− cells compared to the wild-type control. Given that MOC1 is known to terminate mitochondrial transcription in Chlamydomonas [17], its downregulation could represent a compensatory adjustment to the drastically reduced mtDNA template (>99.9% depleted). This pattern is consistent with the concept of mitochondrial retrograde signaling and aligns with reported nuclear transcriptional shifts following mtDNA depletion or ETC inhibition in C. reinhardtii [24]. However, this interpretation remains speculative in the absence of direct evidence for a signaling cascade or controls excluding potential off-target effects of EB. Alternatively, reduced MOC1 might dysregulate the processing of remaining mitochondrial transcripts, potentially exacerbating the molecular phenotype. These observations highlight a correlation rather than a causal relationship. Future studies using genetic mtDNA depletion or complementation are needed to directly test these hypotheses and establish causality.
It is well-studied that the respiratory metabolism in the mitochondrion and the photosynthetic metabolism in the chloroplast interact and play a vital role in the energetic metabolism of photosynthetic organisms [30]. Their activity in photosynthetic eukaryotes is tightly linked, suggesting that the disruption of mitochondrial function might also perturb chloroplast function [31]. Our results support the existence of inter-organellar communication, as a reduction in the mtDNA copy number was correlated with disrupted mitochondrial structure, showing abnormalities such as elongated size, condensed matrix and collapsed cristae, as well as altered photosynthesis. A reduction in the copy number of mtDNA appeared to reduce the electron sink capacity, as indicated by increased chloroplast PQ redox state and elevated PSII excitation pressure [32]. These results suggest that the mETC may serve as an important sink for chloroplast-derived electrons during photosynthesis, aligning with studies in plants that identified the mitochondrion as an important sink for photo-generated reductants [33]. Y(NPQ) and Y(II) remained low following EB treatment despite having similar higher excitation pressure which is similar to Antimycin A inhibitor but distinct from Myxothiazol inhibition. This implies that EB might also affect the chloroplast electron transport chain as observed previously [30]. Y(NO) denotes the proportion of energy in PSII that is dissipated passively as heat and fluorescence. An elevation in Y(NO) indicates an excess of excitation energy in the PSII reaction center resulting from inadequate energy dissipation through alternative pathways [Y(II), Y(NPQ)], which are significantly lower in EB and hence could be linked to PSII damage [34]. Collectively, these observations support the model that the function of the mitochondrion, showing the capacity to act as an electron sink, is critical in supporting cETC activity and may help avoid PSII damage.
In this study, we also explored the Chlamydomonas reinhardtii genome to identify mTERF genes, and eight potential mTERF genes were identified in the green algae Chlamydomonas reinhardtii. Comparative analysis revealed that land plant species such as Arabidopsis, capsicum, maize, grape, and tomato possess a larger number of mTERF genes (25–35), suggesting gene family expansion during plant evolution.
Structural analysis of the exon and intron borders of the CrmTERF genes provides insight into their evolution. Unlike mTERFs has no intron in higher plants like grape (Vitis vinifera L.), capsicum (Capsicum annuum L.), maize (Zea mays L.) [16,20,21], implying evolution via retrotransposition, while Chlamydomonas has introns in all mTERF genes. In C. reinhardtii, introns may contain regulatory elements influencing transcript stability, nucleo–cytoplasmic export, and alternative splicing, potentially enabling functional diversification. Despite the variations in exon/intron numbers, most genes showed a conserved arrangement, suggesting evolutionary conservation within the family. Interestingly, closely related gene pairs identified in the phylogenetic tree (e.g., CrmTERF1/CrmTERF6 and CrmTERF2/CrmTERF4) exhibited partially similar exon–intron organizations, supporting their evolutionary relatedness. However, distinct intron/exon patterns in other members (e.g., CrmTERF5 vs. CrmTERF3) highlight structural divergence that may contribute to functional diversification.
The phylogenetic tree and collinearity analysis was performed among Chlamydomonas reinhardtii, Volvox carteri, Marchantia polymorpha, Physcomitrella patens and Arabidopsis thaliana. The CrmTERFs were distributed across all major clades, with some clustering alongside bryophyte and algal proteins, while others grouped more closely with higher plant sequences, signifying, as suggested by previous work, that genes existing in the same group could exhibit the same functions [35]. This pattern indicates that while nuclear-encoded mTERF gene family has diversified significantly during evolution, certain lineages have maintained strong conservation from algae through to land plants. The collinearity network demonstrates that the mTERF family in C. reinhardtii conserved syntenic relationships with bryophytes, while showing partial divergence from higher plants. This suggests that while functional diversification occurred during plant evolution, a conserved ancestral core of mTERFs persists across algae and early land plants, reflecting their essential role in organelle transcriptional regulation.
In our study, 12 putative miRNAs pointing to the CrmTERF genes except mTERF3 were found. The roles of some of these miRNAs were reported in the past and implicated in other processes. miR1145.1 targeting mTERF1 and mTERF5 has been linked to carotenoid synthesis in Dunaliella salina [36], cre-miR1147.1 is involved in proteolysis and peptidase regulation, while cre-miR1156.2 is associated with amino acid metabolism [37]. These miRNA-mTERF interactions suggest potential post-transcriptional regulatory layers that could be explored in future reverse genetics studies.
GO annotation analysis associated CrmTERFs with DNA-templated transcription termination of RNA biosynthesis regulation and transcriptional regulation. Functional associations have been reported in other systems; the knockout of mTERF2 [11] and tissue-specific inactivation of mTERF3 [12] in mice led to aberrant mitochondrial transcription and severe phenotypes [14]. Additionally, the Drosophila mTERF homolog DmTTF is responsible for transcription termination [38]. Together, these results support the hypothesis that CrmTERF genes may play a role in transcription termination and regulation. Most of the mTERF genes show higher gene expression, which could reflect a compensatory mechanism to enhance the transcription and replication efficiency of the few remaining mtDNA copies. However, these expression changes remain correlative, and functional studies are needed to confirm their regulatory roles.

4. Materials and Methods

4.1. Microalgae Strains, GroCKh Conditions and EB Treatment

The experiments used Chlamydomonas reinhardtii strain CC-124 (wild-type, mt−, background 137c) obtained from our laboratory algal repository. Cultures were maintained in laboratory-scale photobioreactors (PBRs) under continuous shaking (120 rpm) with aeration and ambient CO2 concentration (~0.04%). Standard growth conditions were 25 °C in Tris-acetate-phosphate (TAP) medium under constant illumination (100 µmol photons m−2 s−1, 50% red:50% blue; Philips Amsterdam, NL, USA), cultivating the algae mixotrophically.
To initiate the EB treatment, cells were first grown to the stationary phase (~5 × 106 cells mL−1), then diluted to 3 × 105 cells mL−1 in 300 mL of fresh TAP medium supplemented with 6 µM ethidium bromide (EB). Cultures were incubated mixotrophically with continuous shaking (120 rpm) for up to 5 days. Samples were harvested in triplicate after this period, and mtDNA depletion was confirmed by quantifying the copy number using quantitative PCR (qPCR). Control cultures were treated identically but without the addition of EB.

4.2. Analysis of Mitochondrial DNA (mtDNA) Copy Number

Genomic DNA extraction was performed by using a Genomic DNA Kit (Transgen, Beijing, China, EE101). Sample quality was assessed through a device named the NanoDrop2000 Ultra spectrophotometer to set a unified concentration of 50 ng/µL in order to perform qPCR. The detailed method for the analysis of the mtDNA copy number has been described previously [39]. Briefly, to estimate the number of mitochondrial DNA (mtDNA) copies per cell, we compared the DNA from mitochondria to the DNA from the cell’s nucleus. We used a specific, stable gene from each location: the rrnL6 gene (for mtDNA) and the CLPD24 gene (for nuclear DNA). The difference in their detection cycles (∆Ct) allows us to calculate the relative amount. The number of mtDNA copies per cell was calculated as 2 × 2(∆Ct), where ∆Ct = Ct(CLPD24) − Ct(rrnL6).

4.3. Transmission Electron Microscopy

Samples for transmission electron microscopy (TEM) were prepared using a standard chemical fixation protocol. Cells were initially fixed in 2.5% (v/v) glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) overnight (~12 h) at room temperature. After three buffer washes, samples were post-fixed in 1% (w/v) osmium tetroxide in the same buffer for 4 h at 4 °C. Following dehydration through a graded ethanol series (30%, 50%, 70%, 85%, 95%, and 100%; 15 min per step), the specimens were stained en bloc with 2% uranyl acetate in 50% ethanol for 1 h. Dehydration was completed with two changes in anhydrous ethanol and two changes in propylene oxide (15 min each). Samples were then infiltrated and embedded in Epon 812 resin (Electron Microscopy Sciences, Fort Washington, PA, USA). Ultrathin sections (70–90 nm) were collected on copper grids and post-stained with lead citrate for 5 min. Sections were examined using a Hitachi HT 7800 transmission electron microscope operated at 80 kV, and images were acquired with a CMOS camera in high-contrast (HC) mode at magnifications of 3000×, 4000×, and 8000×.

4.4. Analysis of Photosynthetic Parameters

For all fluorescence measurements, three biological replicates were taken. We used a PAM2500 device (Heinz Walz GmbH, Effeltrich, Germany) to measure photosynthetic parameters. Measurements were conducted using 2 mL,15 min dark-adapted cells at mid-log phase (containing 20 μg Chl) at room temperature (25 °C). For the construction of rapid light curves (RLCs), eight incrementally increasing actinic light (wavelength of 630 nm) intensities (0, 2, 4, 6, 8, 10, 12, 14) with PAR range (0, 33, 66, 200, 365, 621, 983, 1162 µmol m−2 s−1) were set in a light-curve edit. This actinic light was provided continuously without dark interval for 10 s each and followed by a saturation pulse. Chlorophyll a fluorescence was utilized to investigate photochemical and non-photochemical processes. Photochemical energy quenching (qP), also known as excitation pressure, is calculated as 1-qP and redox state of Qa pool as (1-qL). The electron transport rate (ETR), effective PSII quantum yield [Y(II)], the quantum yield of regulated thermal energy dissipation [Y(NPQ)], and the quantum yield of non-regulated thermal energy dissipation [Y(NO)] were also evaluated.

4.5. Identification of Nuclear Encoded mTERF Gene Family in C. reinhardtii

Protein data for C. reinhardtii at the whole-genome level were obtained from the Phytozome database (http://phytozome.jgi.doe.gov/pz/portal.html, accessed on 15 August 2024) [40]. The Arabidopsis genome database (https://www.arabidopsis.org/, accessed on 15 August 2024) supplied the protein sequences of the mTERF family from Arabidopsis thaliana, which were utilized as query sequences for alignment with C. reinhardtii protein files. The Pfam ID of mTERF (PF02536) was acquired by visiting the Pfam website (http://pfam.janelia.org/; visited on 15 August 2024). The mTERF.hmm file, containing the conserved domain information of the mTERF family, was retrieved from the Pfam website. Protein sequences of C. reinhardtii, mTERF.hmm, and the Pfam ID of mTERF (PF02536) were utilized in a straightforward HMM search using TBtools (v1.068) to identify the proteins containing a mTERF domain, resulting in the detection of 9 proteins having a mTERF domain. Initially, the data was filtered using an e-value threshold of <1 × 10−5, after which we manually eliminated the redundant sequences. The mTERF structural domain was predicted within the amino acid sequence of the chosen mTERF protein family member in C. reinhardtii utilizing the Conserved Domain Database (CDD, http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi; accessed on 15 August 2024) from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/, accessed on 15 August 2024). The candidate genes lacking the mTERF structural domain were eliminated. Consequently, eight potential CrmTERF genes were found in C. reinhardtii.
The physicochemical properties of the mTERF protein from C. reinhardtii, including molecular weight, protein length, instability index, theoretical pI, and hydrophilicity, were obtained using the online tool ExPASY-Prot (https://web.expasy.org/protparam/; accessed on 15 August 2024) [41]. The Ks_Ka calculator (https://sourceforge.net/projects/kakscalculator2/; accessed on 15 August 2024) was used to calculate Ka/Ks ratios of each CrmTERF gene. The protein sequences of the eight mTERF proteins were analyzed using the default parameters of the web program MEME v5.4.1 (https://meme-suite.org/meme/tools/glam2scan; accessed on 15 August 2024) to identify conserved areas [42]. The application employed the following settings: the sequencing of alphabet DNA, RNA, or protein; site distribution limited to zero or one occurrence per sequence (zoops); the motif-finding mode set to classic mode; and 10 motifs.

4.6. mTERF Gene Structure and Chromosomal Distribution

The chromosomal locations and protein sequences of all mTERF genes in C. reinhardtii were obtained by using the internet database Phytozome (http://phytozome.jgi.doe.gov/pz/portal.html, viewed on 15 August 2024) [40]. We assessed the distribution of mTERF genes throughout the chromosomes via an online software called MapGene2 Chromosome V2.1 (http://mg2c.iask.in/mg2c_v2.1/index.html; accessed on 15 August 2024) [43] by submitting the gene ID, the start position of the gene, the end position of the gene, and the chromosome ID of the gene in one box, and chromosome ID and the chromosome sequence length in other box. We used the kb scale and blue color for the chromosome, while red color was used for the gene ID, gene line and connecting wire. This is how we discovered the mTERF genes’ position on the chromosomes of C. reinhardtii.
The mTERF gene structure diagram was constructed utilizing the web program GSDS V2.0 (https://gsds.gao-lab.org/; accessed on 15 August 2024) [44] by submitting CDS and genomic sequences followed by quantitative analysis of introns and exons.

4.7. Phylogenetic and Collinearity Analysis

The protein sequences of mTERF genes from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) were utilized for phylogenetic analysis, and the evolutionary relation of the C. reinhardtii mTERF gene family to other species was displayed. ClustalW 2.0 software was used to conduct multiple alignments of the mTERF protein sequences and the phylogenetic tree was built with MEGA 7.0 software [45] using the neighbor-joining (NJ) method with 1000 bootstrap repetitions. The online website iTOL tool (https://itol.embl.de/login.cgi, accessed on 15 August 2024) [46] was used to visualize the phylogenetic tree by using these settings: mode = circular, cover = clade, branch length = ignored, inverted tree = no, alignment = left, rotation = on and colors = gray, green and blue.
Comparative collinearity analysis to find the evolutionary relationships and conservation among Chlamydomonas reinhardtii, Coccomyxa subellipsoidea, Volvox carteri, Physcomitrella patens and Arabidopsis thaliana mTERF proteins was conducted by using an online tool named the synteny viewer circoletto tool (https://bat.infspire.org/circoletto/; accessed on 15 August 2024), using the homology thresholds defined by the tool’s default BLAST + 2.17.0 (Basic Local Alignment Search Tool) settings: an E-value cutoff of 10 to the −10 (normal) and a minimum identity percentage of 60%, as indicated by the orange and red color scheme (≤60% and ≤80% identity, respectively) [47].

4.8. Visualization of CrmiRNA’s Predicted Cleavage Sites and GO Enrichment Analysis

CrmiRNAs targeting CrmTERFs were identified using the online website tool psRNATarget Schema V2 (2017 release) (https://www.zhaolab.org/psRNATarget/; accessed on 15 August 2024) [48] using expectation threshold = 5.0; length for complementarity scoring (HSP size) = 19 bp; penalty for G:U pair = 0.5; extra weight in seed region = 1.5; mismatches allowed in seed region (2–13 nt) = 2; penalty for opening gap = 2.0; penalty for extending gap = 0.5; translation inhibition range considered. Hits with a maximum expectation value ≤ 2.0 were considered putative targets for subsequent analysis. Gene structures were designed using an offline tool named TBtools where yellow triangles depict the CrmiRNA probable targeted sites in the exons of CrmTERF genes. An online tool named ShinyGO v 0.80 (http://bioinformatics.sdstate.edu/go/; accessed on 15 August 2024) [49] with FDR cutoff = 0.05, minimum pathway size = 2, redundancy removal enabled, and maximum pathways to display = 20 was used to carry out the GO enrichment analysis of the CrmTERF genes and visually draw the chart to make it clear.

4.9. Extraction and Purification of RNA and RNA Reverse Transcription

Total RNA was extracted from approximately 1 × 107 Chlamydomonas cells (equivalent to ~50 mg fresh weight) per biological replicate using the TIANAMP Genomic RNA Extraction Kit (Tiangen Biotech, Beijing, China). The extraction was performed strictly following the manufacturer’s protocol, which included on-column DNase I digestion to remove genomic DNA contamination. RNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). All RNA samples used for cDNA synthesis exhibited A260/A280 ratios between 1.9 and 2.1 and A260/A230 ratios greater than 2.0, confirming high purity. First-strand cDNA was synthesized [50] from 500 ng of total RNA using the Quantscript RT Kit (Tiangen Biotech, Beijing, China) in a 20 µL reaction volume. The reverse transcription protocol was as follows: genomic DNA removal at 42 °C for 2 min, reverse transcription at 37 °C for 15 min, followed by enzyme inactivation at 85 °C for 3 min. The resulting cDNA was diluted 1:5 with nuclease-free water and stored at −20 °C until use for qPCR analysis.

4.10. Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

cDNA obtained in the last step was used in real-time PCR analyses using the Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories Inc., Hercules, CA, USA) on an [Applied Biosystems ViiA 7 Real-Time PCR System]. Reactions were assembled in a 10 µL volume containing 5 µL of SYBER Green, 1 µL of forward and reverse primer each, 1.5 µL of diluted cDNA template, and 2.5 µL of nuclease-free water. Thermocycling was performed as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min (combined annealing/extension). The PCR primer sets used to include the housekeeping gene RACK1 are shown in Table 2 and were designed from the published database, BLAST. Comparative gene expression analysis using qRT-PCR was performed according to previously described methods [51] and the calculated relative expression with 2(−ΔΔCt) formula, with three biological replicates.

4.11. Statistical Analysis

All data are presented as the mean ± standard deviation (SD) from three independent biological replicates (n = 3). For comparisons between two independent groups, including the qPCR results for mtDNA copy number and gene expression comparisons, the data were checked for normality using the Shapiro–Wilk test and for homogeneity of variance using the F-test. The Shapiro–Wilk test was used to assess whether the data followed a normal distribution, with p-values greater than 0.05 indicating that the data did not deviate significantly from normality. To test the assumption of equal variances, an F-test was performed for each gene comparing the variances of the control and treatment, as automatically provided by GraphPad Prism v10 when running an unpaired t-test with the assumption of equal standard deviations. For data that satisfied both normality and equal variance assumptions, Student’s t-test (assuming equal variances) was used to compare treatment groups. In cases where normality was satisfied but variances were unequal, Welch’s t-test (not assuming equal variances) was applied.
Chlorophyll fluorescence parameters [Y(II), Y(NPQ), 1-qP, 1-qL, Y(NO), and ETR] are bounded ratios (0–1 scale for quantum yields, and 0 to a theoretical maximum for ETR) that do not meet the assumptions of parametric tests. Therefore, comparisons between control and treatment at each PPFD level were performed using the two-tailed Mann–Whitney U test. Statistical significance levels are denoted as * p < 0.05 with exact p-values reported in the figure legends.

5. Conclusions

The experimental results of this study correlate with our central hypotheses. We observed that mtDNA depletion is associated with severe mitochondrial ultrastructural defects and is associated with significant impairment of chloroplast photoprotection, supporting a functional link between these organelles. Furthermore, we present the first genomic inventory of the mTERF family in green algae, identifying eight CrmTERF genes and documenting their altered expression under mitochondrial stress. Based on these findings, we propose a model in which the nucleus may orchestrate adaptive responses and the CrmTERF family acts as a potential mediator in retrograde signaling and organellar crosstalk. This model provides a testable hypothesis and a foundation for future functional validation to establish causal mechanisms.

Author Contributions

Z.H. and A.K. conceptualized the initial study; A.K. was involved in the experimental layout; A.K. and H.L. performed the laboratory experiments; F.U.R. helped with bioinformatics analyses; A.K. drafted the initial article; Z.H., A.K., Y.Z. and F.U.R. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32273118), Guangxi Major Program for Science and Technology (GuikeAA24263042), the Chinese National Key R&D Project for Synthetic Biology (2018YFA0902500), the Guangdong Key R&D Project (2022B1111070005), the Shenzhen Special Fund for Sustainable Development (KCXFZ20211020164013021), and the Shenzhen University 2035 Program for Excellent Research (2022B010) to Zhangli Hu.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kleine, T.; Voigt, C.; Leister, D. Plastid signalling to the nucleus: Messengers still lost in the mists? Trends Genet. 2009, 25, 185–192. [Google Scholar] [CrossRef] [PubMed]
  2. Timmis, J.N.; Ayliffe, M.A.; Huang, C.Y.; Martin, W. Endosymbiotic gene transfer: Organelle genomes forge eukaryotic chromosomes. Nat. Rev. Genet. 2004, 5, 123–135. [Google Scholar] [CrossRef] [PubMed]
  3. Martin, W.; Rujan, T.; Richly, E.; Hansen, A.; Cornelsen, S.; Lins, T.; Leister, D.; Stoebe, B.; Hasegawa, M.; Penny, D. Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc. Natl. Acad. Sci. USA 2002, 99, 12246–12251. [Google Scholar] [CrossRef] [PubMed]
  4. Binder, S.; Brennicke, A. Gene expression in plant mitochondria: Transcriptional and post-transcriptional control. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2003, 358, 181–188; discussion 188–189. [Google Scholar] [CrossRef]
  5. Liere, K.; Weihe, A.; Börner, T. The transcription machineries of plant mitochondria and chloroplasts: Composition, function, and regulation. J. Plant Physiol. 2011, 168, 1345–1360. [Google Scholar] [CrossRef]
  6. Roberti, M.; Polosa, P.L.; Bruni, F.; Manzari, C.; Deceglie, S.; Gadaleta, M.N.; Cantatore, P. The MTERF family proteins: Mitochondrial transcription regulators and beyond. Biochim. Biophys. Acta (BBA)—Bioenerg. 2009, 1787, 303–311. [Google Scholar] [CrossRef]
  7. Roberti, M.; Bruni, F.; Polosa, P.L.; Gadaleta, M.N.; Cantatore, P. The Drosophila termination factor DmTTF regulates in vivo mitochondrial transcription. Nucleic Acids Res. 2006, 34, 2109–2116. [Google Scholar] [CrossRef]
  8. Roberti, M.; Bruni, F.; Loguercio Polosa, P.; Manzari, C.; Gadaleta, M.N.; Cantatore, P. MTERF3, the most conserved member of the mTERF-family, is a modular factor involved in mitochondrial protein synthesis. Biochim. Biophys. Acta 2006, 1757, 1199–1206. [Google Scholar] [CrossRef]
  9. Kruse, B.; Narasimhan, N.; Attardi, G. Termination of transcription in human mitochondria: Identification and purification of a DNA binding protein factor that promotes termination. Cell 1989, 58, 391–397. [Google Scholar] [CrossRef]
  10. Fernandez-Silva, P.; Martinez-Azorin, F.; Micol, V.; Attardi, G. The human mitochondrial transcription termination factor (mTERF) is a multizipper protein but binds to DNA as a monomer, with evidence pointing to intramolecular leucine zipper interactions. EMBO J. 1997, 16, 1066–1079. [Google Scholar] [CrossRef]
  11. Huang, W.; Yu, M.; Jiao, Y.; Ma, J.; Ma, M.; Wang, Z.; Wu, H.; Tan, D. Mitochondrial transcription termination factor 2 binds to entire mitochondrial DNA and negatively regulates mitochondrial gene expression. Acta Biochim. Biophys. Sin. 2011, 43, 472–479. [Google Scholar] [CrossRef]
  12. Park, C.B.; Asin-Cayuela, J.; Cámara, Y.; Shi, Y.; Pellegrini, M.; Gaspari, M.; Wibom, R.; Hultenby, K.; Erdjument-Bromage, H.; Tempst, P.; et al. MTERF3 is a negative regulator of mammalian mtDNA transcription. Cell 2007, 130, 273–285. [Google Scholar] [CrossRef] [PubMed]
  13. Robles, P.; Micol, J.L.; Quesada, V. Arabidopsis MDA1, a nuclear-encoded protein, functions in chloroplast development and abiotic stress responses. PLoS ONE 2012, 7, e42924. [Google Scholar] [CrossRef] [PubMed]
  14. Kleine, T. Arabidopsis thaliana mTERF proteins: Evolution and functional classification. Front. Plant Sci. 2012, 3, 233. [Google Scholar] [CrossRef] [PubMed]
  15. Su, A.; Ge, S.; Zhou, B.; Wang, Z.; Zhou, L.; Zhang, Z.; Yan, X.; Wang, Y.; Li, D.; Zhang, H.; et al. Analysis of the Tomato mTERF Gene Family and Study of the Stress Resistance Function of SLmTERF-13. Plants 2023, 12, 2862. [Google Scholar] [CrossRef]
  16. Yin, X.; Gao, Y.; Song, S.; Hassani, D.; Lu, J. Identification, characterization and functional analysis of grape (Vitis vinifera L.) mitochondrial transcription termination factor (mTERF) genes in responding to biotic stress and exogenous phytohormone. BMC Genom. 2021, 22, 136. [Google Scholar] [CrossRef]
  17. Wobbe, L.; Nixon, P.J. The mTERF protein MOC1 terminates mitochondrial DNA transcription in the unicellular green alga Chlamydomonas reinhardtii. Nucleic Acids Res. 2013, 41, 6553–6567. [Google Scholar] [CrossRef]
  18. Quesada, V. The roles of mitochondrial transcription termination factors (MTERFs) in plants. Physiol. Plant 2016, 157, 389–399. [Google Scholar] [CrossRef]
  19. Robles, P.; Micol, J.L.; Quesada, V. Unveiling plant mTERF functions. Mol. Plant 2012, 5, 294–296. [Google Scholar] [CrossRef]
  20. Tang, B.; Xie, L.; Yi, T.; Lv, J.; Yang, H.; Cheng, X.; Liu, F.; Zou, X. Genome-Wide Identification and Characterization of the Mitochondrial Transcription Termination Factors (mTERFs) in Capsicum annuum L. Int. J. Mol. Sci. 2019, 21, 269. [Google Scholar] [CrossRef]
  21. Zhao, Y.; Cai, M.; Zhang, X.; Li, Y.; Zhang, J.; Zhao, H.; Kong, F.; Zheng, Y.; Qiu, F. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize. PLoS ONE 2014, 9, e94126. [Google Scholar] [CrossRef]
  22. Xie, N.; Xiao, C.; Shu, Q.; Cheng, B.; Wang, Z.; Xue, R.; Wen, Z.; Wang, J.; Shi, H.; Fan, D.; et al. Cell response to mechanical microenvironment cues via Rho signaling: From mechanobiology to mechanomedicine. Acta Biomater. 2023, 159, 1–20. [Google Scholar] [CrossRef] [PubMed]
  23. Delsite, R.; Kachhap, S.; Anbazhagan, R.; Gabrielson, E.; Singh, K.K. Nuclear genes involved in mitochondria-to-nucleus communication in breast cancer cells. Mol. Cancer 2002, 1, 6. [Google Scholar] [CrossRef] [PubMed]
  24. Khan, A.; Luo, H.; Jihong, Z.; Raza, A.; Hu, Z. Mitochondria-mediated retrograde responses evoked by inhibitor antimycin A and mtDNA elimination in Chlamydomonas reinhardtii. Int. J. Biol. Macromol. 2025, 318, 144690. [Google Scholar] [CrossRef] [PubMed]
  25. Gillham, N.W.; Boynton, J.E.; Harris, E.H. Specific elimination of mitochondrial DNA from Chlamydomonas by intercalating dyes. Curr. Genet. 1987, 12, 41–47. [Google Scholar] [CrossRef]
  26. Khozhukhar, N.; Spadafora, D.; Rodriguez, Y.; Alexeyev, M. Elimination of mitochondrial DNA from mammalian cells. Curr. Protoc. Cell Biol. 2018, 78, 20.11.1–20.11.14. [Google Scholar] [CrossRef]
  27. Matagne, R.-F.; Michel-Wolwertz, M.R.; Munaut, C.; Duyckaerts, C.; Sluse, F. Induction and characterization of mitochondrial DNA mutants in Chlamydomonas reinhardtii. J. Cell Biol. 1989, 108, 1221–1226. [Google Scholar] [CrossRef]
  28. Rasmussen, A.K.; Chatterjee, A.; Rasmussen, L.J.; Singh, K.K. Mitochondria-mediated nuclear mutator phenotype in Saccharomyces cerevisiae. Nucleic Acids Res. 2003, 31, 3909–3917. [Google Scholar] [CrossRef]
  29. Khan, A.; Jihong, Z.; Luo, H.; Raza, A.; Hussain, Q.; Hu, Z. Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii. Processes 2024, 12, 1654. [Google Scholar] [CrossRef]
  30. Alber, N.A.; Vanlerberghe, G.C. The flexibility of metabolic interactions between chloroplasts and mitochondria in Nicotiana tabacum leaf. Plant J. 2021, 106, 1625–1646. [Google Scholar] [CrossRef]
  31. Alber, N.A.; Vanlerberghe, G.C. Signaling interactions between mitochondria and chloroplasts in Nicotiana tabacum leaf. Physiol. Plant 2019, 167, 188–204. [Google Scholar] [CrossRef]
  32. Shameer, S.; Ratcliffe, R.G.; Sweetlove, L.J. Leaf Energy Balance Requires Mitochondrial Respiration and Export of Chloroplast NADPH in the Light. Plant Physiol. 2019, 180, 1947–1961. [Google Scholar] [CrossRef]
  33. Shimakawa, G.; Miyake, C. Oxidation of P700 Ensures Robust Photosynthesis. Front. Plant Sci. 2018, 9, 1617. [Google Scholar] [CrossRef] [PubMed]
  34. Huang, W.; Zhang, S.B.; Cao, K.F. Stimulation of cyclic electron flow during recovery after chilling-induced photoinhibition of PSII. Plant Cell Physiol. 2010, 51, 1922–1928. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, C.; Wright, B.; Allen-Vercoe, E.; Gu, H.; Beiko, R. Phylogenetic Clustering of Genes Reveals Shared Evolutionary Trajectories and Putative Gene Functions. Genome Biol. Evol. 2018, 10, 2255–2265. [Google Scholar] [CrossRef] [PubMed]
  36. Sharma, Y.; Yadav, R.; Sharma, H.; Singh, C.P. Identification of microRNAs in Dunaliella salina and their potential role in carotenogenesis under salinity stress. Biologia 2025, 80, 2611–2625. [Google Scholar] [CrossRef]
  37. Li, C.; Zhu, R.; Chen, Z.; Du, M.; Liu, Y.; Liu, C.; Jiang, P.; Luo, Y.; Lei, A.; Liu, Q.; et al. Extracellular vesicles in Chlamydomonas reinhardtii: Mediators of nutrient sensing and cell-to-cell communication. Algal Res. 2025, 85, 103853. [Google Scholar] [CrossRef]
  38. Roberti, M.; Fernandez-Silva, P.; Polosa, P.L.; Fernandez-Vizarra, E.; Bruni, F.; Deceglie, S.; Montoya, J.; Gadaleta, M.N.; Cantatore, P. In vitro transcription termination activity of the Drosophila mitochondrial DNA-binding protein DmTTF. Biochem. Biophys. Res. Commun. 2005, 331, 357–362. [Google Scholar] [CrossRef]
  39. Quiros, P.M.; Goyal, A.; Jha, P.; Auwerx, J. Analysis of mtDNA/nDNA Ratio in Mice. Curr. Protoc. Mouse Biol. 2017, 7, 47–54. [Google Scholar] [CrossRef]
  40. Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; et al. Phytozome: A comparative platform for green plant genomics. Nucleic Acids Res. 2011, 40, D1178–D1186. [Google Scholar] [CrossRef]
  41. Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef] [PubMed]
  42. Bailey, T.L.; Williams, N.; Misleh, C.; Li, W.W. MEME: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef] [PubMed]
  43. Chao, J.; Li, Z.; Sun, Y.; Aluko, O.O.; Wu, X.; Wang, Q.; Liu, G. MG2C: A user-friendly online tool for drawing genetic maps. Mol. Hortic. 2021, 1, 16. [Google Scholar] [CrossRef] [PubMed]
  44. Hu, B.; Jin, J.; Guo, A.-Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An upgraded gene feature visualization server. Bioinformatics 2014, 31, 1296–1297. [Google Scholar] [CrossRef]
  45. Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9, 299–306. [Google Scholar] [CrossRef]
  46. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL): An online tool for phylogenetic tree display and annotation. Bioinformatics 2006, 23, 127–128. [Google Scholar] [CrossRef]
  47. Darzentas, N. Circoletto: Visualizing sequence similarity with Circos. Bioinformatics 2010, 26, 2620–2621. [Google Scholar] [CrossRef]
  48. Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef]
  49. Ge, S.X.; Jung, D.; Yao, R. ShinyGO: A graphical gene-set enrichment tool for animals and plants. Bioinformatics 2020, 36, 2628–2629. [Google Scholar] [CrossRef]
  50. Chai, T.; Chen, Q.; Zhang, Y.; Dong, J.; An, C. Cadmium resistance in transgenic tobacco plants enhanced by expressing bean heavy metal-responsive gene PvSR2. Sci. China C Life Sci. 2003, 46, 623–630. [Google Scholar] [CrossRef]
  51. Qiao, K.; Tian, Y.; Hu, Z.; Chai, T. Wheat Cell Number Regulator CNR10 Enhances the Tolerance, Translocation, and Accumulation of Heavy Metals in Plants. Environ. Sci. Technol. 2019, 53, 860–867. [Google Scholar] [CrossRef]
Ijms 27 02034 g001
Figure 1. The mtDNA copy number levels of the EB treatment and control determined through qPCR. Data are presented as mean ± SD (n = 3), * p < 0.05 indicates significant difference with CK/EB as determined by Student’s t-test. The mean and SD values were derived from three biological repetitions.
Figure 1. The mtDNA copy number levels of the EB treatment and control determined through qPCR. Data are presented as mean ± SD (n = 3), * p < 0.05 indicates significant difference with CK/EB as determined by Student’s t-test. The mean and SD values were derived from three biological repetitions.
Ijms 27 02034 g001
Ijms 27 02034 g002
Figure 2. Transmission electron microscopic images of chlamydomonas between the CK and the EB-treated cells. (A,B) Solitary mitochondrion (M) in untreated control cell. (C,D) EB-treated cell mitochondria in network with an elongated, electron-dense, condensed matrix and collapsed cristae. M: Mitochondria.
Figure 2. Transmission electron microscopic images of chlamydomonas between the CK and the EB-treated cells. (A,B) Solitary mitochondrion (M) in untreated control cell. (C,D) EB-treated cell mitochondria in network with an elongated, electron-dense, condensed matrix and collapsed cristae. M: Mitochondria.
Ijms 27 02034 g002
Ijms 27 02034 g003
Figure 3. Light response curves of chlorophyll a fluorescence parameters in wild-type (CK, blue dotted line) and EB-treated (orange dotted line) chlamydomonas cells: photochemical quantum yield, Y(II) (A); regulated non-photochemical quantum yield, Y(NPQ) (B); redox state of the QA pool, 1–qL (C); excitation pressure on PSII, 1–qP (D); non-regulated non-photochemical quantum yield, Y(NO) (E); and electron transport rate, ETR (F). Data points show means ± SD of three biological replicates (n = 3); error bars not visible or smaller indicate replicates (n = 3) were highly consistent. Mann–Whitney test was used to predict differences between CK and EB at corresponding photosynthetic photon flux density (PPFD) levels.
Figure 3. Light response curves of chlorophyll a fluorescence parameters in wild-type (CK, blue dotted line) and EB-treated (orange dotted line) chlamydomonas cells: photochemical quantum yield, Y(II) (A); regulated non-photochemical quantum yield, Y(NPQ) (B); redox state of the QA pool, 1–qL (C); excitation pressure on PSII, 1–qP (D); non-regulated non-photochemical quantum yield, Y(NO) (E); and electron transport rate, ETR (F). Data points show means ± SD of three biological replicates (n = 3); error bars not visible or smaller indicate replicates (n = 3) were highly consistent. Mann–Whitney test was used to predict differences between CK and EB at corresponding photosynthetic photon flux density (PPFD) levels.
Ijms 27 02034 g003
Ijms 27 02034 g004
Figure 4. Phylogenetic relationship, gene structure analysis and distribution of conserved motifs of CrmTERFs. (A) Phylogenetic tree of 8 CrmTERFs. (B) Gene structure for mTERFs. The gray horizontal line denotes intron regions, while the yellow horizontal line denotes exon regions. (C) Distributions of conserved motifs in CrmTERFs. Ten putative motifs are indicated with different colored boxes.
Figure 4. Phylogenetic relationship, gene structure analysis and distribution of conserved motifs of CrmTERFs. (A) Phylogenetic tree of 8 CrmTERFs. (B) Gene structure for mTERFs. The gray horizontal line denotes intron regions, while the yellow horizontal line denotes exon regions. (C) Distributions of conserved motifs in CrmTERFs. Ten putative motifs are indicated with different colored boxes.
Ijms 27 02034 g004
Ijms 27 02034 g005
Figure 5. Chromosomal location and 3D structures. (A) The mTERF gene distribution on seven Chlamydomonas reinhardtii chromosomes is shown schematically, along with the gene names in red on the left side. The scale on the left side indicates the location of the mTERF genes on chromosomes. The top of each chromosome (Chr) is where you may find the chromosomal numbers. (B) mTERF family 3D structures displaying functional sites.
Figure 5. Chromosomal location and 3D structures. (A) The mTERF gene distribution on seven Chlamydomonas reinhardtii chromosomes is shown schematically, along with the gene names in red on the left side. The scale on the left side indicates the location of the mTERF genes on chromosomes. The top of each chromosome (Chr) is where you may find the chromosomal numbers. (B) mTERF family 3D structures displaying functional sites.
Ijms 27 02034 g005
Ijms 27 02034 g006
Figure 6. A phylogenetic and collinearity analysis of mTERF proteins. (A) A phylogenetic analysis of mTERF proteins from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) was carried out using the maximum likelihood method. There are three groups of mTERF proteins which include CrmTERF, each of which is represented by a gray, green and blue color. Genes from Chlamydomonas reinhardtii (Cr) are highlighted in blue. (B) Collinearity analysis of mTERF proteins between Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At). The red and orange colors represent ≤80% and ≤60% identity, respectively.
Figure 6. A phylogenetic and collinearity analysis of mTERF proteins. (A) A phylogenetic analysis of mTERF proteins from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) was carried out using the maximum likelihood method. There are three groups of mTERF proteins which include CrmTERF, each of which is represented by a gray, green and blue color. Genes from Chlamydomonas reinhardtii (Cr) are highlighted in blue. (B) Collinearity analysis of mTERF proteins between Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At). The red and orange colors represent ≤80% and ≤60% identity, respectively.
Ijms 27 02034 g006
Ijms 27 02034 g007
Figure 7. Gene ontology enrichment analysis. (A) Enriched GO biological process terms visualized as a network. (B) Enriched GO biological process terms visualized as a chart. GO enrichment analysis of CrmTERF genes was performed and visualized using the online tool ShinyGO 0.80.
Figure 7. Gene ontology enrichment analysis. (A) Enriched GO biological process terms visualized as a network. (B) Enriched GO biological process terms visualized as a chart. GO enrichment analysis of CrmTERF genes was performed and visualized using the online tool ShinyGO 0.80.
Ijms 27 02034 g007
Ijms 27 02034 g008
Figure 8. Predicted target cleavage sites of CrmiRNAs in CrmTERF in C. reinhardtii.
Figure 8. Predicted target cleavage sites of CrmiRNAs in CrmTERF in C. reinhardtii.
Ijms 27 02034 g008
Ijms 27 02034 g009
Figure 9. Relative expression levels of CrmTERF genes for EB-treated cells. t-test was employed to determine significance (* p < 0.05). The mean and standard deviation values were obtained from three biological replicates.
Figure 9. Relative expression levels of CrmTERF genes for EB-treated cells. t-test was employed to determine significance (* p < 0.05). The mean and standard deviation values were obtained from three biological replicates.
Ijms 27 02034 g009
Table 1. The characteristics of the eight CrmTERF genes identified in C. reinhardtii.
Table 1. The characteristics of the eight CrmTERF genes identified in C. reinhardtii.
Gene NumberPhytozome
Identifier		Chromosome Localization (bp)PSL (aa)MW (Da)Theoretical pIHydrophilityIIKa/Ks
Value
CrmTERF1Cre10.g427000Chr.10: 1,291,940–1,296,76155860,009.726.060.05538.060.9435
CrmTERF2Cre09.g408051Chr.9: 5,372,586–5,379,75463564,787.655.940.03344.320.8184
CrmTERF3Cre12.g542500Chr.12:9,285,129–9,286,68125127,462.4910.00−0.21558.200.8184
CrmTERF4Cre12.g560750Chr.12: 6,993,378–6,997,26161865,704.576.14−0.02155.700.8448
CrmTERF5Cre06.g278129Chr.6: 3,588,777–3,594,39898610,2540.786.180.02648.070.8448
CrmTERF6Cre03.g155850Chr.3: 2,004,455–2,010,12061563,553.615.280.33343.570.9688
CrmTERF7Cre16.g651550Chr.16: 1,307,348–1,310,19421222,706.239.360.05126.980.9435
CrmTERF8Cre14.g611200Chr.10: 499,117–502,07023425,718.879.46−0.21344.670.9688
Note: PSL—Protein sequence length, MW—Molecular Weight, II—Instability index.
Table 2. List of primers utilized in this study’s qRT-PCR gene expression investigation and mtDNA copy number.
Table 2. List of primers utilized in this study’s qRT-PCR gene expression investigation and mtDNA copy number.
Gene NamePrimer NameSequence (5′-3′)Length
mTERF11-F ATGTTCGCAACCTCTTTCGG20
1-RCTCCTCGAAGAGGCAAGTGG20
mTERF22-F CGATGCCACACTTCAGTTGC20
2-RCCGATGCCCAGCAAGTCTAA20
mTERF33-F TATTGGGGTATCGCCGAACG20
3-RGATGCTCCCAGCAGTAGGTC20
mTERF44-F TGAGATTGAGGCGGAGTGATG21
4-RCTTGAATGCGACCGGTGAAC20
mTERF55-F TACAAACAGCAACAGCACGC 20
5-RGGATCCGGAAGAGAGCTGC19
mTERF66-F CTGACCGACCCACATGGAC19
6-RCGCCGACCAGAGCTCTTTAT20
mTERF77-F GCAAAGCCCCGACACTAAGA 20
7-RCGATAGAGGAGGGCAGCTTG20
mTERF88-F ACTACATGACCAGCATCGGC 20
8-RTATTTTCCGCAGGTTCGCGT20
RACK19-F CTTCTCGCCCATGACCAC 18
9-RCCCACCAGGTTGTTCTTCAG20
rrnL610-F ACAATTACGCTGAAAACAGTACCA24
10-RTCACTGTTTGTTATGCAAAACCTT24
CLPD2411-F TGTTTCTCCTTGTTCCACCTCTG23
11-RCCGGGTTGACGTCTGTCTTG20
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Khan, A.; Ziyi, Y.; Rahman, F.U.; Luo, H.; Hu, Z. The Impact of Mitochondrial DNA Depletion on Mitochondrial Ultrastructure, Photosynthesis, and the mTERF Gene Family in Chlamydomonas reinhardtii. Int. J. Mol. Sci. 2026, 27, 2034. https://doi.org/10.3390/ijms27042034

AMA Style

Khan A, Ziyi Y, Rahman FU, Luo H, Hu Z. The Impact of Mitochondrial DNA Depletion on Mitochondrial Ultrastructure, Photosynthesis, and the mTERF Gene Family in Chlamydomonas reinhardtii. International Journal of Molecular Sciences. 2026; 27(4):2034. https://doi.org/10.3390/ijms27042034

Chicago/Turabian Style

Khan, Asadullah, Ye Ziyi, Faiz Ur Rahman, Haolin Luo, and Zhangli Hu. 2026. "The Impact of Mitochondrial DNA Depletion on Mitochondrial Ultrastructure, Photosynthesis, and the mTERF Gene Family in Chlamydomonas reinhardtii" International Journal of Molecular Sciences 27, no. 4: 2034. https://doi.org/10.3390/ijms27042034

APA Style

Khan, A., Ziyi, Y., Rahman, F. U., Luo, H., & Hu, Z. (2026). The Impact of Mitochondrial DNA Depletion on Mitochondrial Ultrastructure, Photosynthesis, and the mTERF Gene Family in Chlamydomonas reinhardtii. International Journal of Molecular Sciences, 27(4), 2034. https://doi.org/10.3390/ijms27042034

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop