Bile Salt Tolerance Determines Intestinal Colonization Efficacy of Heyndrickxia coagulans: A Phenotypic and Genomic Study
Innovative Drug Research Center, College of Life Sciences and Medicine, Key Laboratory of Plant Secondary Metabolism and Regulation of Zhejiang Province, Zhejiang Sci-Tech University, Hangzhou 310018, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2026, 27(4), 2022; https://doi.org/10.3390/ijms27042022
Submission received: 28 January 2026
/
Revised: 17 February 2026
/
Accepted: 19 February 2026
/
Published: 20 February 2026
(This article belongs to the Section Molecular Microbiology)
Abstract
The probiotic efficacy of H. coagulans relies on the bile salt tolerance of its vegetative cells, yet direct evidence linking this trait to intestinal colonization remains limited. This study integrated phenotypic screening, in vitro gastrointestinal simulation, in vivo colonization assays, and comparative genomics to address this gap. Among 50 strains, two highly bile salt-tolerant isolates (ATCC 7050 and Idrc019) were identified. In vitro assays using a simulated gastrointestinal model demonstrated that the spores of tolerant strains exhibited a significantly higher germination rate in the intestinal phase. Subsequently, in vivo time-course experiments demonstrated that tolerant strains exhibited superior intestinal proliferation and modulated the gut microbiota by enriching beneficial genera such as Blautia. Comparative genomic analysis revealed five variable genes associated with bile salt tolerance. Notably, BF29_941 (encoding a pilus assembly protein) was significantly upregulated under bile salt stress, suggesting a potential role in cell aggregation as a tolerance mechanism. These findings establish bile salt tolerance as a critical determinant of intestinal colonization in H. coagulans.
1. Introduction
Heyndrickxia coagulans (H. coagulans, formerly Bacillus coagulans) is a Gram-positive, facultatively anaerobic, and spore-forming probiotic bacterium [1]. It exerts beneficial effects through modulation of the gut microbiota, reinforcement of intestinal barrier function, and enhancement of host immunity [2]. A key feature of this bacterium is its ability to form highly resistant dormant spores. Consequently, commercial probiotic formulations are predominantly based on the spore form, which exhibits notable tolerance to heat, acid, alkali, and desiccation, thereby ensuring viability during processing and storage [3]. In the human gastrointestinal tract (GIT), the life cycle of H. coagulans begins with spores that survive the acidic gastric environment and subsequently germinate into metabolically active vegetative cells in the intestine [4,5]. Therefore, our prior research led to the hypothesis that the spores of H. coagulans aid in surviving the stomach, whereas its probiotic activity in the gut is predicated on the bile salt tolerance of its vegetative cells [6]. However, direct experimental evidence demonstrating that bile salt resistance influences the proliferative capacity of the bacterium in the intestinal environment remains limited.
Bacterial bile salt tolerance is mediated by a suite of coordinated physiological and molecular mechanisms. Structurally, bacteria can form a physical barrier through extracellular polysaccharides and S-layer proteins and modify their cell membrane composition to enhance stability and reduce permeability [7]. In terms of detoxification, bacteria primarily employ two systems: active efflux systems that rapidly export intracellular bile salts and bile salt hydrolase, which catalyzes the hydrolysis of conjugated bile salts into less toxic-free forms [8]. Furthermore, under bile salt stress, bacteria activate a comprehensive stress response, including the upregulation of chaperone proteins to repair protein and DNA damage caused by oxidative stress, as well as the reprogramming of global metabolic pathways to enhance energy supply and remodel cell wall architecture for improved mechanical robustness [9,10].
Advances in multi-omics technologies have enabled the broad application of transcriptomics and proteomics to elucidate key pathways involved in bacterial bile salt resistance [11]. However, these approaches are often costly and technically complex. In contrast, comparative genomics provides an efficient and economical strategy to systematically decipher metabolic traits and genetic foundations, offering the potential to directly link genotypes with bile salt tolerance phenotypes [12]. For instance, comparative genomic analyses have identified candidate bile salt tolerance genes in Lactobacillus salivarius, suggesting a feasible approach for screening tolerant strains [13]. Similarly, a study on H. coagulans HS243 revealed two bile salt tolerance-associated gene clusters through comparative genomics, including a single-copy glycine hydrolase gene and four chaperone-related genes [14]. Despite the expanding use of multi-omics, research on bile salt tolerance mechanisms in H. coagulans remains limited. For instance, the Probio-Ichnos database lists ten strains in this species, and only four of them have been experimentally validated in vitro for bile salt tolerance [15]. Moreover, most studies have focused on single strains, and systematic cross-strain or cross-species comparisons coupled with functional validation are still lacking [16]. Therefore, broader strain-level investigations are needed to uncover both conserved and species-specific mechanisms of bile salt tolerance in this bacterium.
Therefore, this study was designed to address the limited experimental evidence directly linking bile salt resistance to the intestinal proliferative capacity of H. coagulans. We aimed to not only determine the influence of bile salt resistance on intestinal colonization but also to elucidate the underlying genetic mechanisms, thereby identifying candidate functional genes responsible for bile salt tolerance of this species. To this end, we first measured the bile salt survival rates of 50 H. coagulans strains. The influence of bile salt tolerance on intestinal proliferation was then evaluated using in vitro and in vivo models. Finally, candidate genes associated with bile salt tolerance were identified through comparative genomics and validated via qRT-PCR, revealing the potential molecular basis of this trait in the species.
2. Results and Discussion
2.1. Different H. coagulans Strains Showed Diverse Survival Rates in Bile Salt Solutions
The bile salt tolerance of 50 H. coauglans strains was evaluated by measuring their survival rates in defined bile salt solutions. The results revealed notable inter-strain variability, as summarized in Table 1, with 27 isolates demonstrating robust survival at 0.3% bile salt, indicating a substantial level of intrinsic resistance. To further distinguish high-tolerance phenotypes, the bile salt concentration in MRS broth was increased to 0.6% for a secondary screening of these candidate strains. Under this more stringent condition, only two isolates (H. coauglans ATCC 7050 and H. coauglans ldrc019) exhibited significantly enhanced growth performance compared to the other strains (Table 1). Their sustained viability and proliferative capacity under elevated bile salt stress suggest superior adaptive traits, potentially associated with enhanced cell membrane stability or bile salt hydrolase activity. Consequently, we selected H. coagulans ATCC 7050 and ldrc019 (high-tolerance strains) for subsequent mechanistic and functional studies, aiming to elucidate the molecular basis of their bile salt tolerance and assess their potential as robust probiotic candidates. Additionally, to explore whether bile salt tolerance correlates with intestinal proliferation capacity, we randomly selected two low-tolerance strains, ldrc033 and ldrc047, in follow-up experiments. The selected strains (ATCC 7050, Idrc019, Idrc033, Idrc047) were then used in subsequent experiments to investigate the correlation between bile salt tolerance and intestinal colonization efficacy. This combined approach will help clarify how bile salt tolerance influences the in vivo proliferation of H. coagulans and its underlying mechanisms.
2.2. In Vitro Growth Response of H. coagulans Spores to Simulated GI Conditions
As shown in Figure 1, the survivability of different H. coagulans strains was evaluated under different conditions. All tested strains exhibited very high resistance to oral and gastric environments with no significant inter-group differences (Figure 2A,B), a pattern consistent with previous reports indicating that spores of H. coagulans serve as the primary protective mechanism by enhancing survival under extreme conditions. However, notably, when evaluating spore germination and proliferation under GIT stress, variations in germination capacity were observed among strains differing in bile salt tolerance. Specifically, post-germination survival rates of spores from bile salt-tolerant H. coagulans strains were significantly higher than those of bile salt-intolerant counterparts (Figure 2C). This finding further substantiates our hypothesis that the high bile salt tolerance of H. coagulans enables its spores to germinate and subsequently proliferate within the intestine, underscoring the critical role of bile salt adaptation in intestinal colonization.
2.3. In Vivo Assessment of Growth of H. coagulans Spore
The effect of gastric stress on H. coagulans spores was initially investigated in an in vitro experiment, followed by in vivo assessment. As shown in Figure 2, we compared the proliferative capacity of H. coagulans strains with varying bile salt tolerance in the intestine and their impacts on the gut microbiota at days 1 and 7 post-administration. At day 1, no significant differences in alpha diversity were observed among groups, indicating that initial colonization by H. coagulans did not disrupt the overall gut microbial community structure (p > 0.05, Figure 2A). By day 7, however, the control group exhibited significantly lower microbial diversity than the group administered high-bile-salt-tolerant strains, suggesting that prolonged exposure to these strains enhanced gut microbial richness (p < 0.05, Figure 2B). Beta-diversity analysis further revealed that, at day 1 showed no structural changes in the mouse gut microbiota upon H. coagulans intake (Figure 2C). In contrast, at day 7, the microbiota of mice administered H. coagulans could be clearly distinguished from the control group, implying that as H. coagulans germinated and proliferated in the host, it gradually influenced the intestinal microbial ecosystem (Figure 2D).
Linear discriminant analysis effect size (LEfSe) analysis of the gut microbiota on day 7 demonstrated significant differences in community composition among groups (Figure 2E,F). Compared to the control group, mice receiving high-bile-salt-tolerant strains showed a significant increase in the relative abundance of specific genera, including Blautia, Heyndrickxia, and Paraprevotella. In addition, the temporal dynamics of H. coagulans strains in fecal samples showed that mice administered bile salt-tolerant strains (ATCC 7050 and Idrc019) exhibited significantly higher levels of the relevant quantities compared to those administered bile salt-sensitive strains (Idrc033 and Idrc047) (Figure 2G, p < 0.05). Through repeated validation, experimental errors were minimized, and these data reconfirmed that, enabling them to maintain higher viable cell counts. In summary, in vivo time-course experiments demonstrated that tolerant strains exhibited superior intestinal proliferation and modulated the gut microbiota by enriching beneficial genera such as Blautia.
Figure 2.
Comparison of the gut microbiota diversity and composition between treatment groups. (A) Alpha diversity indices analysis at day 1 (n = 3, ns, represent not significant). (B) Alpha diversity indices analysis at day 7 (n = 3, ns, represent not significant, * p < 0.05, ** p < 0.01). (C) Beta diversity analysis at day 1. (D) Beta diversity analysis at day 7. (E) LEfSe cladogram identified significant differential abundances of gut microbial taxa. (F) LDA effect size plot similarly visualized these taxonomic differences. (G) Temporal dynamics of H. coagulans strains in fecal samples as determined by qPCR analysis. (n = 3, Different letters represent significant differences).
Figure 2.
Comparison of the gut microbiota diversity and composition between treatment groups. (A) Alpha diversity indices analysis at day 1 (n = 3, ns, represent not significant). (B) Alpha diversity indices analysis at day 7 (n = 3, ns, represent not significant, * p < 0.05, ** p < 0.01). (C) Beta diversity analysis at day 1. (D) Beta diversity analysis at day 7. (E) LEfSe cladogram identified significant differential abundances of gut microbial taxa. (F) LDA effect size plot similarly visualized these taxonomic differences. (G) Temporal dynamics of H. coagulans strains in fecal samples as determined by qPCR analysis. (n = 3, Different letters represent significant differences).
2.4. Comparative Genomic Analysis Determined the Potential H. coagulans Genes Responsible for Bile Salt Tolerance
Genomic analysis of H. coagulans ATCC 7050, Idrc019, Idrc033, and Idrc047 provided critical insights into strain-level genetic variation, supporting the use of comparative genomics to preliminarily screen bile salt tolerance-related functional genes in this species. The analysis revealed the following: the total number of unique elements per strain was 3624, 3774, 3399, and 3598, respectively; pairwise shared elements numbered 8, 92, 1, 70, and 13; triple-combination shared elements were 35, 70, 13, and 490; and core shared elements across all four strains totaled 2587 (Figure 3). These data visually demonstrate the genetic diversity and conserved relatedness among strains. Based on this genomic framework, we employed a comparative genomics approach to identify bile salt tolerance-associated functional genes in H. coagulans. As shown in Table 2, compared to the core gene set of bile salt-tolerant strains, bile salt-sensitive strains exhibited deletions or reduced copy numbers in 5 variable genes: BF29_941, dnaB, BF29_1335, BF29_3251, and BF29_3030. In contrast, bile salt-tolerant H. coagulans strains showed deletions or reduced copy numbers in 12 additional genes relative to the sensitive group. However, these 12 genes may function as “redundant” elements in bile salt adaptation. Previous studies have demonstrated that under survival pressure, bacteria often lose redundant genes to minimize genome size, thereby improving environmental adaptation and reproductive fitness [17].
The dnaB gene, the sole member of the Cl43097 superfamily, encodes a DNA replication helicase involved in gene replication, recombination, and repair. Its product drives 5′→3′ translocation along single-stranded DNA templates by hydrolyzing ATP, facilitating double-stranded DNA unwinding in its path [18]. Previous studies have reported that bile salt environments induce secondary structures in bacterial RNA, leading to DNA damage [19,20]. Thus, genes related to DNA damage repair are often closely associated with bacterial bile salt tolerance. However, as dnaB is a critical gene for maintaining bacterial genome stability and cannot be easily knocked out for functional validation, this study did not conduct in-depth exploration of this gene [21]. Among the five variable genes (BF29_941, dnaB, BF29_1335, BF29_3251, and BF29_3030), two are involved in carbohydrate transport and metabolism: BF29_1335 encodes a glucuronate isomerase, and the putative product of BF29_3030 is a β-phosphoglucomutase. To adapt to high bile salt concentrations, bacteria must efficiently utilize energy to maintain basic metabolism. Therefore, these two-carbohydrate metabolism-related genes may be associated with bile salt tolerance. Additionally, BF29_3251 encodes a phosphoglycerol transferase involved in teichoic acid biosynthesis. Teichoic acids are specific polymers on the surface of Gram-positive bacteria and essential components of their cell membranes and cell walls. Since bile salts can significantly damage the cell wall, the abundance of cell wall synthesis-related genes may critically influence bile salt tolerance.
Notably, this study found that all bile salt-tolerant strains retained the BF29_941 gene, whereas this gene was significantly reduced or deleted in sensitive strains. The product of BF29_941 is a pilus assembly protein. Previous reports indicate that bile salt exposure induces pilus overgrowth in Escherichia coli [22]. While current research on bacterial pili primarily focuses on adhesion capacity, Krebs et al. proposed that pili can protect bacteria from bile salt components to some extent [23]. In summary, this study selected BF29_941, BF29_1335, BF29_3251, and BF29_3030 for subsequent qRT-PCR validation to confirm their roles as key regulatory genes for bile salt tolerance in these strains.
2.5. qRT-PCR Analysis of the Potential H. coagulans Genes Responsible for Bile Salt Tolerance
Given the widespread technical challenges in establishing efficient gene knockout systems in non-model industrial probiotics (such as H. coagulans), this study adopted a strategy combining comparative genomics with qRT-PCR to conduct a preliminary correlative analysis of the genetic basis of bile salt tolerance. As shown in Figure 4, qRT-PCR analysis revealed that the transcriptional levels of all four target genes were significantly upregulated under bile salt stress in both H. coagulans strains ATCC 7050 and Idrc019.
As indicated in Figure 4, BF29_941 exhibited the greatest upregulation in both H. coagulans strains. As previously discussed, bacterial pili have been reported to protect cells from bile salt components to some extent. Kirn et al. proposed that the protective mechanism of pili may involve inducing bacterial self-aggregation, thereby resisting harsh environments and ensuring viability [24]. Beyond bile salts, prior studies have shown that Escherichia coli expressing long pili exhibit a 10-fold increase in viability when exposed to antimicrobial agents such as lysozyme and antibiotics, suggesting that pilus-mediated self-aggregation enhances the survival of vegetative cells in adverse conditions [25]. Interestingly, François P et al. observed that during prolonged bile salt stress, the chromosomal region containing the pilus gene cluster in Lactobacillus rhamnosus GG was progressively lost with increasing passage number, further confirming the tight association between bile salts and bacterial pili [26].
The upregulation of BF29_3251 in the bile salt-treated condition indicates that its encoded glycerol phosphate transferase plays a critical role in the bile salt tolerance of H. coagulans. Teichoic acids, core components of the cell wall/membrane in Gram-positive bacteria, are classified into lipoteichoic acid (LTA) and wall teichoic acid based on their localization. Literature reports highlight that LTA in lactic acid bacteria is crucial for maintaining cell viability, morphological integrity, and ionic homeostasis [27]. Furthermore, although from a different species, Mansour et al. found that Lactobacillus acidophilus NCX2025, deficient in the glycerol phosphate transferase gene, exhibited significantly reduced viability in small intestinal fluid, indirectly supporting the adaptive significance of this enzyme in bile salt environments [28].
Both BF29_1335 and BF29_3030 are involved in carbohydrate metabolism. It has been reported that under bile salt exposure, the gene encoding β-phosphoglucomutase in Lactobacillus salivarius Ren is upregulated by 6.41-fold [29]. β-Phosphoglucomutase catalyzes the conversion of maltose to α-glucose-6-phosphate for glycolysis, a process that does not consume ATP—thus, metabolizing 1 mole of maltose yields more ATP than metabolizing 2 moles of glucose. Madiedo et al. demonstrated that preferential utilization of maltose increases ATP production in bile-tolerant Bifidobacterium animalis [30]. In this study, the upregulation of BF29_3030 may reflect increased energy demand for cell survival under bile salt stress, prompting bacteria to construct an efficient energy transport system via broad carbon source utilization for active uptake of extracellular energy. Interestingly, BF29_1335 shows a relatively low expression level and is only upregulated by 4.67-fold in H. coagulans ATCC 7050, which suggests its potential involvement in bile salt tolerance, though it does not appear to be a decisive key gene.
In summary, the high transcriptional level of BF29_941 in this experiment indicates a close association between bile salts and the pilus of H. coagulans. The differential transcriptional changes in functional genes in H. coagulans strains ATCC 7050 and Idrc019 may explain the intraspecies diversity in bile salt tolerance of H. coagulans. It must be noted that a central limitation of this study is the lack of functional validation, meaning our findings from comparative genomics and qRT-PCR remain associative. To move from correlation to causation, it is imperative that future work focuses on functional analyses, including knockout/complementation of key genes like BF29_941.
3. Materials and Methods
3.1. Chemicals and Materials
All chemicals, including ox bile salts, DEPC-treated water, absolute ethanol, glucose, casein hydrolysate, yeast extract, soy peptone, ferrous sulfate heptahydrate, manganese sulfate monohydrate, anhydrous calcium chloride, sodium chloride, anhydrous disodium hydrogen phosphate, and anhydrous dipotassium hydrogen phosphate, were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). RNA extraction was performed with the TRIzol Plus RNA Purification Kit (Invitrogen, CA, USA); RNA concentration was measured using a NanoDrop spectrophotometer (Thermo Scientific, Shanghai, China); cDNA was synthesized with the HiFiScript gDNA Removal cDNA Synthesis Kit (CoWin Biosciences, Qingdao, China); and quantitative PCR was conducted using the TransStart Tip Green qPCR SuperMix kit (Tiangen Biotech, Beijing, China). The fecal genomic DNA extraction kit was obtained from MP Biomedicals Co., Ltd. (Solon, OH, USA), and the DNA Gel/PCR Purification Miniprep Kit was acquired from Bio-Way Medical Technology Co., Ltd. (Hangzhou, China). H. coagulans strains used in this study were provided by the Innovative Drug Research Center, Zhejiang Sci-Tech University, Hangzhou, China. Vegetative cells of H. coagulans were cultured in MRS broth aerobically at 37 °C for 24 h and were consecutively activated three times prior to use.
3.2. Determination of the Tolerance of H. coagulans Strains in Bile Salt Solutions
Bacterial strains were incubated in MRS broth supplemented with 0.3% and 0.6% (w/v) bile salts at 37 °C with shaking at 100 r/min for 24 h. The optical density at 600 nm (OD600) was measured using a U-2000 spectrophotometer. The bile salt tolerance of the strains was assessed by measuring the time required for the culture to reach an OD600 of 0.5 under defined conditions. The selected strains (ATCC 7050, Idrc019, Idrc033, Idrc047) were then used in subsequent experiments to investigate the correlation between bile salt tolerance and intestinal colonization efficacy.
3.3. Detection of the Survival Rate of H. coagulans Strains In Vitro
The effect of simulated gastrointestinal (GI) stress on spore viability was assessed following established methods with modifications [6]. Spores were subjected to sequential digestion phases: oral (simulated saliva fluid, pH 6.8, 37 °C, 5 min), gastric (pepsin in NaCl, pH 3.0, 37 °C, 3 h, 50 rpm), and intestinal (ox bile and pancreatin with Oxyrase®, pH 7.0, 37 °C, 24 h). After each phase, samples were collected and viable spores of tested H. coagulans strains were enumerated. Growth was quantified by measuring OD600 after 24 h fermentation, with MRS medium as 100% growth control. Experiments were performed in triplicate across three independent runs, and results are expressed as percentage growth relative to the MRS control.
3.4. Animal Experiment Design
Male C57BL mice (6–8 weeks, 22 ± 0.2 g) obtained from Zhejiang Vital River Laboratory Animal Technology Co., Ltd., Hangzhou, China (Approval number: SYXK (Zhejiang) 2021-0001), were utilized in this study. Mice were housed in cages with free access to food and water and placed in an air-conditioned room (25 ± 1 °C, 50–60% relative humidity), with a 12 h light/dark cycle. All animal studies and procedures were conducted in accordance with the guidelines and regulations approved by the Institutional Animal Research Committee of the Zhejiang Sci-tech University (ZSTU20250526-1) and the National Research Council’s Guide for the Care and Use of Laboratory Animals (IACUC No. 3590).
This experiment was designed with a time-gradient approach to dynamically evaluate the colonization patterns of different H. coagulans trains in vivo (Table 3). The experiment was designed with five groups: one control group (3 mice) and four treatment groups (18 mice per group, each further divided into 6 subgroups with n = 3). On the first day, mice in the treatment groups were orally administered 200 μL of the corresponding spore suspension (2 × 109 CFU/mL), while the control group received an equal volume of saline. Subgroups were euthanized for sampling at 6, 12, 18, 24, and 72 h, as well as on day 7 (168 h) after administration; the control group was only euthanized on day 7. During each sampling, fecal samples were collected for the following analyses: (1) analysis of the proliferation dynamics of each strain in different intestinal segments by absolute quantitative PCR (qPCR); (2) monitoring of temporal changes in the gut microbiota, including Alpha diversity (e.g., Shannon index) and Beta diversity; and (3) identification of differentially abundant microbial taxa among groups using LEfSe analysis. This time-gradient design allowed for the comprehensive capture of the dynamic processes of spore germination, proliferation, and microbial community responses, enabling an accurate assessment of the influence of bile salt tolerance on colonization capacity.
3.5. Enumeration of H. coagulans in Fecal Samples
Quantification of H. coagulans in fecal samples was performed by absolute qPCR following a previously described method [31]. Genomic DNA was extracted from the samples using a bacterial DNA extraction kit (MP Biomedicals Co., Ltd., Solon, OH, USA). A standard curve was established using serial dilutions of freeze-dried H. coagulans reconstituted in sterile saline. Each 25 µL qPCR reaction contained 1 µL each of the species-specific primers BG-For (5′-AAAAGCTTGCTTTTAAAAGGTTAGCG-3′) and BG-Rev (5′-GTTCGAACGGCACTTGTTCT-3′), which target a 400-bp region of the 16S rRNA gene and have been validated for specificity to H. coagulans via BLAST+ 2.17.0 analysis, 2.5 µL of template DNA, 8 µL of ddH2O, and 12.5 µL of 2× SYBR Green qPCR master mix [32]. Amplification was carried out according to the referenced protocol. Bacterial levels were determined by comparing the quantification cycle (Cq) values of the samples to the standard curve (Table S1).
3.6. Comparative Genomic Analysis
Comparative genomic analysis was performed as previously described [16,33]. The information of H. coagulans strains used in this study are shown in Table S2. The core gene database of the tolerant group was built using OrthoMCL (https://orthomcl.org/orthomcl/ (accessed on 10 February 2020)) with the default parameters [34]. Next, the whole genome of each non-tolerant strain was compared with the tolerant core database using PGAP (https://github.com/ncbi/pgap (accessed on 15 February 2020)), picking genes deleted in at least two strains via the result of orthologs clusters [35]. The copy numbers of candidate genes in each strain were assessed using BLAST with default parameters. Similarly, redundant genes were identified by comparing the non-tolerant strain gene database against the genomes of tolerant strains. To evaluate the statistical significance of copy number variations between bile salt-tolerant and non-tolerant groups, Fisher‘s Exact Test was applied, with a p-value < 0.05 considered significant [16]. The protein sequences of all selected genes were predicted using Genemark (accessed on 9 February 2020) [36]. Their functions were subsequently annotated via BLAST against the NR and COG databases (both accessed on 25 February 2020) with default parameters [37]. The nucleotide sequences of the five key genes identified in this study are shown in Table S3.
3.7. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Analysis
Total RNA was extracted from H. coagulans ATCC 7050 and Idrc019. Bacterial cells (5 mL) from the control group (MRS broth) and the experimental group (MRS broth supplemented with 0.3% w/v bile salts) were harvested at the stationary phase by centrifugation at 10,000× g and 4 °C. Total RNA was extracted from each bacterial strain using the TRIzol Plus RNA Purification Kit following the manufacturer’s protocol. The concentration of the purified RNA was quantified using a NanoDrop spectrophotometer. Subsequently, cDNA was synthesized from 1 μg of total RNA in a 20 μL reaction volume using the HiFiScript gDNA Removal cDNA Synthesis Kit. qRT-PCR was performed on a 96-well plate with the TransStart Tip Green qPCR SuperMix kit, strictly adhering to the manufacturer’s instructions [16].
Gene-specific primers for the selected target genes were designed using Primer Premier 5. Primer sets with high overall scores were selected and validated (Table 4). qRT-PCR was performed using the SYBR Premix Ex Taq system. The 16S rRNA gene of H. coagulans ATCC was used as the internal reference. Quantified cDNA was used as the template, and all reactions were performed in triplicate. The reaction components are listed in Table 5. The thermal cycling conditions were as follows: initial denaturation at 95 °C for 30 s; 35 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 20 s, and extension at 72 °C for 1 min; a final extension at 72 °C for 5 min; and holding at 12 °C.
3.8. Statistics Analysis
All results are expressed as mean ± SEM. Statistical analysis was performed using GraphPad Prism 9 (San Diego, CA, USA). Differences between the two groups were analyzed using a two-tailed unpaired t-test. For comparisons among multiple groups, one-way ANOVA followed by Dunnett’s post hoc test was used. For microbial diversity, alpha diversity indices (Observed species, Chao1, ACE, Shannon, Simpson) were also compared using one-way ANOVA with Dunnett’s test. α- and β-diversity indices were calculated using the QIIME2 pipeline and the vegan package in R-4.5.2. Amplicon sequence variants (ASVs) were generated via DADA2, and β-diversity was assessed using the Bray–Curtis distance metric [38,39]. LEfSe analysis was performed to identify differentially abundant microbial features between groups [40]. The analysis was conducted using the following parameters: a Kruskal–Wallis test significance threshold of 0.05, a logarithmic LDA score threshold of 2.0 for effect size, and no multiple-testing correction (method = “none”) as per the original implementation. The input data were normalized to relative abundances (sum to 1 per sample) prior to analysis. A p-value ≤ 0.05 was considered statistically significant.
4. Conclusions
This study systematically elucidates the phenotypic and genetic determinants of bile salt tolerance in H. coagulans and its critical role in intestinal colonization. Through phenotypic screening of 50 strains, we identified two highly bile salt-tolerant isolates (ATCC 7050 and ldrc019) capable of sustained growth under 0.6% bile salt stress. In vivo time-course experiments demonstrated that tolerant strains exhibited superior intestinal proliferation and modulated the gut microbiota by enriching beneficial genera such as Blautia. Comparative genomics revealed five key variable genes (BF29_941, dnaB, BF29_1335, BF29_3251, and BF29_3030) associated with bile salt tolerance. qRT-PCR validation confirmed significant upregulation of these genes under bile salt stress, particularly BF29_94, which encodes a pilus assembly protein proposed to enhance tolerance via cell aggregation. These findings establish bile salt tolerance as a decisive factor for intestinal colonization in H. coagulans and provide a genetic basis for marker-assisted selection of robust probiotic strains. Future studies should focus on functional characterization of the identified genes and their synergistic mechanisms in bile salt adaptation.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms27042022/s1.
Author Contributions
Conceptualization, J.C. and Y.-W.J.; methodology, Y.-W.J.; software, F.C.; validation, Y.-W.J.; formal analysis, Y.-W.J.; investigation, Y.-W.J.; resources, J.C.; data curation, Y.-W.J.; writing—original draft preparation, Y.-W.J.; writing—review and editing, J.C. and Y.-W.J.; visualization, F.C.; supervision, J.C.; project administration, J.C.; funding acquisition, J.C. All authors have read and agreed to the published version of the manuscript.
Funding
This research was financially supported by Zhejiang Provincial Natural Science Foundation of China (LQN25C010004).
Institutional Review Board Statement
The animal study protocol was approved by the Institutional Animal Research Committee of the Zhejiang Sci-Tech University (ZSTU20250526-1, 20250525).
Informed Consent Statement
Not applicable.
Data Availability Statement
Data is contained within the article or Supplementary Materials in this study. The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Ke, S.; Chen, Z.; Qi, Y.; Zhang, J.; Chen, Q.; Chen, J.; Bo, H. Heyndrickxia coagulans as a next-generation probiotic: Current evidence and future perspectives. Food Funct. 2026, 17, 15–40. [Google Scholar] [CrossRef] [PubMed]
- Liang, J.; Li, C.; Chen, Z.; Guo, F.; Dou, J.; Wang, T.; Xu, Z.S. Progress of research and application of Heyndrickxia coagulans (Bacillus coagulans) as probiotic bacteria. Front. Cell. Infect. Microbiol. 2024, 14, 1415790. [Google Scholar] [CrossRef] [PubMed]
- Konuray, G.; Erginkaya, Z. Potential use of Bacillus coagulans in the food industry. Foods 2018, 7, 92. [Google Scholar] [CrossRef] [PubMed]
- Cao, J.; Yu, Z.; Liu, W.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Probiotic characteristics of Bacillus coagulans and associated implications for human health and diseases. J. Funct. Foods 2020, 64, 103643. [Google Scholar] [CrossRef]
- Duncan, R.; Mantegazza, G.; Gargari, G.; Pierallini, E.; Russo, R.; Guglielmetti, S. Heyndrickxia coagulans LMG S-24828 Is a Safe Probiotic Strain Capable of Germinating in the Human Gut. Probiotics Antimicrob. Proteins 2025, 17, 4465–4479. [Google Scholar] [CrossRef]
- Cao, J.; Yu, L.; Zhao, J.; Zhang, H.; Chen, W.; Xue, Y.; Zhai, Q. Alleviative effects of Bacillus coagulans strains on IBS-unraveling strain specificity through physiological and genomic analysis. Food Sci. Hum. Wellness 2024, 13, 1845–1855. [Google Scholar] [CrossRef]
- Wu, M.-H.; Pan, T.-M.; Wu, Y.-J.; Chang, S.-J.; Chang, M.-S.; Hu, C.-Y. Exopolysaccharide activities from probiotic bifidobacterium: Immunomodulatory effects (on J774A. 1 macrophages) and antimicrobial properties. Int. J. Food Microbiol. 2010, 144, 104–110. [Google Scholar] [CrossRef]
- Ruiz, L.; Margolles, A.; Sánchez, B. Bile resistance mechanisms in Lactobacillus and Bifidobacterium. Front. Microbiol. 2013, 4, 396. [Google Scholar] [CrossRef]
- Lv, L.-X.; Yan, R.; Shi, H.-Y.; Shi, D.; Fang, D.-Q.; Jiang, H.-Y.; Wu, W.-R.; Guo, F.-F.; Jiang, X.-W.; Gu, S.-L. Integrated transcriptomic and proteomic analysis of the bile stress response in probiotic Lactobacillus salivarius LI01. J. Proteom. 2017, 150, 216–229. [Google Scholar] [CrossRef]
- Lee, J.Y.; Pajarillo, E.A.B.; Kim, M.J.; Chae, J.P.; Kang, D.-K. Proteomic and transcriptional analysis of Lactobacillus johnsonii PF01 during bile salt exposure by iTRAQ shotgun proteomics and quantitative RT-PCR. J. Proteome Res. 2013, 12, 432–443. [Google Scholar] [CrossRef]
- Koskenniemi, K.; Laakso, K.; Koponen, J.; Kankainen, M.; Greco, D.; Auvinen, P.; Savijoki, K.; Nyman, T.A.; Surakka, A.; Salusjärvi, T. Proteomics and transcriptomics characterization of bile stress response in probiotic Lactobacillus rhamnosus GG. Mol. Cell. Proteom. 2011, 10, S1–S18. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Li, M.; Yu, L.; Tian, F.; Zhao, J.; Chen, W.; Zhai, Q. Comparative genomics of Lactiplantibacillus plantarum reveals the role of the two-component system in response to bile salts stress. Food Biosci. 2024, 61, 104803. [Google Scholar] [CrossRef]
- Chen, C.; Yu, L.; Tian, F.; Zhao, J.; Zhai, Q. Identification of novel bile salt-tolerant genes in Lactobacillus using comparative genomics and its application in the rapid screening of tolerant strains. Microorganisms 2022, 10, 2371. [Google Scholar] [CrossRef] [PubMed]
- Kapse, N.; Engineer, A.; Gowdaman, V.; Wagh, S.; Dhakephalkar, P. Functional annotation of the genome unravels probiotic potential of Bacillus coagulans HS243. Genomics 2019, 111, 921–929. [Google Scholar] [CrossRef]
- Tsifintaris, M.; Kiousi, D.E.; Repanas, P.; Kamarinou, C.S.; Kavakiotis, I.; Galanis, A. Probio-Ichnos: A database of microorganisms with in vitro probiotic properties. Microorganisms 2024, 12, 1955. [Google Scholar] [CrossRef]
- Pan, Q.; Shen, X.; Yu, L.; Tian, F.; Zhao, J.; Zhang, H.; Chen, W.; Zhai, Q. Comparative genomic analysis determines the functional genes related to bile salt resistance in Lactobacillus salivarius. Microorganisms 2021, 9, 2038. [Google Scholar] [CrossRef]
- Stefanovic, E.; McAuliffe, O. Comparative genomic and metabolic analysis of three Lactobacillus paracasei cheese isolates reveals considerable genomic differences in strains from the same niche. BMC Genom. 2018, 19, 205. [Google Scholar] [CrossRef]
- San Martin, M.C.; Stamford, N.P.J.; Dammerova, N.; Dixon, N.E.; Carazo, J.M. A structural model for the Escherichia coli DnaB helicase based on electron microscopy data. J. Struct. Biol. 1995, 114, 167–176. [Google Scholar] [CrossRef]
- Begley, M.; Gahan, C.G.; Hill, C. The interaction between bacteria and bile. FEMS Microbiol. Rev. 2005, 29, 625–651. [Google Scholar] [CrossRef]
- Kim, S.H.; Gorski, L.; Reynolds, J.; Orozco, E.; Fielding, S.; Park, Y.H.; Borucki, M.K. Role of uvrA in the growth and survival of Listeria monocytogenes under UV radiation and acid and bile stress. J. Food Prot. 2006, 69, 3031–3036. [Google Scholar] [CrossRef]
- Zhang, Y.; Okada, R.; Isaka, M.; Tatsuno, I.; Isobe, K.I.; Hasegawa, T. Analysis of the roles of NrdR and DnaB from Streptococcus pyogenes in response to host defense. APMIS 2015, 123, 252–259. [Google Scholar] [CrossRef] [PubMed]
- de Jesus, M.C.; Urban, A.A.; Marasigan, M.E.; Barnett Foster, D.E. Acid and bile-salt stress of enteropathogenic Escherichia coli enhances adhesion to epithelial cells and alters glycolipid receptor binding specificity. J. Infect. Dis. 2005, 192, 1430–1440. [Google Scholar] [CrossRef] [PubMed]
- Krebs, S.J.; Taylor, R.K. Protection and attachment of Vibrio cholerae mediated by the toxin-coregulated pilus in the infant mouse model. J. Bacteriol. 2011, 193, 5260–5270. [Google Scholar] [CrossRef] [PubMed]
- Kirn, T.J.; Lafferty, M.J.; Sandoe, C.M.; Taylor, R.K. Delineation of pilin domains required for bacterial association into microcolonies and intestinal colonization by Vibrio cholerae. Mol. Microbiol. 2000, 35, 896–910. [Google Scholar] [CrossRef]
- Clavijo, A.P.; Bai, J.; Gómez-Duarte, O.G. The Longus type IV pilus of enterotoxigenic Escherichia coli (ETEC) mediates bacterial self-aggregation and protection from antimicrobial agents. Microb. Pathog. 2010, 48, 230–238. [Google Scholar] [CrossRef]
- Douillard, F.P.; Ribbera, A.; Xiao, K.; Ritari, J.; Rasinkangas, P.; Paulin, L.; Palva, A.; Hao, Y.; de Vos, W.M. Polymorphisms, chromosomal rearrangements, and mutator phenotype development during experimental evolution of Lactobacillus rhamnosus GG. Appl. Environ. Microbiol. 2016, 82, 3783–3792. [Google Scholar] [CrossRef]
- Vélez, M.P.; Verhoeven, T.L.; Draing, C.; Von Aulock, S.; Pfitzenmaier, M.; Geyer, A.; Lambrichts, I.; Grangette, C.; Pot, B.; Vanderleyden, J. Functional analysis of D-alanylation of lipoteichoic acid in the probiotic strain Lactobacillus rhamnosus GG. Appl. Environ. Microbiol. 2007, 73, 3595–3604. [Google Scholar] [CrossRef]
- Mohamadzadeh, M.; Pfeiler, E.A.; Brown, J.B.; Zadeh, M.; Gramarossa, M.; Managlia, E.; Bere, P.; Sarraj, B.; Khan, M.W.; Pakanati, K.C. Regulation of induced colonic inflammation by Lactobacillus acidophilus deficient in lipoteichoic acid. Proc. Natl. Acad. Sci. USA 2011, 108, 4623–4630. [Google Scholar] [CrossRef]
- Wang, G.; Zhai, Z.; Ren, F.; Li, Z.; Zhang, B.; Hao, Y. Combined transcriptomic and proteomic analysis of the response to bile stress in a centenarian-originated probiotic Lactobacillus salivarius Ren. Food Res. Int. 2020, 137, 109331. [Google Scholar] [CrossRef]
- Ruas-Madiedo, P.; Hernández-Barranco, A.; Margolles, A.; de los Reyes-Gavilán, C.G. A bile salt-resistant derivative of Bifidobacterium animalis has an altered fermentation pattern when grown on glucose and maltose. Appl. Environ. Microbiol. 2005, 71, 6564–6570. [Google Scholar] [CrossRef]
- Fares, C.; Menga, V.; Martina, A.; Pellegrini, N.; Scazzina, F.; Torriani, S. Nutritional profile and cooking quality of a new functional pasta naturally enriched in phenolic acids, added with β-glucan and Bacillus coagulans GBI-30, 6086. J. Cereal Sci. 2015, 65, 260–266. [Google Scholar] [CrossRef]
- Scariot, M.C.; Venturelli, G.L.; Prudêncio, E.S.; Arisi, A.C.M. Quantification of Lactobacillus paracasei viable cells in probiotic yoghurt by propidium monoazide combined with quantitative PCR. Int. J. Food Microbiol. 2018, 264, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Bierschenk, D.; Top, J.; Anastasiou, I.; Bonten, M.J.; Willems, R.J.; van Schaik, W. Functional genomic analysis of bile salt resistance in Enterococcus faecium. BMC Genom. 2013, 14, 299. [Google Scholar] [CrossRef]
- Chen, F.; Mackey, A.J.; Stoeckert, C.J., Jr.; Roos, D.S. OrthoMCL-DB: Querying a comprehensive multi-species collection of ortholog groups. Nucleic Acids Res. 2006, 34, D363–D368. [Google Scholar] [CrossRef] [PubMed]
- Tatusova, T.; DiCuccio, M.; Badretdin, A.; Chetvernin, V.; Nawrocki, E.P.; Zaslavsky, L.; Lomsadze, A.; Pruitt, K.D.; Borodovsky, M.; Ostell, J. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016, 44, 6614–6624. [Google Scholar] [CrossRef] [PubMed]
- Borodovsky, M.; McIninch, J. GENMARK: Parallel gene recognition for both DNA strands. Comput. Chem. 1993, 17, 123–133. [Google Scholar] [CrossRef]
- Sayers, E.W.; Beck, J.; Bolton, E.E.; Bourexis, D.; Brister, J.R.; Canese, K.; Comeau, D.C.; Funk, K.; Kim, S.; Klimke, W. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2021, 49, D10–D17. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857, Erratum in Nat. Biotechnol. 2019, 37, 1091. [Google Scholar] [CrossRef]
- Oksanen, J.; Simpson, G.; Blanchet, F.; Kindt, R.; Legendre, P.; Minchin, P.; O’hara, R.; Solymos, P.; Stevens, H.; Szöcs, E. Vegan Community Ecology Package Version 2.6-2 April 2022. The Comprehensive R Archive Network. Available online: http://cran.r-project.org (accessed on 15 August 2022).
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
Figure 1.
Survival and germination characteristics of H. coagulans strains under simulated gastrointestinal conditions. (A) Oral survival rate; (B) Gastric survival rate; (C) intestinal germination rate (n = 3, ns, represent not significant, * p < 0.05).
Figure 1.
Survival and germination characteristics of H. coagulans strains under simulated gastrointestinal conditions. (A) Oral survival rate; (B) Gastric survival rate; (C) intestinal germination rate (n = 3, ns, represent not significant, * p < 0.05).
Figure 3.
Genome Venn Diagram of H. coagulans Strains.
Figure 4.
qRT-PCR of the bile salt resistance-related genes in H. coagulans. (A) Relative expression of the functional genes conferring bile salt resistance in H. coagulans ATCC 7050; (B) Relative expression of the functional genes conferring bile salt resistance in H. coagulans Idrc019.
Figure 4.
qRT-PCR of the bile salt resistance-related genes in H. coagulans. (A) Relative expression of the functional genes conferring bile salt resistance in H. coagulans ATCC 7050; (B) Relative expression of the functional genes conferring bile salt resistance in H. coagulans Idrc019.
Table 1.
Classification of H. coagulans strains according to their resistance to oxgall.
| 0.3% Oxgall | 0.6% Oxgall | |||
|---|---|---|---|---|
| Group | Bile Resistant Strains | Bile Sensitive Strains | Bile Resistant Strains | Bile Sensitive Strains |
| Delay of Growth | 40 < d < 60 min | d ≥ 60 min | 40 < d < 60 min | d ≥ 60 min |
| ATCC 7050 | + | + | ||
| ldrc001 | + | + | ||
| ldrc002 | + | + | ||
| ldrc003 | + | + | ||
| ldrc004 | + | + | ||
| ldrc005 | + | + | ||
| ldrc006 | + | + | ||
| ldrc007 | + | + | ||
| ldrc008 | + | + | ||
| ldrc009 | + | + | ||
| ldrc010 | + | + | ||
| ldrc011 | + | + | ||
| ldrc012 | + | + | ||
| ldrc013 | + | + | ||
| ldrc014 | + | + | ||
| ldrc015 | + | + | ||
| ldrc016 | + | + | ||
| ldrc017 | + | + | ||
| ldrc018 | + | + | ||
| ldrc019 | + | + | ||
| ldrc020 | + | + | ||
| ldrc021 | + | + | ||
| ldrc022 | + | + | ||
| ldrc023 | + | + | ||
| ldrc024 | + | + | ||
| ldrc025 | + | + | ||
| ldrc026 | + | + | ||
| ldrc027 | + | + | ||
| ldrc028 | + | + | ||
| ldrc029 | + | + | ||
| ldrc030 | + | + | ||
| ldrc031 | + | + | ||
| ldrc032 | + | + | ||
| ldrc033 | + | + | ||
| ldrc034 | + | + | ||
| ldrc035 | + | + | ||
| ldrc036 | + | + | ||
| ldrc037 | + | + | ||
| ldrc038 | + | + | ||
| ldrc039 | + | + | ||
| ldrc040 | + | + | ||
| ldrc041 | + | + | ||
| ldrc042 | + | + | ||
| ldrc043 | + | + | ||
| ldrc044 | + | + | ||
| ldrc045 | + | + | ||
| ldrc046 | + | + | ||
| ldrc047 | + | + | ||
| ldrc048 | + | + | ||
| ldrc049 | + | + | ||
| ldrc050 | + | + | ||
d: Delay of growth between the control and oxgall bile cultures; +: members of the group.
Table 2.
Functions of the different genes identified between the two groups of H. coagulans strains.
Table 2.
Functions of the different genes identified between the two groups of H. coagulans strains.
| Gene/Locus | Group | Significance Analysis | p Value | Function |
|---|---|---|---|---|
| BF29_941 | Variable Genes | ** | 0.0015 | Pilus assembly protein |
| dnaB | Variable Genes | ** | 0.0022 | Replicative DNA helicase |
| BF29_1335 | Variable Genes | ** | 0.0024 | Glucuronate isomerase |
| BF29_3030 | Variable Genes | ** | 0.0029 | Hypothetical protein: beta-phosphoglucomutase |
| BF29_3251 | Variable Genes | ** | 0.0011 | Glycerophosphoryl diester phosphodiesterase |
| Idrc033_000640 | Redundant Genes | *** | 0.0002 | Nitrate reductase delta subunit |
| Idrc033_000641 | Redundant Genes | *** | 0.0002 | Nitrate reductase gamma subunit |
| Idrc033_000643 | Redundant Genes | *** | 0.0002 | Nitrate/nitrite transporter |
| BF29_2700 | Redundant Genes | ** | 0.0002 | Fe3+-siderophore transport system ATP-binding protein |
| Idrc033_002157 | Redundant Genes | ** | 0.0013 | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase |
| Idrc033_002157 | Redundant Genes | ** | 0.0014 | Hypothetical kinase |
| Idrc033_002854 | Redundant Genes | ** | 0.0019 | D-mannonate dehydratase |
| Idrc033_000480 | Redundant Genes | ** | 0.0024 | Hypothetical phosphosugar isomerase |
| gnd | Redundant Genes | ** | 0.0024 | Hypothetical protein: 6-phosphogluconate dehydrogenase |
| Idrc033_002252 | Redundant Genes | ** | 0.0031 | L-rhamnose isomerase |
| lonB | Redundant Genes | ** | 0.0032 | ATP-dependent protease (hypothetical) |
| Idrc033_000639 | Redundant Genes | *** | 0.0004 | Nitrate reductase beta subunit |
Note: ** p < 0.01, *** p < 0.001.
Table 3.
Animal experimental protocol.
| Group | Control | ATCC 7050 | Idrc019 | Idrc033 | Idrc047 |
|---|---|---|---|---|---|
| 6 h | Normal feeding | Subgroup 1 euthanized | Subgroup 1 euthanized | Subgroup 1 euthanized | Subgroup 1 euthanized |
| 12 h | Normal feeding | Subgroup 2 euthanized | Subgroup 2 euthanized | Subgroup 2 euthanized | Subgroup 2 euthanized |
| 18 h | Normal feeding | Subgroup 3 euthanized | Subgroup 3 euthanized | Subgroup 3 euthanized | Subgroup 3 euthanized |
| 24 h | Normal feeding | Subgroup 4 euthanized | Subgroup 4 euthanized | Subgroup 4 euthanized | Subgroup 4 euthanized |
| 72 h | Normal feeding | Subgroup 5 euthanized | Subgroup 5 euthanized | Subgroup 5 euthanized | Subgroup 5 euthanized |
| 168 h | Euthanized | Subgroup 6 euthanized | Subgroup 6 euthanized | Subgroup 6 euthanized | Subgroup 6 euthanized |
Table 4.
H. coagulans primer information.
| Primer Name | Sequence (5′ to 3′) |
|---|---|
| BF29_941-F | ACATAGAGCTTTGCTGCACT |
| BF29_941-R | GCGGTTATTGTGATCCTGGC |
| BF29_1335-F | AGGAAACTGCGTGAATCGGT |
| BF29_1335-R | ATACAAGAAGCGGGATGCGT |
| BF29_3030-F | CGTGGAACCAGAACAATGCC |
| BF29_3030-R | CTCGCCGAACTTGAGGTCTT |
| BF29_3251-F | GACAAAACGATCCGCACGAG |
| BF29_3251-R | CAAAAGCTCTCGAAGCCTTCAT |
| 16S-F | GCATGGATTAAAAAGGAA |
| 16S-R | TAAAACTCTGTTGCCGGG |
Table 5.
qRT-PCR reaction system.
| Reagent | Reaction System |
|---|---|
| SYBR® Premix EX Taq II (Tli RNaseH Plus) (2×) | 10 |
| PCR Forward Primer | 1 |
| PCR Reverse Primer | 1 |
| DNA Template | 2 |
| dd H2O | 6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
MDPI and ACS Style
Jin, Y.-W.; Chen, F.; Cao, J. Bile Salt Tolerance Determines Intestinal Colonization Efficacy of Heyndrickxia coagulans: A Phenotypic and Genomic Study. Int. J. Mol. Sci. 2026, 27, 2022. https://doi.org/10.3390/ijms27042022
AMA Style
Jin Y-W, Chen F, Cao J. Bile Salt Tolerance Determines Intestinal Colonization Efficacy of Heyndrickxia coagulans: A Phenotypic and Genomic Study. International Journal of Molecular Sciences. 2026; 27(4):2022. https://doi.org/10.3390/ijms27042022
Chicago/Turabian StyleJin, Yi-Wei, Feng Chen, and Jiang Cao. 2026. "Bile Salt Tolerance Determines Intestinal Colonization Efficacy of Heyndrickxia coagulans: A Phenotypic and Genomic Study" International Journal of Molecular Sciences 27, no. 4: 2022. https://doi.org/10.3390/ijms27042022
APA StyleJin, Y.-W., Chen, F., & Cao, J. (2026). Bile Salt Tolerance Determines Intestinal Colonization Efficacy of Heyndrickxia coagulans: A Phenotypic and Genomic Study. International Journal of Molecular Sciences, 27(4), 2022. https://doi.org/10.3390/ijms27042022
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
