Associations of Inosine with Gut Microbiota, Metabolic Indicators, and Fluid Homeostasis in Kidney-Related Diarrhea
Abstract
1. Introduction
2. Results
2.1. General Condition of Each Group of Mice
2.2. The Impact of Inosine on Structural and Functional Alterations in the Kidney
2.3. The Impact of Inosine on Structural Changes in the Colon
2.4. The Impact of Inosine on CORT, ADH, and ATP Levels in Mice
2.5. The Effect of Inosine on AMPK and NF-κB mRNA Levels in Colon and Kidney
2.6. The Effect of Inosine on A2AR Protein Expression Levels in Colon and Kidney
2.7. The Effect of Inosine on AQP4 Expression in the Colon and Kidney
2.8. The Effect of Inosine on the Gut Microbiota in Mice
2.8.1. Gut Microbial Diversity in Each Group of Mice
2.8.2. Composition and Differences in the Gut Microbiota of Mice
2.8.3. The Effect of Inosine on the Characteristic Gut Microbiota
2.8.4. The Impact of Inosine on Gut Microbiota Function
2.9. Correlation Analysis of Gut Microbiota and Indicators
3. Discussion
3.1. Inosine Restores Metabolic Homeostasis and Modulates A2AR/AMPK/NF-κB-Associated Signaling in Kidney-Related Diarrhea
3.2. Inosine Alters Gut Microbiota and Microbiota-Associated Metabolic Functions
3.3. Limitations and Prospects
4. Materials and Methods
4.1. Drug and Kits Preparation
4.2. Experimental Animals Grouping and Modeling
4.3. General Observation and Measurement of Fecal Moisture Content
4.4. Measurement of BUN and Cr Levels in Serum
4.5. HE Staining for the Evaluation of Histopathological Alterations
4.6. ELISA for Detection of ATP, ADH, and CORT Levels
4.7. IHC Analysis of AQP4 Expression
4.8. RT-qPCR Detection of AMPK and NF-κB mRNA in Colon and Kidney
4.9. WB Measures A2AR Expression Levels in the Kidney and Colon
4.10. 16S rRNA Sequencing of Colon Content Microbiota
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| IMP | inosine monophosphate |
| AMP | Adenosine monophosphate |
| ATP | Adenosine triphosphate |
| AMPK | AMP-activated protein kinase |
| A2AR | Adenosine A2A Receptor |
| CORT | Corticosterone |
| ADH | Antidiuretic hormone |
| AQP4 | Aquaporin-4 |
| IHC | Immunohistochemistry |
| BUN | blood urea nitrogen |
| Cr | creatinine |
| HE | Hematoxylin and eosin |
| ASVs | Amplicon Sequence Variants |
| LEfSe | Linear Discriminant Analysis Effect Size |
| PCoA | Principal Coordinate Analysis |
| WB | Western Blot |
| HPA | hypothalamic–pituitary–adrenal |
| SCFAs | short-chain fatty acids |
References
- Li, F.; Zhang, J.; Kang, J.; Tong, X.; Zhang, P.; Zhu, Y. Inosine: Biofunctions and the Roles in Human Diseases. Front. Endocrinol. 2025, 16, 1634814. [Google Scholar] [CrossRef] [PubMed]
- Escudero, E.; Mora, L.; Aristoy, M.-C.; Toldrá, F. Possible Biological Markers of the Time of Processing of Dry-Cured Ham. Meat Sci. 2011, 89, 536–539. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Sun, L.; Ding, Y.; Zhuang, Y. Chemical Composition, Health Benefits, Food Processing Effects and Applications of Boletus: A Review. Crit. Rev. Food Sci. Nutr. 2024, 64, 10812–10834. [Google Scholar] [CrossRef] [PubMed]
- Jeyaraj, F.T.; Voruganti, V.S. Multifaceted Role of Inosine in Complex Diseases and Human Health. Nutr. Rev. 2025, 83, e506–e517. [Google Scholar] [CrossRef] [PubMed]
- Karger, G.; Dringen, R. Coapplication of Adenine with Inosine or Guanosine Supports Rapid ATP Restoration by ATP-Deprived Cultured Primary Astrocytes. Neurochem. Res. 2025, 50, 275. [Google Scholar] [CrossRef] [PubMed]
- Samami, E.; Aleebrahim-Dehkordi, E.; Mohebalizadeh, M.; Yaribash, S.; Saghazadeh, A.; Rezaei, N. Inosine, Gut Microbiota, and Cancer Immunometabolism. Am. J. Physiol. Endocrinol. Metab. 2023, 324, E1–E8. [Google Scholar] [CrossRef] [PubMed]
- Luo, W.; Li, R.; Pan, C.; Luo, C. Gut Microbiota-Derived Metabolites in Immunomodulation and Gastrointestinal Cancer Immunotherapy. Front. Immunol. 2025, 16, 1710880. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wang, J.; Shen, J.; Chen, S.; Yuan, H.; Zhang, X.; Liu, X.; Yu, Y.; Li, X.; Gao, Z.; et al. Prophylactic Supplementation with Bifidobacterium Infantis or Its Metabolite Inosine Attenuates Cardiac Ischemia/Reperfusion Injury. iMeta 2024, 3, e220. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Li, Q.; Fang, W.; Cai, L.; Wang, Z.; Kou, B.; Zhou, C.; Zhou, Y.; Yao, Z.; Wei, M.; et al. A2AR Regulate Inflammation through PKA/NF-κB Signaling Pathways in Intervertebral Disc Degeneration. Eur. J. Med. Res. 2024, 29, 433. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulou, G.; Valakos, D.; Polydouri, I.; Moulara, A.; Vatsellas, G.; Angiari, S.; Runtsch, M.C.; Foretz, M.; Viollet, B.; Cassotta, A.; et al. Adenosine 2A Receptor-Dependent Activation of AMPK Represses TH17 Cell Pathogenicity through Epigenetic and Metabolic Reprogramming. Sci. Signal. 2025, 18, eadr3177. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Guo, S.; Li, X.; Tian, Y.; Yu, Y.; Tang, L.; Sun, Q.; Zhang, T.; Fan, M.; Zhang, L.; et al. Semaglutide Alleviates Ovary Inflammation via the AMPK/SIRT1/NF-κB Signaling Pathway in Polycystic Ovary Syndrome Mice. Drug Des. Dev. Ther. 2024, 18, 3925–3938. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.; Guo, X.; Yan, J.; Tian, X.; Yang, W.; Cui, K.; Wang, L.; Guo, B. Neuregulin-4 Alleviates Isoproterenol (ISO)-Induced Cardial Remodeling by Inhibiting Inflammation and Apoptosis via AMPK/NF-κB Pathway. Int. Immunopharmacol. 2024, 143, 113301. [Google Scholar] [CrossRef] [PubMed]
- Kalantar-Zadeh, K.; Lockwood, M.B.; Rhee, C.M.; Tantisattamo, E.; Andreoli, S.; Balducci, A.; Laffin, P.; Harris, T.; Knight, R.; Kumaraswami, L.; et al. Patient-Centred Approaches for the Management of Unpleasant Symptoms in Kidney Disease. Nat. Rev. Nephrol. 2022, 18, 185–198. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Zhang, S.-J.; Zhuang, S.; Li, P.; Miao, H.; Zhao, Y.-Y. Microbiota-Gut-Kidney Axis in Health and Renal Disease. Int. J. Biol. Sci. 2026, 22, 751–770. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.-H.; Gong, Q.; Wang, Z.-L.; Li, C.; Wang, J.-N.; Yu, J.-T.; Ji, M.-L.; Zhang, D.-F.; Wei, J.; Xie, S.-S.; et al. Microbiota-Gut-Kidney Axis and Targeted Therapeutic Strategies in Kidney Diseases. Int. J. Biol. Sci. 2026, 22, 1142–1161. [Google Scholar] [CrossRef] [PubMed]
- Peng, H.; Peng, X.; Liu, Q.; Deng, N.; Xie, X.; Tan, Z. Novel Insights into Diarrhea Mechanism from Gut-Kidney Axis Perspective: Correlations among Intestinal Mucosal Injury, AQP4 Water Transport Disorder and Gut Microbiota Dysbiosis. 3 Biotech 2026, 16, 148. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Fang, L.; Peng, X.; Jiang, M.; Xie, X.; Tan, Z. The Interplay among Gut Microbial Composition, Short-Chain Fatty Acid Metabolism and Gut-Kidney Oxidative Stress: Correlation with Diarrhea. J. Inflamm. Res. 2026, 19, 588857. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Li, X.; Deng, N.; Peng, X.; Tan, Z. Diarrhea with Deficiency Kidney-Yang Syndrome Caused by Adenine Combined with Folium Senna Was Associated with Gut Mucosal Microbiota. Front. Microbiol. 2022, 13, 1007609. [Google Scholar] [CrossRef] [PubMed]
- Kaur, S.; Thakur, R. Gut Microbiota and Inflammatory Bowel Disease: Mechanisms, Clinical Implications, and Future Directions. Mol. Biol. Rep. 2025, 53, 47. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.; Li, Y.; Wang, D.; Sun, K. The Gut Microbiota and Its Metabolites: Novel Therapeutic Targets for Inflammatory Bowel Disease. Front. Immunol. 2025, 16, 1690279. [Google Scholar] [CrossRef] [PubMed]
- Mabley, J.G.; Pacher, P.; Liaudet, L.; Soriano, F.G.; Haskó, G.; Marton, A.; Szabó, C.; Salzman, A.L. Inosine Reduces Inflammation and Improves Survival in a Murine Model of Colitis. Am. J. Physiol.-Gastrointest. Liver Physiol. 2003, 284, G138–G144. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Tang, X.; Zhang, Q.; Zhao, J.; Mao, B.; Zhang, H.; Cui, S. Mitigation of Dextran-Sodium-Sulfate-Induced Colitis in Mice through Oral Administration of Microbiome-Derived Inosine and Its Underlying Mechanisms. Int. J. Mol. Sci. 2023, 24, 13852. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Gnanaprakasam, J.N.R.; Chen, X.; Kang, S.; Xu, X.; Sun, H.; Liu, L.; Rodgers, H.; Miller, E.; Cassel, T.A.; et al. Inosine Is an Alternative Carbon Source for CD8+-T-Cell Function under Glucose Restriction. Nat. Metab. 2020, 2, 635–647. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.; Lian, J.; Zhang, C.; Miu, Y.; Zhang, Y.; Shi, J.; Xu, N.; Jia, T. Comparative Effects of Raw and Processed Cistanche Glycosides on the HPT Axis and Gut Microbiota in a Rat Model of Kidney-Yang Deficiency. Front. Pharmacol. 2025, 16, 1597564. [Google Scholar] [CrossRef] [PubMed]
- Xiong, R.; Li, Y.; Zheng, K.; Zhang, T.; Gao, M.; Li, Y.; Lian, Y.; Chen, D.; Hu, C. Er Shen Wan Extract Alleviates Polyuria and Regulates AQP 2 and AVPR 2 in a Rat Model of Spleen-Kidney Yang Deficiency-Induced Diarrhea. Biomed. Pharmacother. 2019, 110, 302–311. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Wang, B.; Ao, H. Corticosterone Effects Induced by Stress and Immunity and Inflammation: Mechanisms of Communication. Front. Endocrinol. 2025, 16, 1448750. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Zeng, J.; Tang, L.; Geng, L.; Yu, X.; Deng, C.; Liu, H.; Huang, P.; Hong, E.; Hu, X. Regulation of 11β-HSD1 Reductase and the HPA Axis by Long-Snake Moxibustion in Kidney-Yang Deficiency Rats. Heliyon 2024, 10, e38486. [Google Scholar] [CrossRef] [PubMed]
- El-Shamarka, M.E.A.; Kozman, M.R.; Messiha, B.A.S. The Protective Effect of Inosine against Rotenone-Induced Parkinson’s Disease in Mice; Role of Oxido-Nitrosative Stress, ERK Phosphorylation, and A2AR Expression. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2020, 393, 1041–1053. [Google Scholar] [CrossRef] [PubMed]
- Yeung, E.S.H.; Tran, D.T.; Batchu, S.N.; Advani, S.L.; Liu, Y.; Kaur, H.; Yuen, D.A.; Aslam, R.; Luk, C.T.; Advani, A. Biphasic Actions of the Adenosine A2a Receptor Antagonist Istradefylline in Mice with Obstructive Uropathy. Sci. Rep. 2025, 15, 41110. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Zhuang, Z.; Wu, Q.; Lin, S.; Zhao, N.; Zhang, Q.; Xie, L.; Yu, S. CD39/CD73/A2a Adenosine Metabolic Pathway: Targets for Moxibustion in Treating DSS-Induced Ulcerative Colitis. Am. J. Chin. Med. 2021, 49, 661–676. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Fan, W.; Neng, L.; Chen, B.; Wang, Y.; Zuo, B.; Lu, W. Adenosine Improves LPS-Induced ROS Expression and Increasing in Monolayer Permeability of Endothelial Cell via Acting on A2AR. Microvasc. Res. 2022, 143, 104403. [Google Scholar] [CrossRef] [PubMed]
- Steinberg, G.R.; Hardie, D.G. New Insights into Activation and Function of the AMPK. Nat. Rev. Mol. Cell Biol. 2023, 24, 255–272. [Google Scholar] [CrossRef] [PubMed]
- Pan, S.-M.; Wang, C.-L.; Hu, Z.-F.; Zhang, M.-L.; Pan, Z.-F.; Zhou, R.-Y.; Wang, X.-J.; Huang, S.-W.; Li, Y.-Y.; Wang, Q.; et al. Baitouweng Decoction Repairs the Intestinal Barrier in DSS-Induced Colitis Mice via Regulation of AMPK/mTOR-Mediated Autophagy. J. Ethnopharmacol. 2024, 318, 116888. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Guo, C.; Li, Y.; Han, X.; Luo, X.; Chen, L.; Zhang, T.; Wang, N.; Wang, W. Alginate Oligosaccharides Ameliorate DSS-Induced Colitis through Modulation of AMPK/NF-κB Pathway and Intestinal Microbiota. Nutrients 2022, 14, 2864. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Zhang, J.; Chen, K.; Wang, J.; Xu, A.; Wang, Z. Donepezil Attenuates Inflammation and Apoptosis in Ulcerative Colitis via Regulating LRP1/AMPK/NF-κB Signaling. Pathol. Int. 2023, 73, 549–559. [Google Scholar] [CrossRef] [PubMed]
- Dias, L.; Nabais, A.M.; Borges-Martins, V.P.P.; Canas, P.M.; Cunha, R.A.; Agostinho, P. Impact of Glucocorticoid-Associated Stress-like Conditions on Aquaporin-4 in Cultured Astrocytes and Its Modulation by Adenosine A2A Receptors. J. Neurochem. 2025, 169, e16299. [Google Scholar] [CrossRef] [PubMed]
- Iş, Ş.; Ceman, D.; Iş, M.; Keser, N.; Tekin, Ş. Relcovaptan: A Promising Therapeutic Agent in Traumatic Spinal Cord Injury That Acts by Modulating Newly Identified Transcriptional Regulators of Aquaporins Compared to Tolvaptan. Turk. J. Med. Sci. 2025, 55, 1394–1407. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Jia, D.; Wu, Y.; Xu, Y. Antipyretic and Anti-Inflammatory Effects of Inosine, an Active Component of Kangfuxin. Immunobiology 2024, 229, 152812. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, U.; Fatima, F.; Farooq, H.A. Microbial Dysbiosis and Associated Disease Mechanisms in Maternal and Child Health. Infect. Immun. 2025, 93, e0017925. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, F.P.B.; de Luna Freire, M.O.; de Oliveira Coutinho, D.; de Santana Cirilo, M.A.; de Brito Alves, J.L. Gut Dysbiosis and Probiotic Therapy in Chronic Kidney Disease: A Comprehensive Review. Probiotics Antimicrob. Proteins 2025, 17, 1797–1819. [Google Scholar] [CrossRef] [PubMed]
- Ansari, S.; Purohit, K.J.; Shelke, A.B.; Shah, M.; Nkhoma, I.A.; Navale, A.M.; Wakchaure, R. Microbiota-Driven Mechanisms in Multisystem Diseases: Integrative Evidence across Cardiovascular, Metabolic, Neurological and Autoimmune Disorders. Antonie Leeuwenhoek 2026, 119, 83. [Google Scholar] [CrossRef] [PubMed]
- Ushakov, M.V. Functional Alpha Diversity: A New Distance-Based Measurement Calculations Technique That Accounts for Intraspecific Variability. Russ. J. Ecol. 2024, 55, 123–134. [Google Scholar] [CrossRef]
- Matchado, M.S.; Rühlemann, M.; Reitmeier, S.; Kacprowski, T.; Frost, F.; Haller, D.; Baumbach, J.; List, M. On the Limits of 16S rRNA Gene-Based Metagenome Prediction and Functional Profiling. Microb. Genom. 2024, 10, 001203. [Google Scholar] [CrossRef] [PubMed]
- Louis, P.; Flint, H.J. Formation of Propionate and Butyrate by the Human Colonic Microbiota. Environ. Microbiol. 2017, 19, 29–41. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.; Yang, T.; Tian, Z.; Shi, C.; Yan, C.; Li, H.; Du, Y.; Li, G. Progress in the Investigation of the Firmicutes/Bacteroidetes Ratio as a Potential Pathogenic Factor in Ulcerative Colitis. J. Med. Microbiol. 2025, 74. [Google Scholar] [CrossRef] [PubMed]
- Lozupone, C.A.; Stombaugh, J.I.; Gordon, J.I.; Jansson, J.K.; Knight, R. Diversity, Stability and Resilience of the Human Gut Microbiota. Nature 2012, 489, 221–230. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Gao, T.; Chen, G.; Liang, Y.; Nie, X.; Gu, W.; Li, L.; Tong, H.; Huang, W.; Lu, T.; et al. Vinegar-Processed Schisandra Chinensis Enhanced Therapeutic Effects on Colitis-Induced Depression through Tryptophan Metabolism. Phytomedicine 2024, 135, 156057. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Xi, Y.; Gu, F.; Peng, L.; Li, J. Protective Effects of a Polyherbal Mixture on Intestinal Injury via the NF-κB Signaling Pathway and Gut Microbiota Modulation in Hyperuricemic Mice. Foods 2025, 14, 1118. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Zhang, L.; Wang, X.; Yi, Y.; Shan, Y.; Liu, B.; Zhou, Y.; Lü, X. Roles of Intestinal Parabacteroides in Human Health and Diseases. FEMS Microbiol. Lett. 2022, 369, fnac072. [Google Scholar] [CrossRef] [PubMed]
- Wexler, H.M. Bacteroides: The Good, the Bad, and the Nitty-Gritty. Clin. Microbiol. Rev. 2007, 20, 593–621. [Google Scholar] [CrossRef] [PubMed]
- Jia, D.; Wang, Q.; Hu, Y.; He, J.; Ge, Q.; Qi, Y.; Chen, L.; Zhang, Y.; Fan, L.; Lin, Y.; et al. Lactobacillus johnsonii Alleviates Colitis by TLR1/2-STAT3 Mediated CD206+ macrophagesIL-10 Activation. Gut Microbes 2022, 14, 2145843. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Nie, Q.; Sun, Y.; Zuo, S.; Chen, C.; Li, S.; Yang, J.; Hu, J.; Zhou, X.; Yu, Y.; et al. Bacteroides Uniformis Degrades β-Glucan to Promote Lactobacillus johnsonii Improving Indole-3-Lactic Acid Levels in Alleviating Colitis. Microbiome 2024, 12, 177. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.B.; Baiseitova, A.; Zahoor, M.; Ahmad, I.; Ikram, M.; Bakhsh, A.; Shah, M.A.; Ali, I.; Idress, M.; Ullah, R.; et al. Probiotic Significance of Lactobacillus Strains: A Comprehensive Review on Health Impacts, Research Gaps, and Future Prospects. Gut Microbes 2024, 16, 2431643. [Google Scholar] [CrossRef] [PubMed]
- Miao, H.; Liu, F.; Wang, Y.-N.; Yu, X.-Y.; Zhuang, S.; Guo, Y.; Vaziri, N.D.; Ma, S.-X.; Su, W.; Shang, Y.-Q.; et al. Targeting Lactobacillus johnsonii to Reverse Chronic Kidney Disease. Signal Transduct. Target. Ther. 2024, 9, 195. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Fang, L.; Wu, Y.; Deng, N.; Peng, X.; Li, D.; Tan, Z. Intestinal Microbiota Dysbiosis Disrupts the Mucosal Barrier, Triggering Inflammatory Responses in Gut-Kidney Interaction and Exacerbating Diarrhea. J. Inflamm. Res. 2025, 18, 9379–9399. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Jiang, F.; Tan, Z.; Xiao, N. Research on the Combination of Polygonatum Sibiricum and Poria Cocos for Preventing Constipation Due to Pi Deficiency. Biosci. Microbiota Food Health 2026, 45, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Peng, H.; Xie, X.; Jiang, M.; Peng, M.; Tan, Z. New Insights into Diarrhea Caused by High-Fat Diet and Fatigue: Gut Microbiota Dysbiosis-Driven Bile Acid Metabolism Disorder. Nutrients 2026, 18, 1317. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Hao, H.; Gao, Y.; Li, N.; Liu, Z.; Shu, L.; Wang, Q.; Zhang, L. Dapagliflozin Ameliorates Kidney Injury Following Limb Ischemia-Reperfusion via the AMPK/SIRT1/NLRP3 Pathway. Ren. Fail. 2025, 47, 2495111. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; He, W.; Li, W.; Cai, J.; Wang, Z.; Li, K.; Qin, G.; Gu, X.; Lin, X.; Ma, L.; et al. Arctiin, a Lignan Compound, Enhances Adipose Tissue Browning and Energy Expenditure by Activating the Adenosine A2A Receptor. Mol. Med. 2025, 31, 188. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Fang, L.; Tan, Z.; Xiao, N.; Peng, M. The Effects of Functional Biscuits on Intestinal Mucosal Microbiota Composition, Brain Function, and Antioxidant Activity. Biosci. Microbiota Food Health 2025, 44, 171–181. [Google Scholar] [CrossRef] [PubMed]












| Primer | Primer F | Primer R | Product Length (bp) |
|---|---|---|---|
| GAPDH | TGCCCCCATGTTTGTGATG | TGTGGTCATGAGCCCTTCC | 151 |
| AMPK | AAGTGAAGGTGGGCAAGCAC | GGCTTTCCTTTTCGTCCAACC | 264 |
| NF-κB | ACCTGTTCCAAAGAGCACCC | CAAGGCCCCCAAGTCTTCAT | 94 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Peng, H.; Liu, Q.; Tan, Z. Associations of Inosine with Gut Microbiota, Metabolic Indicators, and Fluid Homeostasis in Kidney-Related Diarrhea. Int. J. Mol. Sci. 2026, 27, 6540. https://doi.org/10.3390/ijms27156540
Peng H, Liu Q, Tan Z. Associations of Inosine with Gut Microbiota, Metabolic Indicators, and Fluid Homeostasis in Kidney-Related Diarrhea. International Journal of Molecular Sciences. 2026; 27(15):6540. https://doi.org/10.3390/ijms27156540
Chicago/Turabian StylePeng, Huiyi, Qin Liu, and Zhoujin Tan. 2026. "Associations of Inosine with Gut Microbiota, Metabolic Indicators, and Fluid Homeostasis in Kidney-Related Diarrhea" International Journal of Molecular Sciences 27, no. 15: 6540. https://doi.org/10.3390/ijms27156540
APA StylePeng, H., Liu, Q., & Tan, Z. (2026). Associations of Inosine with Gut Microbiota, Metabolic Indicators, and Fluid Homeostasis in Kidney-Related Diarrhea. International Journal of Molecular Sciences, 27(15), 6540. https://doi.org/10.3390/ijms27156540

