Akkermansia muciniphila Alleviates Enterococcus faecalis-Exacerbated Alcoholic Liver Injury by Modulating Gut Microbiota and Barrier Function
Abstract
1. Introduction
2. Results
2.1. Enterococcus faecalis Exacerbates Acute Ethanol-Induced Liver Injury
2.2. Enterococcus faecalis Aggravates Gut Microbiota Dysbiosis, with Campylobacterota Enrichment
2.3. Akk11 Mitigates Intestinal Inflammation and Liver Damage
2.4. Akk11 Ameliorates Ethanol/E. faecalis-Induced Gut Dysbiosis and Barrier Dysfunction
2.5. Mechanisms of Helicobacter typhlonius and Bacteroides sartorii in the Gut–Liver Axis and Protective Effect of Akk11
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture
4.2. Animal Experimental Design
4.3. Acute Ethanol Exposure Model
4.4. Sample Collection and Organ Index Calculation
4.5. Biochemical and Cytokine Analysis
4.6. Histopathological Evaluation
4.7. Gut Permeability and Tight Junction Gene Expression
4.8. 16S rRNA Gene Sequencing and Bioinformatics Analysis
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A

Appendix B
| Primers | Sequence (5′ to 3′) |
| clyLl-F | ATGGAAAATTTAAGTGTAGTTCCTAG |
| ClyLl-R | TTAACAATGTTTTAAAGACACAACTAC |
| ClyLs-F | GTGCTAAATAAGGAAAATCAAGAAAAC |
| ClyLs-R | TTAGCAAAATTTAGCTGAAAATAATGC |
| Ef-F | CGCTTCTTTCCTCCCGAGT |
| Ef--R | GCCATGCGGCATAAACTG |
| Atg7-F | TGGCTGCTACTTCTGCAATGAT |
| Atg7-R | CAGGACAGAGACCATCAGCTCC |
| Occludin-F | TGGCTATGGAGGCGGCTATGG |
| Occludin-R | AAGGAAGCGATGAAGCAGAAGGC |
| Claudin-F | GCTGGGTTTCATCCTGGCTTCTC |
| Claudin-R | CCTGAGCGGTCACGATGTTGTC |
| ZO-1-F | GCGAACAGAAGGAGCGAGAAGAG |
| ZO-1-R | GCTTTGCGGGCTGACTGGAG |
| MUC2-F | GAAGCCAGATCCCGAAACCA |
| MUC2-R | TGTAGGAGTCTCGGCAGTCA |
| β-actin-F | CTACCTCATGAAGATCCTGACC |
| β-actin-R | CACAGCTTCTCTTTGATGTCAC |
References
- Seitz, H.K.; Bataller, R.; Cortez-Pinto, H.; Gao, B.; Gual, A.; Lackner, C.; Mathurin, P.; Mueller, S.; Szabo, G.; Tsukamoto, H. Alcoholic liver disease. Nat. Rev. Dis. Primers 2018, 4, 16, Correction in Nat. Rev. Dis. Primers 2018, 4, 18. [Google Scholar] [CrossRef] [Scilit]
- Asrani, S.K.; Devarbhavi, H.; Eaton, J.; Kamath, P.S. Burden of liver diseases in the world. J. Hepatol. 2019, 70, 151–171. [Google Scholar] [CrossRef] [Scilit]
- Teschke, R. Alcoholic Liver Disease: Alcohol Metabolism, Cascade of Molecular Mechanisms, Cellular Targets, and Clinical Aspects. Biomedicines 2018, 6, 106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petrasek, J.; Iracheta-Vellve, A.; Csak, T.; Satishchandran, A.; Kodys, K.; Kurt-Jones, E.A.; Fitzgerald, K.A.; Szabo, G. STING-IRF3 pathway links endoplasmic reticulum stress with hepatocyte apoptosis in early alcoholic liver disease. Proc. Natl. Acad. Sci. USA 2013, 110, 16544–16549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heo, M.J.; Kim, T.H.; You, J.S.; Blaya, D.; Sancho-Bru, P.; Kim, S.G. Alcohol dysregulates miR-148a in hepatocytes through FoxO1, facilitating pyroptosis via TXNIP overexpression. Gut 2019, 68, 708–720. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.Y.; Wang, M.; Yu, H.M.; Han, F.X.; Wu, Q.S.; Cai, X.J.; Kurihara, H.; Chen, Y.X.; Li, Y.F.; He, R.R. Ferroptosis is involved in alcohol-induced cell death in vivo and in vitro. Biosci. Biotechnol. Biochem. 2020, 84, 1621–1628. [Google Scholar] [CrossRef] [Scilit]
- Bajaj, J.S. Alcohol, liver disease and the gut microbiota. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 235–246. [Google Scholar] [CrossRef] [Scilit]
- Alexander, M.; Ang, Q.Y.; Nayak, R.R.; Bustion, A.E.; Sandy, M.; Zhang, B.; Upadhyay, V.; Pollard, K.S.; Lynch, S.V.; Turnbaugh, P.J. Human gut bacterial metabolism drives Th17 activation and colitis. Cell Host Microbe 2022, 30, 17–30.e19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, H.; Zhou, L.; Zhang, H.; Yang, Y.; Jiang, L.; Wu, D.; Shu, H.; Zhang, H.; Xie, L.; Zhou, K.; et al. Dietary fiber alleviates alcoholic liver injury via Bacteroides acidifaciens and subsequent ammonia detoxification. Cell Host Microbe 2024, 32, 1331–1346.e6. [Google Scholar] [CrossRef] [Scilit]
- Addolorato, G.; Ponziani, F.R.; Dionisi, T.; Mosoni, C.; Vassallo, G.A.; Sestito, L.; Petito, V.; Picca, A.; Marzetti, E.; Tarli, C.; et al. Gut microbiota compositional and functional fingerprint in patients with alcohol use disorder and alcohol-associated liver disease. Liver Int. 2020, 40, 878–888. [Google Scholar] [CrossRef] [Scilit]
- Zhong, X.; Cui, P.; Jiang, J.; Ning, C.; Liang, B.; Zhou, J.; Tian, L.; Zhang, Y.; Lei, T.; Zuo, T.; et al. Streptococcus, the Predominant Bacterium to Predict the Severity of Liver Injury in Alcoholic Liver Disease. Front. Cell. Infect. Microbiol. 2021, 11, 649060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, W.; Kong, D. The intestinal microbiota as a therapeutic target in the treatment of NAFLD and ALD. Biomed. Pharmacother. 2021, 135, 111235. [Google Scholar] [CrossRef] [Scilit]
- Brown, J.M.; Hazen, S.L. The gut microbial endocrine organ: Bacterially derived signals driving cardiometabolic diseases. Annu. Rev. Med. 2015, 66, 343–359. [Google Scholar] [CrossRef] [Scilit]
- Zhong, W.; Zhou, Z. Alterations of the gut microbiome and metabolome in alcoholic liver disease. World J. Gastrointest. Pathophysiol. 2014, 5, 514–522. [Google Scholar] [CrossRef] [Scilit]
- Mackowiak, B.; Fu, Y.; Maccioni, L.; Gao, B. Alcohol-associated liver disease. J. Clin. Investig. 2024, 134, e176345. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Z.; Yang, L.; Chu, H. The role of gut microbiota, exosomes, and their interaction in the pathogenesis of ALD. J. Adv. Res. 2025, 72, 353–367. [Google Scholar] [CrossRef] [Scilit]
- Szabo, G. Gut-liver axis in alcoholic liver disease. Gastroenterology 2015, 148, 30–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milosevic, I.; Vujovic, A.; Barac, A.; Djelic, M.; Korac, M.; Radovanovic Spurnic, A.; Gmizic, I.; Stevanovic, O.; Djordjevic, V.; Lekic, N.; et al. Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. Int. J. Mol. Sci. 2019, 20, 395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.; Tang, R.; Li, B.; Ma, X.; Schnabl, B.; Tilg, H. Gut microbiome, liver immunology, and liver diseases. Cell. Mol. Immunol. 2021, 18, 4–17. [Google Scholar] [CrossRef] [Scilit]
- Alvarado-Tapias, E.; Pose, E.; Gratacós-Ginès, J.; Clemente-Sánchez, A.; López-Pelayo, H.; Bataller, R. Alcohol-associated liver disease: Natural history, management and novel targeted therapies. Clin. Mol. Hepatol. 2025, 31, S112–S133. [Google Scholar] [CrossRef] [Scilit]
- Duan, Y.; Llorente, C.; Lang, S.; Brandl, K.; Chu, H.; Jiang, L.; White, R.C.; Clarke, T.H.; Nguyen, K.; Torralba, M.; et al. Bacteriophage targeting of gut bacterium attenuates alcoholic liver disease. Nature 2019, 575, 505–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cani, P.D.; Depommier, C.; Derrien, M.; Everard, A.; de Vos, W.M. Akkermansia muciniphila: Paradigm for next-generation beneficial microorganisms. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 625–637, Correction in Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 682. [Google Scholar] [CrossRef] [Scilit]
- Rodrigues, V.F.; Elias-Oliveira, J.; Pereira, Í.S.; Pereira, J.A.; Barbosa, S.C.; Machado, M.S.G.; Carlos, D. Akkermansia muciniphila and Gut Immune System: A Good Friendship That Attenuates Inflammatory Bowel Disease, Obesity, and Diabetes. Front. Immunol. 2022, 13, 934695. [Google Scholar] [CrossRef] [Scilit]
- Ioannou, A.; Berkhout, M.D.; Geerlings, S.Y.; Belzer, C. Akkermansia muciniphila: Biology, microbial ecology, host interactions and therapeutic potential. Nat. Rev. Microbiol. 2025, 23, 162–177. [Google Scholar] [CrossRef] [Scilit]
- Kang, E.J.; Kim, J.H.; Kim, Y.E.; Lee, H.; Jung, K.B.; Chang, D.H.; Lee, Y.; Park, S.; Lee, E.Y.; Lee, E.J.; et al. The secreted protein Amuc_1409 from Akkermansia muciniphila improves gut health through intestinal stem cell regulation. Nat. Commun. 2024, 15, 2983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, L.; Pan, Y.; Guo, Y.; Zhu, Y.; Jin, H.; Gu, Y.; Li, C.; Wang, Y.; Lin, J.; Chen, Y.; et al. Symbiotic combination of Akkermansia muciniphila and inosine alleviates alcohol-induced liver injury by modulating gut dysbiosis and immune responses. Front. Microbiol. 2024, 15, 1355225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grander, C.; Adolph, T.E.; Wieser, V.; Lowe, P.; Wrzosek, L.; Gyongyosi, B.; Ward, D.V.; Grabherr, F.; Gerner, R.R.; Pfister, A.; et al. Recovery of ethanol-induced Akkermansia muciniphila depletion ameliorates alcoholic liver disease. Gut 2018, 67, 891–901. [Google Scholar] [CrossRef] [Scilit]
- Feng, S.; Wang, W.; Zhang, X.; Helal, S.E.; Peng, N.; Zhang, Z. Investigating the role of Akkermansia muciniphila Akk11 in modulating obesity and intestinal dysbiosis: A comparative study of live and pasteurized treatments. Front. Microbiol. 2025, 16, 1638771. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Lopez, N.; Singh, R. Autophagy and Lipid Droplets in the Liver. Annu. Rev. Nutr. 2015, 35, 215–237. [Google Scholar] [CrossRef] [Scilit]
- Paillet, J.; Kroemer, G. Autophagy represses hepatic carcinogenesis. Mol. Cell. Oncol. 2019, 6, 1573080. [Google Scholar] [CrossRef] [Scilit]
- Fu, S.; Sun, H.; Wang, J.; Gao, S.; Zhu, L.; Cui, K.; Liu, S.; Qi, X.; Guan, R.; Fan, X.; et al. Impaired neuronal macroautophagy in the prelimbic cortex contributes to comorbid anxiety-like behaviors in rats with chronic neuropathic pain. Autophagy 2024, 20, 1559–1576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Li, F.; Lu, S.; Ren, L.; Bian, S.; Liu, M.; Zhao, D.; Wang, S.; Wang, J. Ginseng root extract attenuates inflammation by inhibiting the MAPK/NF-κB signaling pathway and activating autophagy and p62-Nrf2-Keap1 signaling in vitro and in vivo. J. Ethnopharmacol. 2022, 283, 114739. [Google Scholar] [CrossRef] [Scilit]
- Chancharoenthana, W.; Kamolratanakul, S.; Udompornpitak, K.; Wannigama, D.L.; Schultz, M.J.; Leelahavanichkul, A. Alcohol-induced gut permeability defect through dysbiosis and enterocytic mitochondrial interference causing pro-inflammatory macrophages in a dose dependent manner. Sci. Rep. 2025, 15, 14710. [Google Scholar] [CrossRef] [Scilit]
- Visitchanakun, P.; Saisorn, W.; Wongphoom, J.; Chatthanathon, P.; Somboonna, N.; Svasti, S.; Fucharoen, S.; Leelahavanichkul, A. Gut leakage enhances sepsis susceptibility in iron-overloaded β-thalassemia mice through macrophage hyperinflammatory responses. Am. J. Physiol. Gastrointest. Liver Physiol. 2020, 318, G966–G979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, V.; Mastromarino, P.; Garg, R. Effectiveness of Prophylactic Oral and/or Vaginal Probiotic Supplementation in the Prevention of Recurrent Urinary Tract Infections: A Randomized, Double-Blind, Placebo-Controlled Trial. Clin. Infect. Dis. 2024, 78, 1154–1161. [Google Scholar] [CrossRef] [Scilit]
- Kelly, J.R.; Borre, Y.; O’Brien, C.; Patterson, E.; El Aidy, S.; Deane, J.; Kennedy, P.J.; Beers, S.; Scott, K.; Moloney, G.; et al. Transferring the blues: Depression-associated gut microbiota induces neurobehavioural changes in the rat. J. Psychiatr. Res. 2016, 82, 109–118. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Cao, L.; Li, S.; Zhang, M.; Li, Y.; Duan, J.; Li, Y.; Hu, Z.; Wu, J.; Ni, J.; et al. Gut microbiota dysbiosis-mediated ceramides elevation contributes to corticosterone-induced depression by impairing mitochondrial function. npj Biofilms Microbiomes 2024, 10, 111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spiegelhauer, M.R.; Offersen, S.M.; Mao, X.; Gambino, M.; Sandris Nielsen, D.; Nguyen, D.N.; Brunse, A. Protection against experimental necrotizing enterocolitis by fecal filtrate transfer requires an active donor virome. Gut Microbes 2025, 17, 2486517. [Google Scholar] [CrossRef] [Scilit]
- Scarlata, G.G.M.; Belančić, A.; Štimac, D.; Fajkić, A.; Meštrović, T.; Abenavoli, L. Bacteriophage Therapy Against Shigella spp.: A Precision Antimicrobial Strategy. Antibiotics 2026, 15, 317. [Google Scholar] [CrossRef] [Scilit]
- Nacaroglu, M.B.; Karaynir, A.; Özkan, R.G.; Yalcin, M.; Türkyılmaz, S.; Aslantaş, Ö. Isolation and characterization of a therapeutic lytic phage cocktail against mastitis-associated Enterococcus faecalis with antibiofilm activity and in vivo efficacy. Vet. Microbiol. 2026, 318, 111046. [Google Scholar] [CrossRef] [Scilit]
- Aburto, M.R.; Cryan, J.F. Gastrointestinal and brain barriers: Unlocking gates of communication across the microbiota–gut–brain axis. Nat. Rev. Gastroenterol. Hepatol. 2024, 21, 365, Correction in Nat. Rev. Gastroenterol. Hepatol 2024, 21, 222–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Longo, S.; Rizza, S.; Federici, M. Microbiota-gut-brain axis: Relationships among the vagus nerve, gut microbiota, obesity, and diabetes. Acta Diabetol. 2023, 60, 1007–1017. [Google Scholar] [CrossRef] [Scilit]
- Loh, J.S.; Mak, W.Q.; Tan, L.K.S.; Ng, C.X.; Chan, H.H.; Yeow, S.H.; Foo, J.B.; Ong, Y.S.; How, C.W.; Khaw, K.Y. Microbiota–gut–brain axis and its therapeutic applications in neurodegenerative diseases. Signal Transduct. Target. Ther. 2024, 9, 1–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leclercq, S.; Matamoros, S.; Cani, P.D.; Neyrinck, A.M.; Jamar, F.; Stärkel, P.; Windey, K.; Tremaroli, V.; Bäckhed, F.; Verbeke, K.; et al. Intestinal permeability, gut-bacterial dysbiosis, and behavioral markers of alcohol-dependence severity. Proc. Natl. Acad. Sci. 2014, 111, E4485–E4493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Li, Q.; Zhang, W.; Xu, Y.; Nie, X.; Wang, X.; Chen, C.; Xie, J.; Nie, S. Akkermansia muciniphila- derived extracellular vesicles alleviate colitis-related cognitive impairment via tryptophan metabolic reprogramming of the gut–brain axis. Gut Microbes 2026, 18, 2611546. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Wang, Z.; Liu, X.; Liu, X.; Liu, T.; Feng, Y.; Yuan, Z.; Jia, Z.; Zhang, Y. Akkermansia muciniphila administration ameliorates streptozotocin-induced hyperglycemia and muscle atrophy by promoting IGF2 secretion from mouse intestine. iMeta 2024, 3, e237. [Google Scholar] [CrossRef] [Scilit]
- Derrien, M.; Vaughan, E.E.; Plugge, C.M.; de Vos, W.M. Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol. 2004, 54, 1469–1476. [Google Scholar] [CrossRef] [Scilit]









Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Sui, X.; Feng, S.; Wang, W.; Zhang, X.; Liu, Y.; Peng, N. Akkermansia muciniphila Alleviates Enterococcus faecalis-Exacerbated Alcoholic Liver Injury by Modulating Gut Microbiota and Barrier Function. Int. J. Mol. Sci. 2026, 27, 5474. https://doi.org/10.3390/ijms27125474
Sui X, Feng S, Wang W, Zhang X, Liu Y, Peng N. Akkermansia muciniphila Alleviates Enterococcus faecalis-Exacerbated Alcoholic Liver Injury by Modulating Gut Microbiota and Barrier Function. International Journal of Molecular Sciences. 2026; 27(12):5474. https://doi.org/10.3390/ijms27125474
Chicago/Turabian StyleSui, Xin, Songhui Feng, Weitao Wang, Xin Zhang, Yang Liu, and Nan Peng. 2026. "Akkermansia muciniphila Alleviates Enterococcus faecalis-Exacerbated Alcoholic Liver Injury by Modulating Gut Microbiota and Barrier Function" International Journal of Molecular Sciences 27, no. 12: 5474. https://doi.org/10.3390/ijms27125474
APA StyleSui, X., Feng, S., Wang, W., Zhang, X., Liu, Y., & Peng, N. (2026). Akkermansia muciniphila Alleviates Enterococcus faecalis-Exacerbated Alcoholic Liver Injury by Modulating Gut Microbiota and Barrier Function. International Journal of Molecular Sciences, 27(12), 5474. https://doi.org/10.3390/ijms27125474

