NGR1 Pretreatment Enhances the Therapeutic Efficacy of Transplanting Cardiomyocytes Derived from Human Induced Pluripotent Stem Cells for Myocardial Infarction
Abstract
1. Introduction
2. Results
2.1. Induction of hiPSC Differentiation and Detection of Myocardial Markers
2.2. Transplantation of hiPSC-CMs with NGR1 Pretreatment Improves Cardiac Function
2.3. NGR1-Pretreated hiPSC-CM Transplantation Reduces Infarct Area and Collagen Deposition
2.4. NGR1 Pretreatment Enhances Survival of Transplanted hiPSC-CMs
2.5. NGR1 Pretreatment Reduces Apoptosis in Cardiac Tissue
2.6. NGR1-Pretreated hiPSC-CM Transplantation Promotes Angiogenesis
2.7. NGR1-Pretreated hiPSC-CM Transplantation Enhances Lymphangiogenesis
2.8. NGR1-Pretreated hiPSC-CM Transplantation Stimulates Paracrine Secretion
2.9. Regulation of PI3K/Akt Signaling Pathway in hiPSC-CMs by NGR1
3. Discussion
4. Materials and Methods
4.1. hiPSC Cultivation
4.2. Induced Differentiation of hiPSC
4.3. Detection of Cardiac Cell Markers in hiPSC-CM
4.4. CCK8 Testing
4.5. Western Blot
4.6. Nude Mouse Model and Cell Transplantation
4.7. Echocardiography
4.8. Masson’s Trichrome Staining
4.9. Immunofluorescence Staining
4.10. RT-qPCR Detection
4.11. Statistical Analysis
4.12. Experimental Flowchart
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| NGR1 | Panax notoginseng saponin R1 |
| hiPSC | human induced pluripotent stem cell |
| hiPSC-CMs | human induced pluripotent stem cell derived cardiomyocytes |
| LAD | left anterior descending branch |
| MI | myocardial infarction |
| EF | ejection fraction |
| FS | fractional shortening |
| LVEDV | left ventricular end diastolic volume |
| LVESV | left ventricular end systolic volume |
| LVIDd | left ventricular diastolic diameter |
| LVIDs | left ventricular systolic diameter |
| MSCs | mesenchymal stem cells |
| VEGF | vascular endothelial growth factor A |
| VEGFC | vascular endothelial growth factor C |
| IGF-1 | insulin-like growth factor-1 |
| SDF-1 | stromal cell-derived factor-1 |
| SCF | stem cell factor |
| GAPDH | glyceraldehyde-3-phosphate dehydrogenase |
| MIRI | myocardial ischemia-reperfusion injury |
| HNA | human nuclear antigen |
| cTnT | cardiac troponin T |
| vWF | von Willebrand Factor |
| PCI | percutaneous coronary intervention |
| PI3K | phosphatidylinositol 3-kinase |
| RTKs | receptor tyrosine kinases |
| PIP2 | phosphatidylinositol 4,5-bisphosphate |
| PIP3 | phosphatidylinositol 3,4,5-triphosphate |
| Akt | protein kinase B |
| FoxO1 | Forkhead box protein O1 |
| Wnt | Wingless-related integration site |
| JAK2 | Janus Kinase 2 |
| STAT3 | Signal Transducer and Activator of Transcription 3 |
| TAK1 | TGF-β-activated kinase 1 |
| JNK | c-Jun N-terminal kinase |
| p38 | p38 Mitogen-Activated Protein Kinase |
References
- Rao, S.V.; O’Donoghue, M.L.; Ruel, M.; Rab, T.; Tamis-Holland, J.E.; Alexander, J.H.; Baber, U.; Baker, H.; Cohen, M.G.; Cruz-Ruiz, M.; et al. 2025 ACC/AHA/ACEP/NAEMSP/SCAI Guideline for the Management of Patients With Acute Coronary Syndromes: A Report of the American College of Cardiology/American Heart Association Joint Committee on Clinical Practice Guidelines. J. Am. Coll. Cardiol. 2025, 85, 2135–2237, Correction in J. Am. Coll. Cardiol. 2025, 85, 1800. Correction in J. Am. Coll. Cardiol. 2025, 86, 2723. [Google Scholar] [CrossRef]
- Nicolau, A.M.; Silva, P.G.; Mejia, H.P.G.; Granada, J.F.; Kaluza, G.L.; Burkhoff, D.; Abizaid, T.; Pileggi, B.; Freire, A.F.D.; Godinho, R.R.; et al. Molecular Mechanisms of Microvascular Obstruction and Dysfunction in Percutaneous Coronary Interventions: From Pathophysiology to Therapeutics-A Comprehensive Review. Int. J. Mol. Sci. 2025, 26, 6835. [Google Scholar] [CrossRef]
- Wang, Y.; Xue, Y.; Guo, H.D. Intervention effects of traditional Chinese medicine on stem cell therapy of myocardial infarction. Front. Pharmacol. 2022, 13, 1013740. [Google Scholar] [CrossRef] [PubMed]
- Han, L.; Mich-Basso, J.; Kuhn, B. Generation of Human Induced Pluripotent Stem Cells and Differentiation into Cardiomyocytes. Methods Mol. Biol. 2021, 2158, 125–139. [Google Scholar] [CrossRef]
- Sugiura, T.; Shahannaz, D.C.; Ferrell, B.E. Current Status of Cardiac Regenerative Therapy Using Induced Pluripotent Stem Cells. Int. J. Mol. Sci. 2024, 25, 5772. [Google Scholar] [CrossRef] [PubMed]
- Ai, X.; Yan, B.; Witman, N.; Gong, Y.; Yang, L.; Tan, Y.; Chen, Y.; Liu, M.; Lu, T.; Luo, R.; et al. Transient secretion of VEGF protein from transplanted hiPSC-CMs enhances engraftment and improves rat heart function post MI. Mol. Ther. 2023, 31, 211–229. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.C.; Hsieh, M.L.; Lin, C.J.; Chang, C.M.C.; Huang, C.Y.; Puntney, R.; Wu Moy, A.; Ting, C.Y.; Herr Chan, D.Z.; Nicholson, M.W.; et al. Combined Treatment of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes and Endothelial Cells Regenerate the Infarcted Heart in Mice and Non-Human Primates. Circulation 2023, 148, 1395–1409. [Google Scholar] [CrossRef]
- Sun, B.; Wang, L.; Guo, W.; Chen, S.; Ma, Y.; Wang, D. New treatment methods for myocardial infarction. Front. Cardiovasc. Med. 2023, 10, 1251669. [Google Scholar] [CrossRef]
- Zhu, T.; Wan, Q. Pharmacological properties and mechanisms of Notoginsenoside R1 in ischemia-reperfusion injury. Chin. J. Traumatol. 2023, 26, 20–26. [Google Scholar] [CrossRef]
- Zeng, J.J.; Shi, H.Q.; Ren, F.F.; Zhao, X.S.; Chen, Q.Y.; Wang, D.J.; Wu, L.P.; Chu, M.P.; Lai, T.F.; Li, L. Notoginsenoside R1 protects against myocardial ischemia/reperfusion injury in mice via suppressing TAK1-JNK/p38 signaling. Acta Pharmacol. Sin. 2023, 44, 1366–1379. [Google Scholar] [CrossRef]
- Li, H.; Zhu, J.; Xu, Y.W.; Mou, F.F.; Shan, X.L.; Wang, Q.L.; Liu, B.N.; Ning, K.; Liu, J.J.; Wang, Y.C.; et al. Notoginsenoside R1-loaded mesoporous silica nanoparticles targeting the site of injury through inflammatory cells improves heart repair after myocardial infarction. Redox Biol. 2022, 54, 102384. [Google Scholar] [CrossRef]
- Cai, H.; Han, X.J.; Luo, Z.R.; Wang, Q.L.; Lu, P.P.; Mou, F.F.; Zhao, Z.N.; Hu, D.; Guo, H.D. Pretreatment with Notoginsenoside R1 enhances the efficacy of neonatal rat mesenchymal stem cell transplantation in model of myocardial infarction through regulating PI3K/Akt/FoxO1 signaling pathways. Stem Cell Res. Ther. 2024, 15, 419. [Google Scholar] [CrossRef]
- Guo, H.D.; Cui, G.H.; Tian, J.X.; Lu, P.P.; Zhu, Q.C.; Lv, R.; Shao, S.J. Transplantation of salvianolic acid B pretreated mesenchymal stem cells improves cardiac function in rats with myocardial infarction through angiogenesis and paracrine mechanisms. Int. J. Cardiol. 2014, 177, 538–542. [Google Scholar] [CrossRef]
- Nijak, A.; Simons, E.; Vandendriessche, B.; Van de Sande, D.; Fransen, E.; Sieliwończyk, E.; Van Gucht, I.; Van Craenenbroeck, E.; Saenen, J.; Heidbuchel, H.; et al. Morpho-functional comparison of differentiation protocols to create iPSC-derived cardiomyocytes. Biol. Open 2022, 11, bio059016. [Google Scholar] [CrossRef]
- Cai, S.; Dai, Q. Progress in preclinical research on induced pluripotent stem cell therapy for acute myocardial infarction. Zhejiang Da Xue Xue Bao Yi Xue Ban 2024, 53, 244–253. [Google Scholar] [CrossRef] [PubMed]
- Mehler, V.J.; Burns, C.J.; Stauss, H.; Francis, R.J.; Moore, M.L. Human iPSC-Derived Neural Crest Stem Cells Exhibit Low Immunogenicity. Mol. Ther. Methods Clin. Dev. 2020, 16, 161–171. [Google Scholar] [CrossRef]
- Kleinsorge, M.; Cyganek, L. Subtype-Directed Differentiation of Human iPSCs into Atrial and Ventricular Cardiomyocytes. STAR Protoc. 2020, 1, 100026. [Google Scholar] [CrossRef]
- Brazhkina, O.; Park, J.H.; Brown, M.; Walcott, J.C.; Han, J.; Turchetti, A.; Roychowdhury, S.; Prasad, R.S.; Kim, M.J.; Itzhaki, I.; et al. In vivo assessment of iPSC-cardiomyocyte loaded auxetic cardiac patches following chronic myocardial infarction. Biomaterials 2025, 323, 123418. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.Y.; Li, S.L.; Jiang, M.; Tao, B.; Cao, R.H.; Zhang, J.B.; Tian, L.; Liu, J.W.; Wang, H.B.; Cao, F. Biocompatibility of extracellular matrix hydrogel with human iPSCs differentiated cardiomyocytes. Zhonghua Xin Xue Guan Bing Za Zhi 2021, 49, 487–495. [Google Scholar]
- Jiang, Y.; Zhang, L.L.; Zhang, F.; Bi, W.; Zhang, P.; Yu, X.J.; Rao, S.L.; Wang, S.H.; Li, Q.; Ding, C.; et al. Dual human iPSC-derived cardiac lineage cell-seeding extracellular matrix patches promote regeneration and long-term repair of infarcted hearts. Bioact. Mater. 2023, 28, 206–226. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Shou, X.; Fan, Z.; Cui, J.; Xue, D.; Wu, Y. A Systematic Review and Meta-Analysis of Phytoestrogen Protects Against Myocardial Ischemia/Reperfusion Injury: Pre-Clinical Evidence From Small Animal Studies. Front. Pharmacol. 2022, 13, 847748. [Google Scholar] [CrossRef]
- Liu, Y.; Tong, C.; Tang, Y.; Cong, P.; Liu, Y.; Shi, X.; Shi, L.; Zhao, Y.; Jin, H.; Li, J.; et al. Tanshinone IIA alleviates blast-induced inflammation, oxidative stress and apoptosis in mice partly by inhibiting the PI3K/Akt/FoxO1 signaling pathway. Free Radic. Biol. Med. 2020, 152, 52–60. [Google Scholar] [CrossRef]
- He, X.D.; Li, M.; Zuo, X.D.; Ni, H.Y.; Han, Y.X.; Hu, Y.K.; Yu, J.; Yang, X.X. Kushenol I combats ulcerative colitis via intestinal barrier preservation and gut microbiota optimization. World J. Gastroenterol. 2025, 31, 105656. [Google Scholar] [CrossRef] [PubMed]
- Giha, H.A.; Alamin, O.A.O.; Sater, M.S. Diabetic sarcopenia: Metabolic and molecular appraisal. Acta Diabetol. 2022, 59, 989–1000. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zhao, L.; Shen, Y.; He, Y.; Cheng, G.; Yin, M.; Zhang, Q.; Qin, L. Curculigoside Protects against Excess-Iron-Induced Bone Loss by Attenuating Akt-FoxO1-Dependent Oxidative Damage to Mice and Osteoblastic MC3T3-E1 Cells. Oxid. Med. Cell Longev. 2019, 2019, 9281481. [Google Scholar] [CrossRef] [PubMed]
- Demeulenaere, O.; Sandoval, Z.; Mateo, P.; Dizeux, A.; Villemain, O.; Gallet, R.; Ghaleh, B.; Deffieux, T.; Demene, C.; Tanter, M.; et al. Coronary Flow Assessment Using 3-Dimensional Ultrafast Ultrasound Localization Microscopy. JACC Cardiovasc. Imaging 2022, 15, 1193–1208. [Google Scholar] [CrossRef]
- Prakash, R.O.; Chakrala, T.S.; Feuer, D.S.; Valdes, C.A.; Pepine, C.J.; Keeley, E.C. Critical role of the coronary microvasculature in heart disease: From pathologic driving force to “innocent” bystander. Am. Heart J. Plus 2022, 22, 100215. [Google Scholar] [CrossRef]
- Chiba, T.; Cerqueira, D.M.; Li, Y.; Bodnar, A.J.; Mukherjee, E.; Pfister, K.; Phua, Y.L.; Shaikh, K.; Sanders, B.T.; Hemker, S.L.; et al. Endothelial-Derived miR-17 approximately 92 Promotes Angiogenesis to Protect against Renal Ischemia-Reperfusion Injury. J. Am. Soc. Nephrol. 2021, 32, 553–562. [Google Scholar] [CrossRef]
- Klaourakis, K.; Vieira, J.M.; Riley, P.R. The evolving cardiac lymphatic vasculature in development, repair and regeneration. Nat. Rev. Cardiol. 2021, 18, 368–379. [Google Scholar] [CrossRef]
- Roh, K.; Li, H.; Freeman, R.N.; Zazzeron, L.; Lee, A.; Zhou, C.; Shen, S.; Xia, P.; Guerra, J.R.B.; Sheffield, C.; et al. Exercise-Induced Cardiac Lymphatic Remodeling Mitigates Inflammation in the Aging Heart. Aging Cell 2025, 24, e70043. [Google Scholar] [CrossRef]
- Salah, H.M.; Biegus, J.; Ponikowski, P.P.; Fudim, M. Role of Lymphatics in Heart Failure. J. Soc. Cardiovasc. Angiogr. Interv. 2023, 2, 101204. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Chen, X.; Swanson, T.A.; LaViolette, B.; Pang, J.; Cunio, T.; Nagle, M.W.; Asano, S.; Hales, K.; Shipstone, A.; et al. Lymphangiogenic therapy prevents cardiac dysfunction by ameliorating inflammation and hypertension. Elife 2020, 9, e58376. [Google Scholar] [CrossRef] [PubMed]
- Pichler Sekulic, S.; Sekulic, M. Neovascularization of native cardiac valves, and correlation with histopathologic, clinical, and radiologic features. Cardiovasc. Pathol. 2024, 69, 107605. [Google Scholar] [CrossRef] [PubMed]
- Reventun, P.; Sanchez-Esteban, S.; Cook-Calvete, A.; Delgado-Marin, M.; Roza, C.; Jorquera-Ortega, S.; Hernandez, I.; Tesoro, L.; Botana, L.; Zamorano, J.L.; et al. Endothelial ILK induces cardioprotection by preventing coronary microvascular dysfunction and endothelial-to-mesenchymal transition. Basic. Res. Cardiol. 2023, 118, 28. [Google Scholar] [CrossRef]
- Shimizu, Y.; Luo, H.; Murohara, T. Disease-Specific Alteration of Cardiac Lymphatics: A Review from Animal Disease Models to Clinics. Int. J. Mol. Sci. 2024, 25, 10656. [Google Scholar] [CrossRef]
- Cohen, B.; Tempelhof, H.; Raz, T.; Oren, R.; Nicenboim, J.; Bochner, F.; Even, R.; Jelinski, A.; Eilam, R.; Ben-Dor, S.; et al. BACH family members regulate angiogenesis and lymphangiogenesis by modulating VEGFC expression. Life Sci. Alliance 2020, 3, 4. [Google Scholar] [CrossRef]
- Wang, R.; Wei, W.; Rong, S.; Wang, T.; Li, B. Intravenous Injection of SDF-1alpha-overexpressing Bone Marrow Mesenchymal Stem Cells has a Potential Protective Effect on Myocardial Ischemia in Mice. Curr. Stem Cell Res. Ther. 2022, 17, 348–360. [Google Scholar] [CrossRef]
- Song, B.; Chen, D.; Liu, Z.; Cheng, Y.; Zhang, Z.; Han, W.; Zhang, R.; Gong, Y. Stromal cell-derived factor-1 exerts opposing roles through CXCR4 and CXCR7 in angiotensin II-induced adventitial remodeling. Biochem. Biophys. Res. Commun. 2022, 594, 38–45. [Google Scholar] [CrossRef]
- Ma, S.; Zhou, J.; Huang, T.; Zhang, Z.; Xing, Q.; Zhou, X.; Zhang, K.; Yao, M.; Cheng, T.; Wang, X.; et al. Sodium alginate/collagen/stromal cell-derived factor-1 neural scaffold loaded with BMSCs promotes neurological function recovery after traumatic brain injury. Acta Biomater. 2021, 131, 185–197, Erratum in Acta Biomater. 2021, 136, 596–597. [Google Scholar] [CrossRef]
- Li, Z.H.; Wang, Y.L.; Wang, H.J.; Wu, J.H.; Tan, Y.Z. Rapamycin-Preactivated Autophagy Enhances Survival and Differentiation of Mesenchymal Stem Cells After Transplantation into Infarcted Myocardium. Stem Cell Rev. Rep. 2020, 16, 344–356. [Google Scholar] [CrossRef]
- Zeng, B.; Liao, X.; Liu, L.; Zhang, C.; Ruan, H.; Yang, B. Thyroid hormone mediates cardioprotection against postinfarction remodeling and dysfunction through the IGF-1/PI3K/AKT signaling pathway. Life Sci. 2021, 267, 118977. [Google Scholar] [CrossRef]
- Xue, Z.; Yang, D.; Jin, Z.; Li, Y.; Yu, Y.; Zhao, X.; Huang, Y.; Jia, S.; Zhang, T.; Huang, G.; et al. IGF-1 secreted by mesenchymal stem cells affects the function of lymphatic endothelial progenitor cells: A potential strategy for the treatment of lymphedema. Front. Genet. 2025, 16, 1584095. [Google Scholar] [CrossRef]
- He, Y.; Lu, X.; Chen, T.; Yang, Y.; Zheng, J.; Chen, C.; Zhang, Y.; Lei, W. Resveratrol protects against myocardial ischemic injury via the inhibition of NF-kappaB-dependent inflammation and the enhancement of antioxidant defenses. Int. J. Mol. Med. 2021, 47, 29. [Google Scholar] [CrossRef]
- Onodi, Z.; Visnovitz, T.; Kiss, B.; Hambalko, S.; Koncz, A.; Agg, B.; Varadi, B.; Toth, V.E.; Nagy, R.N.; Gergely, T.G.; et al. Systematic transcriptomic and phenotypic characterization of human and murine cardiac myocyte cell lines and primary cardiomyocytes reveals serious limitations and low resemblances to adult cardiac phenotype. J. Mol. Cell Cardiol. 2022, 165, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Dababneh, S.; Hamledari, H.; Maaref, Y.; Jayousi, F.; Hosseini, D.B.; Khan, A.; Jannati, S.; Jabbari, K.; Arslanova, A.; Butt, M.; et al. Advances in Hypertrophic Cardiomyopathy Disease Modelling Using hiPSC-Derived Cardiomyocytes. Can. J. Cardiol. 2024, 40, 766–776. [Google Scholar] [CrossRef]
- McKenna, D.H.; Perlingeiro, R.C.R. Development of allogeneic iPS cell-based therapy: From bench to bedside. EMBO Mol. Med. 2023, 15, e15315. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Yang, Y.; Lu, Z.; Zhang, J.Z. Simultaneous Optical Imaging of Action Potentials and Calcium Transients in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes. Curr. Protoc. 2024, 4, e1101. [Google Scholar] [CrossRef]
- Altomare, C.; Bartolucci, C.; Sala, L.; Balbi, C.; Burrello, J.; Pietrogiovanna, N.; Burrello, A.; Bolis, S.; Panella, S.; Arici, M.; et al. A dynamic clamping approach using in silico IK1 current for discrimination of chamber-specific hiPSC-derived cardiomyocytes. Commun. Biol. 2023, 6, 291. [Google Scholar] [CrossRef]
- Lian, X.; Zhang, J.; Azarin, S.M.; Zhu, K.; Hazeltine, L.B.; Bao, X.; Hsiao, C.; Kamp, T.J.; Palecek, S.P. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/beta-catenin signaling under fully defined conditions. Nat. Protoc. 2013, 8, 162–175. [Google Scholar] [CrossRef] [PubMed]









| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| VEGF | CTGCCGTCCGATTGAGACC | CCCCTCCTTGTACCACTGTC |
| VEGFC | GAGGTCAAGGCTTTTGAAGGC | CTGTCCTGGTATTGAGGGTGG |
| IGF-1 | CTGGACCAGAGACCCTTTGC | GGACGGGGACTTCTGAGTCTT |
| SDF-1 | GCAGCCTTTCTCTTCTTCTGTC | ACTCCAAACTGTGCCCTTCA |
| SCF | GAATCTCCGAAGAGGCCAGAA | GCTGCAACAGGGGGTAACAT |
| GAPDH | AGGCCGGTGCTGAGTATGTC | TGCCTGCTTCACCACCTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Cai, H.; Huang, M.-Y.; Mou, F.-F.; Wang, Q.-L.; Luo, Z.-R.; Lu, P.-P.; Liu, B.-N.; Hu, L.; Guo, H.-D. NGR1 Pretreatment Enhances the Therapeutic Efficacy of Transplanting Cardiomyocytes Derived from Human Induced Pluripotent Stem Cells for Myocardial Infarction. Int. J. Mol. Sci. 2026, 27, 475. https://doi.org/10.3390/ijms27010475
Cai H, Huang M-Y, Mou F-F, Wang Q-L, Luo Z-R, Lu P-P, Liu B-N, Hu L, Guo H-D. NGR1 Pretreatment Enhances the Therapeutic Efficacy of Transplanting Cardiomyocytes Derived from Human Induced Pluripotent Stem Cells for Myocardial Infarction. International Journal of Molecular Sciences. 2026; 27(1):475. https://doi.org/10.3390/ijms27010475
Chicago/Turabian StyleCai, Hao, Meng-Ying Huang, Fang-Fang Mou, Qiang-Li Wang, Zhi-Rong Luo, Ping-Ping Lu, Bao-Nian Liu, Liang Hu, and Hai-Dong Guo. 2026. "NGR1 Pretreatment Enhances the Therapeutic Efficacy of Transplanting Cardiomyocytes Derived from Human Induced Pluripotent Stem Cells for Myocardial Infarction" International Journal of Molecular Sciences 27, no. 1: 475. https://doi.org/10.3390/ijms27010475
APA StyleCai, H., Huang, M.-Y., Mou, F.-F., Wang, Q.-L., Luo, Z.-R., Lu, P.-P., Liu, B.-N., Hu, L., & Guo, H.-D. (2026). NGR1 Pretreatment Enhances the Therapeutic Efficacy of Transplanting Cardiomyocytes Derived from Human Induced Pluripotent Stem Cells for Myocardial Infarction. International Journal of Molecular Sciences, 27(1), 475. https://doi.org/10.3390/ijms27010475

