Allele-Specific PCR for Detection of Missense Mutations in the Chimeric BCR::ABL1 Gene Causing Failure of Tyrosine Kinase Inhibitor Therapy in CML Patients
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. Next-Generation Sequencing
4.3. AS-PCR
4.4. Allele Ratio and VAF in AS-PCR Assays
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Braun, T.P.; Eide, C.A.; Druker, B.J. Response and Resistance to BCR-ABL1-Targeted Therapies. Cancer Cell 2020, 37, 530–542. [Google Scholar] [CrossRef]
- Goranova-Marinova, V.; Linev, A.; Ivanov, H.J.; Zheljazkov, I.; Stoyanova, V.; Grudeva-Popova, Z. Clinical characteristics, disease evolution and survival in patients with chronic myeloid leukemia, BCR-ABL1 (+) and T315I mutation. Folia Med. 2021, 63, 670–675. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Kim, S.; Kim, H.J.; Kim, Y.-K.; Kwak, J.-Y.; Yhim, H.-Y.; Kim, S.-H.; Do, Y.R.; Oh, S.; Lee, S.-E.; et al. Comparison of Frequency and Sensitivity of BCR-ABL1 Kinase Domain Mutations in Asian and White Patients With Imatinib-resistant Chronic-Phase Chronic Myeloid Leukemia. Clin. Lymphoma Myeloma Leuk. 2018, 18, 391–399. [Google Scholar] [CrossRef] [PubMed]
- Chahardouli, B.; Zaker, F.; Mousavi, S.A.; Kazemi, A.; Ostadali, M.; Nadali, F.; Rostami, S.; Alimoghaddam, K.; Ghavamzade, A. Evaluation of T315I mutation frequency in chronic myeloid leukemia patients after imatinib resistance. Hematology 2013, 18, 158–162. [Google Scholar] [CrossRef]
- Sun, J.; Hu, R.; Han, M.; Tan, Y.; Xie, M.; Gao, S.; Hu, J.F. Mechanisms underlying therapeutic resistance of tyrosine kinase inhibitors in chronic myeloid leukemia. Int. J. Biol. Sci. 2024, 20, 175–181. [Google Scholar] [CrossRef]
- Jabbour, E.; Parikh, S.A.; Kantarjian, H.; Cortes, J. Chronic myeloid leukemia: Mechanisms of resistance and treatment. Hematol. Oncol. Clin. N. Am. 2011, 25, 981–995. [Google Scholar] [CrossRef]
- Cortes, J.; Jabbour, E.; Kantarjian, H.; Yin, C.C.; Shan, J.; O’Brien, S.; Garcia-Manero, G.; Giles, F.; Breeden, M.; Reeves, N.; et al. Dynamics of BCR-ABL kinase domain mutations in chronic myeloid leukemia after sequential treatment with multiple tyrosine kinase inhibitors. Blood 2007, 110, 4005–4011. [Google Scholar] [CrossRef] [PubMed]
- Soverini, S. Resistance mutations in CML and how we approach them. Hematol. Am. Soc. Hematol. Educ. Program. 2023, 2023, 469–475. [Google Scholar] [CrossRef]
- Turkina, A.G.; Lomaia, E.G.; Morozova, E.V.; Vinogradova, O.Y.; Mitina, T.A.; Shatokhin, Y.V.; Ovsyannikova, E.G.; Vlasova, Y.Y.; Kulikov, S.M.; Chelysheva, E.Y. Evolution of therapeutic approaches in patients with chronic myeloid leukemia and T315I mutation. Oncohematology 2024, 19, 93–107. [Google Scholar] [CrossRef]
- Soverini, S.; Branford, S.; Nicolini, F.E.; Talpaz, M.; Deininger, M.W.N.; Martinelli, G.; Müller, M.C.; Radich, J.P.; Shah, N.P. Implications of BCR-ABL1 kinase domain-mediated resistance in chronic myeloid leukemia. Leuk. Res. 2014, 38, 10–20. [Google Scholar] [CrossRef]
- Kockerols, C.; Valk, P.J.M.; Blijlevens, N.M.A.; Cornelissen, J.J.; Dinmohamed, A.G.; Geelen, I.; Hoogendoorn, M.; Janssen, J.J.W.M.; Daenen, L.G.M.; Reijden, B.A.v.d. BCR::ABL1 kinase domain mutation testing and clinical outcome in a nationwide chronic myeloid leukemia patient population. Eur. J. Haematol. 2023, 111, 938–945. [Google Scholar] [CrossRef]
- Wang, S.; Qiao, C.; Zhu, Y.; Shen, W.; He, G.M.; Li, J. The third-time chronic myeloid leukemia in lymphoblastic crisis with ABL1 kinase mutation induced by decitabine, dexamethason combined with nilotinib and dasatinib. J. Transl. Int. Med. 2016, 4, 182–184. [Google Scholar] [CrossRef] [PubMed]
- Chelysheva, E.Y.; Shukhov, O.A.; Lazareva, O.V.; Turkina, A.V.; Turkina, A.G. Mutations of the kinase domain of the BCR-ABL gene in chronic myeloleukemia. Clin. Oncohematol. 2012, 1, 13–21. [Google Scholar]
- Zabriskie, M.S.; Eide, C.A.; Tantravahi, S.K.; Vellore, N.A.; Estrada, J.; Nicolini, F.E.; Khoury, H.J.; Larson, R.A.; Konopleva, M.; Cortes, J.E.; et al. BCR::ABL1 compound mutations combining key kinase domain positions confer clinical resistance to ponatinib in Ph chromosome-positive leukemia. Cancer Cell 2014, 26, 428–442. [Google Scholar] [CrossRef] [PubMed]
- Soverini, S.; Bernardi, S.; Galimberti, S. Molecular Testing in CML between Old and New Methods: Are We at a Turning Point? J. Clin. Med. 2020, 9, 3865. [Google Scholar] [CrossRef]
- Polivkova, V.; Benesova, A.; Zizkova, H.; Koblihova, J.; Curik, N.; Motlova, E.; Klamova, H.; Salek, C.; Polakova, K.M. Sensitivity and reliability of DNA-based mutation analysis by allele-specific digital PCR to follow resistant BCR-ABL1-positive cells. Leukemia 2021, 35, 2419–2423. [Google Scholar] [CrossRef]
- Branford, S.; Rudzki, Z.; Parkinson, I.; Grigg, A.; Taylor, K.; Seymour, J.F.; Durrant, S.; Browett, P.; Anthony, P.; Arthur, C. Real-time quantitative PCR analysis can be used as a primary screen to identify patients with CML treated with imatinib who have BCR-ABL kinase domain mutations. Blood 2004, 104, 2926–2932. [Google Scholar] [CrossRef]
- Dyer, S.C.; Austine-Orimoloye, O.; Azov, A.G.; Barba, M.; Barnes, I.; Barrera-Enriquez, V.P.; Becker, A.; Bennett, R.; Beracochea, M.; Berry, A.; et al. Ensembl. Nucleic Acids Res. 2025, 53, D948–D957. [Google Scholar] [CrossRef]
- Arechavaleta, G.M.; Scholl, V.; Pérez, V.; Bittencourt, R.; Moellmann, A.; Hassan, R.; Seuánez, H.N.; Dobbin, J.; Martinez, L.; Renault, I.Z.; et al. Rapid and sensitive allele-specific (AS)-RT-PCR assay for detection of T315I mutation in chronic myeloid leukemia patients treated with tyrosine-kinase inhibitors. Clin. Exp. Med. 2011, 11, 55–59. [Google Scholar] [CrossRef]
- Innes, A.J.; Hayden, C.; Orovboni, V.; Bittencourt, R.; Moellmann, A.; Hassan, R.; Seuánez, H.N.; Dobbin, J.; Martinez, L.; Renault, I.Z. Impact of BCR::ABL1 single nucleotide variants on asciminib efficacy. Leukemia 2024, 38, 2443–2455. [Google Scholar] [CrossRef]
- Sidorova, Y.V.; Sorokina, T.V.; Biderman, B.V.; Nikulina, E.E.; Kisilichina, D.G.; Naumova, E.V.; Pochtar, M.E.; Lugovskaya, S.A.; Ivanova, V.L.; Kovaleva, L.G.; et al. Determination of minimal residual disease in patients with B-cell chronic lympholeukemia by patient-specific PCR. Klin. Lab. Diagn. 2011, 12, 22–35. [Google Scholar]
- van Dongen, J.; Macintyre, E.; Gabert, J.; Delabesse, E.; Rossi, V.; Saglio, G.; Gottardi, E.; Rambaldi, A.; Dotti, G.; Griesinger, F.; et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: Investigation of minimal residual disease in acute leukemia. Leukemia 1999, 13, 1901–1928. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 2010, 26, 589–595. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Lai, Z.; Markovets, A.; Ahdesmaki, M.; Chapman, B.; Hofmann, O.; McEwen, R.; Johnson, J.; Dougherty, B.; Barrett, J.C.; Dry, J.R. VarDict: A novel and versatile variant caller for next-generation sequencing in cancer research. Nucleic Acids Res. 2016, 44, e108. [Google Scholar] [CrossRef]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef]
- Franklin. Available online: https://franklin.genoox.com/clinical-db/home (accessed on 4 September 2024).
Amino Acid Substitution/Nucleotide Mutation/NCBI SNP | Primer/Probe Orientation | Sequence (5′ to 3′) |
---|---|---|
NM_005157.6 (ABL1):c.730A>G (p.Met244Val) rs121913456 | Reverse w Reverse mt Forward Probe | 5′-CGCCCAGCTTGTGCTTCTT-3′ 5′-CGCCCAGCTTGTGCTTCTC-3′ 5′-CTATGGTGTGTCCCCCAACT-3 5′-Cy5-GTCCGTGCG(T-BHQ2)TCCATCTCCCACTTG-(P)-3′ |
NM_005157.6 (ABL1):c.757T>C (p.Tyr253His) rs121913461 | Reverse w Reverse mt Forward Probe | 5′-CTCGTACACCTCCCCGAA-3′ 5′-CTCGTACACCTCCCCGAG-3′ 5′-CTATGGTGTGTCCCCCAACT-3 5′-Cy5-GTCCGTGCG(T-BHQ2)TCCATCTCCCACTTG-(P)-3′ |
NM_005157.6 (ABL1): c.895G>C (p.Val299Leu) rs1057519771 | Reverse w Reverse mt Forward Probe | 5′-TACTCACCAAGGAGCTGCTC-3′ 5′-TACTCACCAAGGAGCTGCTG-3′ 5′-TCCTTCTGCAGGAGGACACCATGGA-3′ 5′-Cy5-GGTTAGGGTG(T-BHQ2)TTGATCTCTTTCATGACTGC(P)-3′ |
NM_005157.6 (ABL1):c.944C>T (p.Thr315Ile) rs121913459 | Reverse w Reverse mt Forward Probe | 5′-TCCCGTAGGTCATGAACTCTG-3′ 5′-TCCCGTAGGTCATGAACTCTA-3′ 5′-GACAGTTGTTTGTTCAGTTGGGA-3′ 5′-Cy5-CAACAAGACAACGAGGACTTCAACACGTG-RTQ2-3′ |
NM_005157.6 (ABL1):c.1075T>G (p.Phe359Val) rs121913452 | Forward w Forward mt Reverse Probe | 5′-GGAGTACCTGGAGAAGAAAAAGT-3′ 5′-GGAGTACCTGGAGAAGAAAACGV-3′ 5′-CCTGAGACCTCCTAGGCTG-3′ 5′-Cy5-CAGCCTGCGCCATGGAGTCACAG-BHQ2-3′ |
Patient No. | VAF for DNA AS-PCR Amplification | VAF for NGS by One-Step DNA PCR | VAF for NGS by Nested cDNA PCR |
---|---|---|---|
Patient 1 | 23.8%—T315I | 36.5%—T315I | 96%—T315I |
Patient 2 | 0.03%—M244V | Less than 5%—M244V | Less than 5%—M244V |
Patient 3 | 0.32%—F359V | Less than 5%—F359V | Less than 5%—F359V |
Patient 4 | 6.5%—T315I 26.7%—V299L | Less than 5%—T315I Less than 5%—V299L | Less than 5%—T315I; 17.5%—V299L |
Patient 5 | 31.2%—T315I | 20%—T315I | 98%—T315I |
Date of Analysis | ΔCT for the M244V Mutation | AR % for the M244V Mutation | ΔCT for the F359V Mutation | AR % for the F359V Mutation | BCR::ABL1 Transcript % |
---|---|---|---|---|---|
6 June 2022 | 12.1 | 0.02 | 12.7 | 0.02 | 66.8 |
10 August 2023 | 0.8 | 59.5 | 5.1 | 2.91 | 54 |
25 September 2023 | 9.5 | 0.11 | 11.8 | 0.03 | 0.09 |
29 September 2023 | 11.6 | 0.03 | 12.3 | 0.02 | 0.07 |
29 November 2023 | Hematopoietic stem cell transplantation | ||||
27 December 2023 | 11.6 | 0.03 | 12.4 | 0.02 | n/a |
29 January2024 | 2.3 | 20.6 | 11.9 | 0.03 | 49.1 |
3 April 2024 | 11.9 | 0.03 | 12.7 | 0.01 | n/a |
11 July 2024 | 11.4 | 0.04 | 12.5 | 0.02 | n/a |
Date of Analysis | ΔCT for the T315I Mutation | AR % for the T315I Mutation T315I | BCR::ABL1 Transcript % |
---|---|---|---|
8 December 2022 | 4.3 | 5.2 | 55.549 |
10 April 2023 | 3.6 | 8.3 | 35.27 |
20 December 2023 | 10.4 | 0.07 | 12.787 |
14 March 2024 | 11.2 | 0.04 | 3.143 |
6 June 2024 | 15.4 | 0 | 2.186 |
16 August 2024 | 14.7 | 0 | 1.462 |
15 November 2024 | 20 | 0 | 0.755 |
Date Analyzed | ΔCT for the T315I Mutation | AR % for the T315I Mutation T315I | BCR::ABL1 Transcript % |
---|---|---|---|
16 December 2022 | 3.5 | 9 | 92.796 |
22 March 2023 | 2 | 24.8 | 56.4 |
21 June 2023 | 5 | 3.1 | 76.7 |
18 December 2023 | 3 | 12.4 | 63.5 |
11 April 2024 | 1.7 | 31.2 | 54.7 |
16 July 2024 | 4.8 | 3.7 | 46 |
12 November 2024 | 5.2 | 2.7 | 57.4 |
Primers | Nucleotide Sequence of Primer (5′-3′) | Product Size, bp | |
---|---|---|---|
1 | abl1_ex4_FW | TGTGTAGTGAATTAAGGCTCAGC | 456 |
1 | abl1_ex4_RV | GAGGTAGACTTCCAGGCAGA | |
2 | abl1_ex5_FW | TCAGCTGTCATGGAACCTGT | 350 |
2 | abl1_ex5_RV | CCAACGAGGTTTTGTGCAGT | |
3 | abl1_ex6_FW | GGAGCAGAGTCAGAATCCTTC | 399 |
3 | abl1_ex6_RV | TGCCAGCACTGAGGTTAGAA | |
4 | abl1_ex7_FW | CTCAGCAGTGGTGGATTTGT | 333 |
4 | abl1_ex7_RV | GGAAGAGCAAGAAAGAGGCA | |
5 | abl1_ex8_FW | AGCCTTGTCCTGGTCTTCTG | 396 |
5 | abl1_ex8_RV | TGTACACACTCCTGCACAGT | |
6 | abl1_ex9_FW | CGTTTTGACTTGTTGCAGCA | 375 |
6 | abl1_ex9_RV | AATACTCCACACCTCTGCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Skripkina, A.; Fevraleva, I.; Kuzmina, E.; Biderman, B.; Stepanova, E.; Chelysheva, E.; Turkina, A.; Sudarikov, A. Allele-Specific PCR for Detection of Missense Mutations in the Chimeric BCR::ABL1 Gene Causing Failure of Tyrosine Kinase Inhibitor Therapy in CML Patients. Int. J. Mol. Sci. 2025, 26, 3728. https://doi.org/10.3390/ijms26083728
Skripkina A, Fevraleva I, Kuzmina E, Biderman B, Stepanova E, Chelysheva E, Turkina A, Sudarikov A. Allele-Specific PCR for Detection of Missense Mutations in the Chimeric BCR::ABL1 Gene Causing Failure of Tyrosine Kinase Inhibitor Therapy in CML Patients. International Journal of Molecular Sciences. 2025; 26(8):3728. https://doi.org/10.3390/ijms26083728
Chicago/Turabian StyleSkripkina, Anastasia, Irina Fevraleva, Elena Kuzmina, Bella Biderman, Elena Stepanova, Ekaterina Chelysheva, Anna Turkina, and Andrey Sudarikov. 2025. "Allele-Specific PCR for Detection of Missense Mutations in the Chimeric BCR::ABL1 Gene Causing Failure of Tyrosine Kinase Inhibitor Therapy in CML Patients" International Journal of Molecular Sciences 26, no. 8: 3728. https://doi.org/10.3390/ijms26083728
APA StyleSkripkina, A., Fevraleva, I., Kuzmina, E., Biderman, B., Stepanova, E., Chelysheva, E., Turkina, A., & Sudarikov, A. (2025). Allele-Specific PCR for Detection of Missense Mutations in the Chimeric BCR::ABL1 Gene Causing Failure of Tyrosine Kinase Inhibitor Therapy in CML Patients. International Journal of Molecular Sciences, 26(8), 3728. https://doi.org/10.3390/ijms26083728