Differential Cellular Responses to Class I and II Sphingomyelinase D: Unraveling the Mechanisms of Loxosceles Venom-Induced Dermonecrosis and Potential Therapeutic Targets
Abstract
1. Introduction
2. Results
2.1. SMase D Isoforms Induce Biological Processes Associated with Inflammation, While Class II Specifically Promotes Wound Healing Pathways
2.2. Distinct Pathway Targets of Class I and Class II SMase D Treatments: Proteolysis and Apoptosis Versus IL-10 Signaling and Keratin Metabolism
2.3. Distinct Temporal Expression Profiles Induced by Class I and Class II SMase D Treatments
2.4. Sustained VEGF-A Expression Observed Only in Keratinocytes Treated with Class II SMase D
3. Discussion
4. Materials and Methods
4.1. Recombinant Sphingomyelinase D
4.2. Cell Culture
4.3. RNA-Seq Analysis
4.3.1. Cell Treatments
4.3.2. RNA Extraction from HaCaT Cultures
4.3.3. Library Preparation and Sequencing
4.3.4. Pre-Processing and Cleaning
4.3.5. Mapping, Assembly, and Quantification
4.3.6. Analysis of Differentially Expressed and Modulated Genes
4.4. RT-qPCR
4.5. Immunofluorescence Assay and Analysis on the Confocal Microscope
4.6. VEGF-A ELISA in Cell Supernatant
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Sezerino, U.M.; Zannin, M.; Coelho, L.K.; Gonçalves Júnior, J.; Grando, M.; Mattosinho, S.G.; Cardoso, J.L.; von Eickstedt, V.R.; França, F.O.; Barbaro, K.C.; et al. A Clinical and Epidemiological Study of Loxosceles Spider Envenoming in Santa Catarina, Brazil. Trans. R. Soc. Trop. Med. Hyg. 1998, 92, 546–548. [Google Scholar] [CrossRef] [Scilit]
- Amorim, M.L.P.; Simão, D.G.d.O.; de Albuquerque, J.P.V.E.S.; Ramos, B.M.T.; Nascimento, G.J.L.d.; Mello, M.J.G.d. Brown Spiders (Loxosceles) Are Taking Hold in Pernambuco, Brazil: A Case Series, 2018–2022. Epidemiol. E Serviços De Saúde 2024, 33, e2023568. [Google Scholar] [CrossRef] [Scilit]
- de Almeida, D.M.; Fernandes-Pedrosa, M.d.F.; de Andrade, R.M.G.; Marcelino, J.R.; Gondo-Higashi, H.; de Azevedo, I.d.L.M.J.; Ho, P.L.; van den Berg, C.; Tambourgi, D.V. A New Anti-Loxoscelic Serum Produced against Recombinant Sphingomyelinase D: Results of Preclinical Trials. Am. J. Trop. Med. Hyg. 2008, 79, 463–470. [Google Scholar] [CrossRef] [Scilit]
- de Santi Ferrara, G.I.; Fernandes-Pedrosa, M.d.F.; Junqueira-de-Azevedo, I.d.L.M.; Gonçalves-de-Andrade, R.M.; Portaro, F.C.V.; Manzoni-de-Almeida, D.; Murakami, M.T.; Arni, R.K.; van den Berg, C.W.; Ho, P.L.; et al. SMase II, a New Sphingomyelinase D from Loxosceles Laeta Venom Gland: Molecular Cloning, Expression, Function and Structural Analysis. Toxicon 2009, 53, 743–753. [Google Scholar] [CrossRef] [Scilit]
- Wasserman, G.S.; Anderson, P.C. Loxoscelism and Necrotic Arachnidism. J. Toxicol. Clin. Toxicol. 1983, 21, 451–472. [Google Scholar] [CrossRef] [Scilit]
- Futrell, J.M. Loxoscelism. Am. J. Med. Sci. 1992, 304, 261–267. [Google Scholar] [CrossRef] [Scilit]
- Tambourgi, D.V.; Morgan, B.P.; de Andrade, R.M.G.; Magnoli, F.C.; van den Berg, C.W. Loxosceles Intermedia Spider Envenomation Induces Activation of an Endogenous Metalloproteinase, Resulting in Cleavage of Glycophorins from the Erythrocyte Surface and Facilitating Complement-Mediated Lysis. Blood 2000, 95, 683–691. [Google Scholar] [CrossRef] [Scilit]
- Mackinnon, J.E.; Witkind, J. Necrotic Arachnidism. An. Fac. Med. Univ. Repub. Montev. Urug. 1953, 38, 75–100. [Google Scholar]
- Pizzi, T. A histopathological study on necrotic arachnidism by Loxosceles laeta (author’s transl). Bol. Chil. Parasitol. 1975, 30, 34–36. [Google Scholar]
- Tambourgi, D.V.; Magnoli, F.C.; Von Eickstedt, V.R.; Benedetti, Z.C.; Petricevich, V.L.; da Silva, W.D. Incorporation of a 35-Kilodalton Purified Protein from Loxosceles Intermedia Spider Venom Transforms Human Erythrocytes into Activators of Autologous Complement Alternative Pathway. J. Immunol. 1995, 155, 4459–4466. [Google Scholar] [CrossRef] [Scilit]
- Tambourgi, D.V.; Magnoli, F.C.; van den Berg, C.W.; Morgan, B.P.; de Araujo, P.S.; Alves, E.W.; Da Silva, W.D. Sphingomyelinases in the Venom of the Spider Loxosceles Intermedia Are Responsible for Both Dermonecrosis and Complement-Dependent Hemolysis. Biochem. Biophys. Res. Commun. 1998, 251, 366–373. [Google Scholar] [CrossRef] [Scilit]
- Fernandes Pedrosa, M.d.F.; Junqueira de Azevedo, I.d.L.M.; Gonçalves-de-Andrade, R.M.; van den Berg, C.W.; Ramos, C.R.R.; Ho, P.L.; Tambourgi, D.V. Molecular Cloning and Expression of a Functional Dermonecrotic and Haemolytic Factor from Loxosceles Laeta Venom. Biochem. Biophys. Res. Commun. 2002, 298, 638–645. [Google Scholar] [CrossRef] [Scilit]
- Tambourgi, D.V.; de F Fernandes Pedrosa, M.; van den Berg, C.W.; Gonçalves-de-Andrade, R.M.; Ferracini, M.; Paixão-Cavalcante, D.; Morgan, B.P.; Rushmere, N.K. Molecular Cloning, Expression, Function and Immunoreactivities of Members of a Gene Family of Sphingomyelinases from Loxosceles Venom Glands. Mol. Immunol. 2004, 41, 831–840. [Google Scholar] [CrossRef] [Scilit]
- Murakami, M.T.; Fernandes-Pedrosa, M.F.; Tambourgi, D.V.; Arni, R.K. Structural Basis for Metal Ion Coordination and the Catalytic Mechanism of Sphingomyelinases D. J. Biol. Chem. 2005, 280, 13658–13664. [Google Scholar] [CrossRef] [Scilit]
- Murakami, M.T.; Fernandes-Pedrosa, M.F.; de Andrade, S.A.; Gabdoulkhakov, A.; Betzel, C.; Tambourgi, D.V.; Arni, R.K. Structural Insights into the Catalytic Mechanism of Sphingomyelinases D and Evolutionary Relationship to Glycerophosphodiester Phosphodiesterases. Biochem. Biophys. Res. Commun. 2006, 342, 323–329. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira, K.C.; Gonçalves de Andrade, R.M.; Piazza, R.M.F.; Ferreira, J.M.C., Jr.; van den Berg, C.W.; Tambourgi, D.V. Variations in Loxosceles Spider Venom Composition and Toxicity Contribute to the Severity of Envenomation. Toxicon 2005, 45, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Pedroso, A.; Matioli, S.R.; Murakami, M.T.; Pidde-Queiroz, G.; Tambourgi, D.V. Adaptive Evolution in the Toxicity of a Spider’s Venom Enzymes. BMC Evol. Biol. 2015, 15, 290. [Google Scholar] [CrossRef] [Scilit]
- Tambourgi, D.V.; Paixão-Cavalcante, D.; Gonçalves de Andrade, R.M.; Fernandes-Pedrosa, M.d.F.; Magnoli, F.C.; Paul Morgan, B.; van den Berg, C.W. Loxosceles Sphingomyelinase Induces Complement-Dependent Dermonecrosis, Neutrophil Infiltration, and Endogenous Gelatinase Expression. J. Investig. Dermatol. 2005, 124, 725–731. [Google Scholar] [CrossRef] [Scilit]
- Paixão-Cavalcante, D.; van den Berg, C.W.; de Freitas Fernandes-Pedrosa, M.; Gonçalves de Andrade, R.M.; Tambourgi, D.V. Role of Matrix Metalloproteinases in HaCaT Keratinocytes Apoptosis Induced by Loxosceles Venom Sphingomyelinase D. J. Investig. Dermatol. 2006, 126, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Paixão-Cavalcante, D.; van den Berg, C.W.; Gonçalves-de-Andrade, R.M.; Fernandes-Pedrosa, M.d.F.; Okamoto, C.K.; Tambourgi, D.V. Tetracycline Protects against Dermonecrosis Induced by Loxosceles Spider Venom. J. Investig. Dermatol. 2007, 127, 1410–1418. [Google Scholar] [CrossRef] [Scilit]
- Corrêa, M.A.; Okamoto, C.K.; Gonçalves-de-Andrade, R.M.; van den Berg, C.W.; Tambourgi, D.V. Sphingomyelinase D from Loxosceles Laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis. PLoS ONE 2016, 11, e0153090. [Google Scholar] [CrossRef] [Scilit]
- Pinto, B.F.; Lopes, P.H.; Trufen, C.E.M.; Ching, A.T.C.; De Azevedo, I.d.L.M.J.; Nishiyama, M.Y., Jr.; Pohl, P.C.; Tambourgi, D.V. Role of ErbB and IL-1 Signaling Pathways in the Dermonecrotic Lesion Induced by Loxosceles Sphingomyelinases D. Arch. Toxicol. 2023, 97, 3285–3301. [Google Scholar] [CrossRef] [Scilit]
- Uchiyama, A.; Nayak, S.; Graf, R.; Cross, M.; Hasneen, K.; Gutkind, J.S.; Brooks, S.R.; Morasso, M.I. SOX2 Epidermal Overexpression Promotes Cutaneous Wound Healing via Activation of EGFR/MEK/ERK Signaling Mediated by EGFR Ligands. J. Investig. Dermatol. 2019, 139, 1809–1820.e8. [Google Scholar] [CrossRef] [Scilit]
- Darby, I.A.; Bisucci, T.; Raghoenath, S.; Olsson, J.; Muscat, G.E.; Koopman, P. Sox18 Is Transiently Expressed during Angiogenesis in Granulation Tissue of Skin Wounds with an Identical Expression Pattern to Flk-1 mRNA. Lab. Investig. 2001, 81, 937–943. [Google Scholar] [CrossRef] [Scilit]
- Caley, M.P.; Martins, V.L.C.; O’Toole, E.A. Metalloproteinases and Wound Healing. Adv. Wound Care 2015, 4, 225–234. [Google Scholar] [CrossRef] [Scilit]
- Kanda, N.; Watanabe, S. Substance P Enhances the Production of Interferon-Induced Protein of 10 kDa by Human Keratinocytes in Synergy with Interferon-Gamma. J. Investig. Dermatol. 2002, 119, 1290–1297. [Google Scholar] [CrossRef] [Scilit]
- Redkiewicz, P. The Regenerative Potential of Substance P. Int. J. Mol. Sci. 2022, 23, 750. [Google Scholar] [CrossRef] [Scilit]
- Jiang, M.H.; Chung, E.; Chi, G.F.; Ahn, W.; Lim, J.E.; Hong, H.S.; Kim, D.W.; Choi, H.; Kim, J.; Son, Y. Substance P Induces M2-Type Macrophages after Spinal Cord Injury. Neuroreport 2012, 23, 786–792. [Google Scholar] [CrossRef] [Scilit]
- Hong, H.S.; Son, Y. Substance P Ameliorates Collagen II-Induced Arthritis in Mice via Suppression of the Inflammatory Response. Biochem. Biophys. Res. Commun. 2014, 453, 179–184. [Google Scholar] [CrossRef] [Scilit]
- Wise, L.M.; Inder, M.K.; Real, N.C.; Stuart, G.S.; Fleming, S.B.; Mercer, A.A. The Vascular Endothelial Growth Factor (VEGF)-E Encoded by Orf Virus Regulates Keratinocyte Proliferation and Migration and Promotes Epidermal Regeneration. Cell Microbiol. 2012, 14, 1376–1390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desai, A.; Lankford, H.A.; Warren, J.S. Loxosceles Deserta Spider Venom Induces the Expression of Vascular Endothelial Growth Factor (VEGF) in Keratinocytes. Inflammation 2000, 24, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sitailo, L.A.; Jerome-Morais, A.; Denning, M.F. Mcl-1 Functions as Major Epidermal Survival Protein Required for Proper Keratinocyte Differentiation. J. Investig. Dermatol. 2009, 129, 1351–1360. [Google Scholar] [CrossRef] [Scilit]
- Gupta, K.; Kshirsagar, S.; Li, W.; Gui, L.; Ramakrishnan, S.; Gupta, P.; Law, P.Y.; Hebbel, R.P. VEGF Prevents Apoptosis of Human Microvascular Endothelial Cells via Opposing Effects on MAPK/ERK and SAPK/JNK Signaling. Exp. Cell Res. 1999, 247, 495–504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Macdonald, A.; Campbell, D.G.; Toth, R.; McLauchlan, H.; Hastie, C.J.; Arthur, J.S.C. Pim Kinases Phosphorylate Multiple Sites on Bad and Promote 14-3-3 Binding and Dissociation from Bcl-XL. BMC Cell Biol. 2006, 7, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, X.; Liu, B.; Han, W.; Ming, M.; He, Y.-Y. UVB-Induced p21 Degradation Promotes Apoptosis of Human Keratinocytes. Photochem. Photobiol. Sci. 2010, 9, 1640–1648. [Google Scholar] [CrossRef] [Scilit]
- Chen, A.; Huang, X.; Xue, Z.; Cao, D.; Huang, K.; Chen, J.; Pan, Y.; Gao, Y. The Role of p21 in Apoptosis, Proliferation, Cell Cycle Arrest, and Antioxidant Activity in UVB-Irradiated Human HaCaT Keratinocytes. Med. Sci. Monit. Basic. Res. 2015, 21, 86–95. [Google Scholar] [CrossRef] [Scilit]
- Simone, T.M.; Longmate, W.M.; Law, B.K.; Higgins, P.J. Targeted Inhibition of PAI-1 Activity Impairs Epithelial Migration and Wound Closure Following Cutaneous Injury. Adv. Wound Care 2015, 4, 321–328. [Google Scholar] [CrossRef] [Scilit]
- Gangnuss, S.; Cowin, A.J.; Daehn, I.S.; Hatzirodos, N.; Rothnagel, J.A.; Varelias, A.; Rayner, T.E. Regulation of MAPK Activation, AP-1 Transcription Factor Expression and Keratinocyte Differentiation in Wounded Fetal Skin. J. Investig. Dermatol. 2004, 122, 791–804. [Google Scholar] [CrossRef] [Scilit]
- Nawijn, M.C.; Alendar, A.; Berns, A. For Better or for Worse: The Role of Pim Oncogenes in Tumorigenesis. Nat. Rev. Cancer 2011, 11, 23–34. [Google Scholar] [CrossRef] [Scilit]
- de Vries, M.; Heijink, I.H.; Gras, R.; den Boef, L.E.; Reinders-Luinge, M.; Pouwels, S.D.; Hylkema, M.N.; van der Toorn, M.; Brouwer, U.; van Oosterhout, A.J.M.; et al. Pim1 Kinase Protects Airway Epithelial Cells from Cigarette Smoke-Induced Damage and Airway Inflammation. Am. J. Physiol. Lung Cell Mol. Physiol. 2014, 307, L240–L251. [Google Scholar] [CrossRef] [Scilit]
- Zippo, A.; De Robertis, A.; Bardelli, M.; Galvagni, F.; Oliviero, S. Identification of Flk-1 Target Genes in Vasculogenesis: Pim-1 Is Required for Endothelial and Mural Cell Differentiation in Vitro. Blood 2004, 103, 4536–4544. [Google Scholar] [CrossRef] [Scilit]
- Liang, C.; Li, Y.-Y. Use of Regulators and Inhibitors of Pim-1, a Serine/threonine Kinase, for Tumour Therapy (review). Mol. Med. Rep. 2014, 9, 2051–2060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stewart, B.E.; Rice, R.H. Differentiation-Associated Expression of the Proto-Oncogene Pim-1 in Cultured Human Keratinocytes. J. Investig. Dermatol. 1995, 105, 699–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Zhang, Q.; Ann, D.K.; Akhondzadeh, A.; Duong, H.S.; Messadi, D.V.; Le, A.D. Increased Vascular Endothelial Growth Factor May Account for Elevated Level of Plasminogen Activator Inhibitor-1 via Activating ERK1/2 in Keloid Fibroblasts. Am. J. Physiol. Cell Physiol. 2004, 286, C905–C912. [Google Scholar] [CrossRef] [Scilit]
- Le Gouill, S.; Podar, K.; Amiot, M.; Hideshima, T.; Chauhan, D.; Ishitsuka, K.; Kumar, S.; Raje, N.; Richardson, P.G.; Harousseau, J.-L.; et al. VEGF Induces Mcl-1 up-Regulation and Protects Multiple Myeloma Cells against Apoptosis. Blood 2004, 104, 2886–2892. [Google Scholar] [CrossRef] [Scilit]
- Theoharides, T.C.; Zhang, B.; Kempuraj, D.; Tagen, M.; Vasiadi, M.; Angelidou, A.; Alysandratos, K.-D.; Kalogeromitros, D.; Asadi, S.; Stavrianeas, N.; et al. IL-33 Augments Substance P-Induced VEGF Secretion from Human Mast Cells and Is Increased in Psoriatic Skin. Proc. Natl. Acad. Sci. USA 2010, 107, 4448–4453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbas, T.; Dutta, A. p21 in Cancer: Intricate Networks and Multiple Activities. Nat. Rev. Cancer 2009, 9, 400–414. [Google Scholar] [CrossRef] [Scilit]
- Decraene, D.; Van Laethem, A.; Agostinis, P.; De Peuter, L.; Degreef, H.; Bouillon, R.; Garmyn, M. AKT Status Controls Susceptibility of Malignant Keratinocytes to the Early-Activated and UVB-Induced Apoptotic Pathway. J. Investig. Dermatol. 2004, 123, 207–212. [Google Scholar] [CrossRef] [Scilit]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef] [Scilit]
- Laemmli, U.K. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [Scilit]
- Aronesty, E. Comparison of Sequencing Utility Programs. Open Bioinform. J. 2013, 7, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and Memory-Efficient Alignment of Short DNA Sequences to the Human Genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [Scilit]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast Universal RNA-Seq Aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [Scilit]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An Efficient General Purpose Program for Assigning Sequence Reads to Genomic Features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [Scilit]
- Risso, D.; Ngai, J.; Speed, T.P.; Dudoit, S. Normalization of RNA-Seq Data Using Factor Analysis of Control Genes or Samples. Nat. Biotechnol. 2014, 32, 896–902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor Package for Differential Expression Analysis of Digital Gene Expression Data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit]
- Robinson, M.D.; Oshlack, A. A Scaling Normalization Method for Differential Expression Analysis of RNA-Seq Data. Genome Biol. 2010, 11, R25. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Lun, A.T.L.; Smyth, G.K. Differential Expression Analysis of Complex RNA-Seq Experiments Using edgeR. In Statistical Analysis of Next Generation Sequencing Data; Springer International Publishing: Cham, Switzerland, 2014; pp. 51–74. ISBN 9783319072111. [Google Scholar]
- Phipson, B.; Lee, S.; Majewski, I.J.; Alexander, W.S.; Smyth, G.K. Robust Hyperparameter Estimation Protects Against Hypervariable Genes And Improves Power To Detect Differential Expression. Ann. Appl. Stat. 2016, 10, 946–963. [Google Scholar] [CrossRef] [Scilit]
- McCarthy, D.J.; Chen, Y.; Smyth, G.K. Differential Expression Analysis of Multifactor RNA-Seq Experiments with Respect to Biological Variation. Nucleic Acids Res. 2012, 40, 4288–4297. [Google Scholar] [CrossRef] [Scilit]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. 1995, 57, 289–300. [Google Scholar] [CrossRef] [Scilit]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene Set Enrichment Analysis: A Knowledge-Based Approach for Interpreting Genome-Wide Expression Profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Scilit]
- Harris, M.A.; Clark, J.; Ireland, A.; Lomax, J.; Ashburner, M.; Foulger, R.; Eilbeck, K.; Lewis, S.; Marshall, B.; Mungall, C.; et al. The Gene Ontology (GO) Database and Informatics Resource. Nucleic Acids Res. 2004, 32, D258–D261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING Database in 2021: Customizable Protein-Protein Networks, and Functional Characterization of User-Uploaded Gene/measurement Sets. Nucleic Acids Res 2021, 49, D605–D612. [Google Scholar] [CrossRef] [Scilit]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A Software Environment for Integrated Models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuleshov, M.V.; Jones, M.R.; Rouillard, A.D.; Fernandez, N.F.; Duan, Q.; Wang, Z.; Koplev, S.; Jenkins, S.L.; Jagodnik, K.M.; Lachmann, A.; et al. Enrichr: A Comprehensive Gene Set Enrichment Analysis Web Server 2016 Update. Nucleic Acids Res. 2016, 44, W90–W97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Shapiro, S.S.; Wilk, M.B. An Analysis of Variance Test for Normality (complete Samples). Biometrika 1965, 52, 591. [Google Scholar] [CrossRef] [Scilit]
- Metsalu, T.; Vilo, J. ClustVis: A Web Tool for Visualizing Clustering of Multivariate Data Using Principal Component Analysis and Heatmap. Nucleic Acids Res. 2015, 43, W566–W570. [Google Scholar] [CrossRef] [Scilit]







| Target | Primer | Sequence |
|---|---|---|
| TAC1 | Fw | GACTGGTACGACAGCGACC |
| Rv | AAAGAACTGCTGAGGCTTGG | |
| VEGFA | Fw | CCCACTGAGGAGTCCAACATC |
| Rv | CTGCATTCACATTTGTTGTGCTG | |
| F2RL1 | Fw | CAGTGGCACCATCCAAGGAAC |
| Rv | TTCCAGTGAGGACAGATGCAGA | |
| FOS | Fw | GCTGGCGTTGTGAAGACCAT |
| Rv | GTTGGTCTGTCTCCGCTTGG | |
| MCL1 | Fw | GAAGGCGCTGGAGACCTTAC |
| Rv | GTTACGCCGTCGCTGAAAAC | |
| PIM1 | Fw | TCGGTCTACTCAGGCATCCG |
| Rv | CTCGAGTGCCATTAGGCAGC | |
| CDKN1A | Fw | GATGTCCGTCAGAACCCATGC |
| Rv | CGCCATTAGCGCATCACAGT | |
| SERPINE1 | Fw | TCCACAAATCAGACGGCAGC |
| Rv | CGTAGTAATGGCCATCGGGC | |
| GAPDH | Fw | CCCACTCCTCCACCTTTGAC |
| Rv | CCACCACCCTGTTGCTGTAG | |
| RPL13A | Fw | GTATGCTGCCCCACAAAACC |
| Rv | CTTCAGACGCACGACCTTGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pinto, B.F.; Lopes, P.H.; Trufen, C.E.M.; Ching Ching, A.T.; Junqueira de Azevedo, I.d.L.M.; Nishiyama-Jr, M.Y.; de Souza, M.M.; Pohl, P.C.; Tambourgi, D.V. Differential Cellular Responses to Class I and II Sphingomyelinase D: Unraveling the Mechanisms of Loxosceles Venom-Induced Dermonecrosis and Potential Therapeutic Targets. Int. J. Mol. Sci. 2025, 26, 3012. https://doi.org/10.3390/ijms26073012
Pinto BF, Lopes PH, Trufen CEM, Ching Ching AT, Junqueira de Azevedo IdLM, Nishiyama-Jr MY, de Souza MM, Pohl PC, Tambourgi DV. Differential Cellular Responses to Class I and II Sphingomyelinase D: Unraveling the Mechanisms of Loxosceles Venom-Induced Dermonecrosis and Potential Therapeutic Targets. International Journal of Molecular Sciences. 2025; 26(7):3012. https://doi.org/10.3390/ijms26073012
Chicago/Turabian StylePinto, Bruna Fernandes, Priscila Hess Lopes, Carlos Eduardo Madureira Trufen, Ana Tung Ching Ching, Inácio de Loyola M. Junqueira de Azevedo, Milton Yutaka Nishiyama-Jr, Marcelo Medina de Souza, Paula C. Pohl, and Denise V. Tambourgi. 2025. "Differential Cellular Responses to Class I and II Sphingomyelinase D: Unraveling the Mechanisms of Loxosceles Venom-Induced Dermonecrosis and Potential Therapeutic Targets" International Journal of Molecular Sciences 26, no. 7: 3012. https://doi.org/10.3390/ijms26073012
APA StylePinto, B. F., Lopes, P. H., Trufen, C. E. M., Ching Ching, A. T., Junqueira de Azevedo, I. d. L. M., Nishiyama-Jr, M. Y., de Souza, M. M., Pohl, P. C., & Tambourgi, D. V. (2025). Differential Cellular Responses to Class I and II Sphingomyelinase D: Unraveling the Mechanisms of Loxosceles Venom-Induced Dermonecrosis and Potential Therapeutic Targets. International Journal of Molecular Sciences, 26(7), 3012. https://doi.org/10.3390/ijms26073012

