Enhancing the Therapeutic Efficacy of Berberine and Quercetin Through Salt Formulation for Liver Fibrosis Treatment
Abstract
1. Introduction
2. Results
2.1. Synthesis and Characterization of BBR-QR Salt
2.1.1. Hydrogen-1 Nuclear Magnetic Resonance (1H NMR) Results
2.1.2. Differential Scanning Calorimetry (DSC) Results
2.1.3. Powder X-Ray Diffraction (PXRD) Results
2.1.4. Fourier-Transform Infrared Spectroscopy (FTIR) Evaluation
2.1.5. Scanning Electron Microscopy (SEM) Results
2.2. BQS Improved the Dissolution and Bioavailability of QR
2.3. BQS Ameliorated Liver Fibrosis In Vitro
2.3.1. BQS Inhibited Lipid Accumulation and Inflammation
2.3.2. BQS Alleviated Extra Collagen Formation
2.3.3. BQS Modulated Proliferation and Apoptosis
2.4. BQS Improved Liver Fibrosis In Vivo
2.4.1. BQS Protected Liver Function
2.4.2. BQS Ameliorated Liver Fibrosis
2.4.3. BQS Alleviated Inflammation in Liver Tissue
2.5. Network Pharmacology Analysis and Mechanism Validation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Preparation and Characterization of BBR–QR Samples
4.2.1. NMR Analysis
4.2.2. DSC Analysis
4.2.3. FTIR Analysis
4.2.4. PXRD Analysis
4.2.5. SEM Analysis
4.2.6. Dissolution Experiment
4.3. Bioavailability Analysis
4.4. In Vitro Anti-Fibrosis Activity in LX-2 Cells
4.4.1. Apoptosis
4.4.2. Cell Cycle
4.4.3. Immunofluorescence (IF) Analysis
4.5. In Vitro Analysis of HepG2 Cells
4.5.1. Oil Red O Staining
4.5.2. IF Analysis
4.6. In Vivo Study
4.6.1. Biochemical Analysis
4.6.2. Tissue Staining
4.6.3. Immunohistochemistry (IHC) Analysis
4.6.4. Enzyme-Linked Immunosorbent Assay
4.7. ELISA Measurement
4.8. Quantitative Real-Time PCR (qPCR) Analysis
4.9. Network Pharmacology-Based Analysis
4.10. Western Blot Analysis
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Younossi, Z.; Tacke, F.; Arrese, M.; Chander Sharma, B.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Yilmaz, Y.; George, J.; Fan, J.; et al. Global Perspectives on Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef] [PubMed]
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef] [PubMed]
- Damiris, K.; Tafesh, Z.H.; Pyrsopoulos, N. Efficacy and safety of anti-hepatic fibrosis drugs. World J. Gastroenterol. 2020, 26, 6304–6321. [Google Scholar] [CrossRef]
- Herbert, A.S.; Froude, J.W.; Ortiz, R.A.; Kuehne, A.I.; Dorosky, D.E.; Bakken, R.R.; Zak, S.E.; Josleyn, N.M.; Musiychuk, K.; Jones, R.M.; et al. Development of an antibody cocktail for treatment of Sudan virus infection. Proc. Natl. Acad. Sci. USA 2020, 117, 3768–3778. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Yu, F.; Wang, Q.; Qi, Q.; Su, S.; Xie, L.; Lu, L.; Jiang, S. Co-delivery of HIV-1 entry inhibitor and nonnucleoside reverse transcriptase inhibitor shuttled by nanoparticles: Cocktail therapeutic strategy for antiviral therapy. AIDS 2016, 30, 827–838. [Google Scholar] [CrossRef]
- Plumet, L.; Ahmad-Mansour, N.; Dunyach-Remy, C.; Kissa, K.; Sotto, A.; Lavigne, J.P.; Costechareyre, D.; Molle, V. Bacteriophage Therapy for Staphylococcus Aureus Infections: A Review of Animal Models, Treatments, and Clinical Trials. Front. Cell. Infect. Microbiol. 2022, 12, 907314. [Google Scholar] [CrossRef]
- Weinreich, D.M.; Sivapalasingam, S.; Norton, T.; Ali, S.; Gao, H.; Bhore, R.; Musser, B.J.; Soo, Y.; Rofail, D.; Im, J.; et al. REGN-COV2, a Neutralizing Antibody Cocktail, in Outpatients with COVID-19. New Engl. J. Med. 2021, 384, 238–251. [Google Scholar] [CrossRef]
- Lin, L.J.; Huang, H.Y. DFSG, a novel herbal cocktail with anti-asthma activity, suppressed MUC5AC in A549 cells and alleviated allergic airway hypersensitivity and inflammatory cell infiltration in a chronic asthma mouse model. Biomed. Pharmacother. = Biomed. Pharmacother. 2020, 121, 109584. [Google Scholar] [CrossRef]
- McLarnon, J.G. Consideration of a Pharmacological Combinatorial Approach to Inhibit Chronic Inflammation in Alzheimer’s Disease. Curr. Alzheimer Res. 2019, 16, 1007–1017. [Google Scholar] [CrossRef]
- Zhu, Y.; Xie, N.; Chai, Y.; Nie, Y.; Liu, K.; Liu, Y.; Yang, Y.; Su, J.; Zhang, C. Apoptosis Induction, a Sharp Edge of Berberine to Exert Anti-Cancer Effects, Focus on Breast, Lung, and Liver Cancer. Front. Pharmacol. 2022, 13, 803717. [Google Scholar] [CrossRef]
- Xu, X.; Yi, H.; Wu, J.; Kuang, T.; Zhang, J.; Li, Q.; Du, H.; Xu, T.; Jiang, G.; Fan, G. Therapeutic effect of berberine on metabolic diseases: Both pharmacological data and clinical evidence. Biomed. Pharmacother. = Biomed. Pharmacother. 2021, 133, 110984. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Wang, P.; Guo, W.; Huang, X.; Tian, X.; Wu, G.; Xu, B.; Li, F.; Yan, C.; Liang, X.J.; et al. Natural Berberine-Based Chinese Herb Medicine Assembled Nanostructures with Modified Antibacterial Application. ACS Nano 2019, 13, 6770–6781. [Google Scholar] [CrossRef]
- Yi, J.; Wu, S.; Tan, S.; Qin, Y.; Wang, X.; Jiang, J.; Liu, H.; Wu, B. Berberine alleviates liver fibrosis through inducing ferrous redox to activate ROS-mediated hepatic stellate cells ferroptosis. Cell Death Discov. 2021, 7, 374. [Google Scholar] [CrossRef]
- Wang, N.; Xu, Q.; Tan, H.Y.; Hong, M.; Li, S.; Yuen, M.F.; Feng, Y. Berberine Inhibition of Fibrogenesis in a Rat Model of Liver Fibrosis and in Hepatic Stellate Cells. Evid. Based Complement. Altern. Med. 2016, 2016, 8762345. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Deng, Y.; Liu, M.; Liao, L.; Dai, X.; Guo, C.; Zhao, X.; He, L.; Peng, C.; Li, Y. The pharmacological activity of berberine, a review for liver protection. Eur. J. Pharmacol. 2021, 890, 173655. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhao, Z.; Yan, Y.; Qiang, X.; Zhou, C.; Li, R.; Chen, H.; Zhang, Y. Demethyleneberberine Protects against Hepatic Fibrosis in Mice by Modulating NF-κB Signaling. Int. J. Mol. Sci. 2016, 17, 1036. [Google Scholar] [CrossRef]
- Li, D.; Yang, C.; Zhu, J.Z.; Lopez, E.; Zhang, T.; Tong, Q.; Peng, C.; Lin, L.G. Berberine remodels adipose tissue to attenuate metabolic disorders by activating sirtuin 3. Acta Pharmacol. Sin. 2022, 43, 1285–1298. [Google Scholar] [CrossRef]
- Nasiri-Ansari, N.; Nikolopoulou, C.; Papoutsi, K.; Kyrou, I.; Mantzoros, C.S.; Kyriakopoulos, G.; Chatzigeorgiou, A.; Kalotychou, V.; Randeva, M.S.; Chatha, K.; et al. Empagliflozin Attenuates Non-Alcoholic Fatty Liver Disease (NAFLD) in High Fat Diet Fed ApoE(−/−) Mice by Activating Autophagy and Reducing ER Stress and Apoptosis. Int. J. Mol. Sci. 2021, 22, 818. [Google Scholar] [CrossRef]
- Liu, X.; Wang, L.; Tan, S.; Chen, Z.; Wu, B.; Wu, X. Therapeutic Effects of Berberine on Liver Fibrosis are associated with Lipid Metabolism and Intestinal Flora. Front. Pharmacol. 2022, 13, 814871. [Google Scholar] [CrossRef]
- Domitrović, R.; Jakovac, H.; Marchesi, V.V.; Blažeković, B. Resolution of liver fibrosis by isoquinoline alkaloid berberine in CCl4-intoxicated mice is mediated by suppression of oxidative stress and upregulation of MMP-2 expression. J. Med. Food 2013, 16, 518–528. [Google Scholar] [CrossRef]
- Eissa, L.A.; Kenawy, H.I.; El-Karef, A.; Elsherbiny, N.M.; El-Mihi, K.A. Antioxidant and anti-inflammatory activities of berberine attenuate hepatic fibrosis induced by thioacetamide injection in rats. Chem.-Biol. Interact. 2018, 294, 91–100. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.M.; Deng, X.T.; Zhou, J.; Li, Q.P.; Ge, X.X.; Miao, L. Pharmacological basis and new insights of quercetin action in respect to its anti-cancer effects. Biomed. Pharmacother. = Biomed. Pharmacother. 2020, 121, 109604. [Google Scholar] [CrossRef] [PubMed]
- Grewal, A.K.; Singh, T.G.; Sharma, D.; Sharma, V.; Singh, M.; Rahman, M.H.; Najda, A.; Walasek-Janusz, M.; Kamel, M.; Albadrani, G.M.; et al. Mechanistic insights and perspectives involved in neuroprotective action of quercetin. Biomed. Pharmacother. = Biomed. Pharmacother. 2021, 140, 111729. [Google Scholar] [CrossRef]
- Chen, L.; Liu, J.; Mei, G.; Chen, H.; Peng, S.; Zhao, Y.; Yao, P.; Tang, Y. Quercetin and non-alcoholic fatty liver disease: A review based on experimental data and bioinformatic analysis. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2021, 154, 112314. [Google Scholar] [CrossRef]
- Li, X.; Jin, Q.; Yao, Q.; Xu, B.; Li, Z.; Tu, C. Quercetin attenuates the activation of hepatic stellate cells and liver fibrosis in mice through modulation of HMGB1-TLR2/4-NF-κB signaling pathways. Toxicol. Lett. 2016, 261, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Zhang, Q.; Mo, W.; Feng, J.; Li, S.; Li, J.; Liu, T.; Xu, S.; Wang, W.; Lu, X.; et al. Quercetin prevents hepatic fibrosis by inhibiting hepatic stellate cell activation and reducing autophagy via the TGF-β1/Smads and PI3K/Akt pathways. Sci. Rep. 2017, 7, 9289. [Google Scholar] [CrossRef]
- Li, X.; Jin, Q.; Yao, Q.; Xu, B.; Li, L.; Zhang, S.; Tu, C. The Flavonoid Quercetin Ameliorates Liver Inflammation and Fibrosis by Regulating Hepatic Macrophages Activation and Polarization in Mice. Front. Pharmacol. 2018, 9, 72. [Google Scholar] [CrossRef]
- Hao, M.; Li, Y.; Liu, L.; Yuan, X.; Gao, Y.; Guan, Z.; Li, W. The design and synthesis of a novel compound of berberine and baicalein that inhibits the efficacy of lipid accumulation in 3T3-L1 adipocytes. Bioorg. Med. Chem. 2017, 25, 5506–5512. [Google Scholar] [CrossRef]
- Jia, D.; Dou, Y.; Li, Z.; Zhou, X.; Gao, Y.; Chen, K.; Cong, W.; Ma, M.; Wu, Z.; Li, W. Design, synthesis and evaluation of a baicalin and berberine hybrid compound as therapeutic agent for ulcerative colitis. Bioorg. Med. Chem. 2020, 28, 115697. [Google Scholar] [CrossRef]
- Shailajan, S.; Patil, Y.; Joshi, M.; Menon, S.; Mhatre, M. Simultaneous Quantification of Pharmacological Markers Quercetin and Berberine Using High-Performance Thin-Layer Chromatography (HPTLC) and High-Performance Liquid Chromatography (HPLC) from a Polyherbal Formulation Pushyanuga Churna. J. AOAC Int. 2019, 102, 1003–1013. [Google Scholar] [CrossRef] [PubMed]
- Urasaki, Y.; Le, T.T. Functional Complementation of Anti-Adipogenic Phytonutrients for Obesity Prevention and Management. Nutrients 2022, 14, 4325. [Google Scholar] [CrossRef]
- Tang, Y.; Su, H.; Wang, H.; Lu, F.; Nie, K.; Wang, Z.; Huang, W.; Dong, H. The effect and mechanism of Jiao-tai-wan in the treatment of diabetes mellitus with depression based on network pharmacology and experimental analysis. Mol. Med. 2021, 27, 154. [Google Scholar] [CrossRef] [PubMed]
- Kisseleva, T.; Brenner, D. Molecular and cellular mechanisms of liver fibrosis and its regression. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 151–166. [Google Scholar] [CrossRef]
- Cano-Martínez, A.; Bautista-Pérez, R.; Castrejón-Téllez, V.; Carreón-Torres, E.; Pérez-Torres, I.; Díaz-Díaz, E.; Flores-Estrada, J.; Guarner-Lans, V.; Rubio-Ruíz, M.E. Resveratrol and Quercetin as Regulators of Inflammatory and Purinergic Receptors to Attenuate Liver Damage Associated to Metabolic Syndrome. Int. J. Mol. Sci. 2021, 22, 8939. [Google Scholar] [CrossRef]
- Sun, X.; Zhang, X.; Hu, H.; Lu, Y.; Chen, J.; Yasuda, K.; Wang, H. Berberine inhibits hepatic stellate cell proliferation and prevents experimental liver fibrosis. Biol. Pharm. Bull. 2009, 32, 1533–1537. [Google Scholar] [CrossRef]
- Bessone, F.; Razori, M.V.; Roma, M.G. Molecular pathways of nonalcoholic fatty liver disease development and progression. Cell. Mol. Life Sci. CMLS 2019, 76, 99–128. [Google Scholar] [CrossRef] [PubMed]
- Mountford, S.; Effenberger, M.; Noll-Puchta, H.; Griessmair, L.; Ringleb, A.; Haas, S.; Denk, G.; Reiter, F.P.; Mayr, D.; Dinarello, C.A.; et al. Modulation of Liver Inflammation and Fibrosis by Interleukin-37. Front. Immunol. 2021, 12, 603649. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.M.; Nikolic-Paterson, D.J.; Lan, H.Y. TGF-β: The master regulator of fibrosis. Nat. Rev. Nephrol. 2016, 12, 325–338. [Google Scholar] [CrossRef]
- Ahamed, J.; Laurence, J. Role of Platelet-Derived Transforming Growth Factor-β1 and Reactive Oxygen Species in Radiation-Induced Organ Fibrosis. Antioxid. Redox Signal. 2017, 27, 977–988. [Google Scholar] [CrossRef]
- Meng, D.; Li, Z.; Wang, G.; Ling, L.; Wu, Y.; Zhang, C. Carvedilol attenuates liver fibrosis by suppressing autophagy and promoting apoptosis in hepatic stellate cells. Biomed. Pharmacother. = Biomed. Pharmacother. 2018, 108, 1617–1627. [Google Scholar] [CrossRef]
- Koda, Y.; Teratani, T.; Chu, P.S.; Hagihara, Y.; Mikami, Y.; Harada, Y.; Tsujikawa, H.; Miyamoto, K.; Suzuki, T.; Taniki, N.; et al. CD8(+) tissue-resident memory T cells promote liver fibrosis resolution by inducing apoptosis of hepatic stellate cells. Nat. Commun. 2021, 12, 4474. [Google Scholar] [CrossRef]
- Zhou, W.C.; Zhang, Q.B.; Qiao, L. Pathogenesis of liver cirrhosis. World J. Gastroenterol. 2014, 20, 7312–7324. [Google Scholar] [CrossRef] [PubMed]
- Challa, T.D.; Wueest, S.; Lucchini, F.C.; Dedual, M.; Modica, S.; Borsigova, M.; Wolfrum, C.; Blüher, M.; Konrad, D. Liver ASK1 protects from non-alcoholic fatty liver disease and fibrosis. EMBO Mol. Med. 2019, 11, e10124. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Chen, J.; Sun, H.; Zhang, Y.; Zou, D. New insights into fibrosis from the ECM degradation perspective: The macrophage-MMP-ECM interaction. Cell Biosci. 2022, 12, 117. [Google Scholar] [CrossRef]
- Roehlen, N.; Crouchet, E.; Baumert, T.F. Liver Fibrosis: Mechanistic Concepts and Therapeutic Perspectives. Cells 2020, 9, 875. [Google Scholar] [CrossRef]
- Nie, Q.; Li, M.; Huang, C.; Yuan, Y.; Liang, Q.; Ma, X.; Qiu, T.; Li, J. The clinical efficacy and safety of berberine in the treatment of non-alcoholic fatty liver disease: A meta-analysis and systematic review. J. Transl. Med. 2024, 22, 225. [Google Scholar] [CrossRef] [PubMed]
- Fabregat, I.; Caballero-Diaz, D. Transforming Growth Factor-beta-Induced Cell Plasticity in Liver Fibrosis and Hepatocarcinogenesis. Front. Oncol. 2018, 8, 357. [Google Scholar] [CrossRef]
- Wang, S.Y.; Duan, K.M.; Li, Y.; Mei, Y.; Sheng, H.; Liu, H.; Mei, X.; Ouyang, W.; Zhou, H.H.; Liu, Z.Q. Effect of quercetin on P-glycoprotein transport ability in Chinese healthy subjects. Eur. J. Clin. Nutr. 2013, 67, 390–394. [Google Scholar] [CrossRef]
- Kim, M.K.; Choo, H.; Chong, Y. Water-soluble and cleavable quercetin-amino acid conjugates as safe modulators for P-glycoprotein-based multidrug resistance. J. Med. Chem. 2014, 57, 7216–7233. [Google Scholar] [CrossRef]
- Zhao, Q.; Wei, J.; Zhang, H. Effects of quercetin on the pharmacokinetics of losartan and its metabolite EXP3174 in rats. Xenobiotica 2019, 49, 563–568. [Google Scholar] [CrossRef]
- Zhang, Z.; Shang, J.; Yang, Q.; Dai, Z.; Liang, Y.; Lai, C.; Feng, T.; Zhong, D.; Zou, H.; Sun, L.; et al. Exosomes derived from human adipose mesenchymal stem cells ameliorate hepatic fibrosis by inhibiting PI3K/Akt/mTOR pathway and remodeling choline metabolism. J. Nanobiotechnol. 2023, 21, 29. [Google Scholar] [CrossRef]
- Yu, H.; Zhang, L.; Chen, P.; Liang, X.; Cao, A.; Han, J.; Wu, X.; Zheng, Y.; Qin, Y.; Xue, M. Dietary Bile Acids Enhance Growth, and Alleviate Hepatic Fibrosis Induced by a High Starch Diet via AKT/FOXO1 and cAMP/AMPK/SREBP1 Pathway in Micropterus salmoides. Front. Physiol. 2019, 10, 1430. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Usman, T.O.; Yamauchi, J.; Chhetri, G.; Wang, X.; Coudriet, G.M.; Zhu, C.; Gao, J.; McConnell, R.; Krantz, K.; et al. Myeloid FoxO1 depletion attenuates hepatic inflammation and prevents nonalcoholic steatohepatitis. J. Clin. Investig. 2022, 132, e154333. [Google Scholar] [CrossRef]
- Gao, H.; Zhou, L.; Zhong, Y.; Ding, Z.; Lin, S.; Hou, X.; Zhou, X.; Shao, J.; Yang, F.; Zou, X.; et al. Kindlin-2 haploinsufficiency protects against fatty liver by targeting Foxo1 in mice. Nat. Commun. 2022, 13, 1025. [Google Scholar] [CrossRef] [PubMed]
- Crowley, L.C.; Marfell, B.J.; Scott, A.P.; Waterhouse, N.J. Quantitation of Apoptosis and Necrosis by Annexin V Binding, Propidium Iodide Uptake, and Flow Cytometry. Cold Spring Harb. Protoc. 2016, 2016, pdb-prot087288. [Google Scholar] [CrossRef] [PubMed]
- Larter, C.Z.; Yeh, M.M. Animal models of NASH: Getting both pathology and metabolic context right. J. Gastroenterol. Hepatol. 2008, 23, 1635–1648. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, T.; Luo, Z.; Li, X.; Lin, M.; Li, R.; Du, P.; Yu, X.; Ma, C.; Yan, P.; et al. Functional nano-vector boost anti-atherosclerosis efficacy of berberine in Apoe(−/−) mice. Acta Pharm. Sin. B 2020, 10, 1769–1783. [Google Scholar] [CrossRef]
Origin | Name | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|---|
Human | IL-1β | TATCATCTTTCAACACGCAGGACAG | TATCATCTTTCAACACGCAGGACAG |
TNF-α | GCCGTCTCCTACCAGACCAAG | ATGGGCTCATACCAGGGCTTG | |
IL-6 | ACAGACAGCCACTCACCTCTTC | AGTGCCTCTTTGCTGCTTTCAC | |
COL1A1 | AGGGCGACAGAGGCATAAAGG | AGGACCAGAGGCTCCAGAGG | |
α-SMA | CCGGGAGAAAATGACTCAAA | GCAAGGCATAGCCCTCATAG | |
GAPDH | GAACATCATCCCTGCCTCTACTGG | CCTCCGACGCCTGCTTCAC | |
Murine | Tgfβ1 | CCGCTTCTGCTCCCACTCC | CATGTCGATGGTCTTGCAGGTG |
Col1a1 | GGTCCTGCTGGTCCTGCTG | GAGAAGCCACGATGACCCTTTATG | |
Il-1β | CAAACCTTTGACCTGGGCTGTC | GCCTGCCTGAAGCTCTTGTTG | |
Tnf-α | GCCTCTTCTCATTCCTGCTTGTG | GTGTGAGGGTCTGGGCCATAG | |
α-SMA | CTTCGTGACTACTGCCGAGC | AGGTGGTTTCGTGGATGCC | |
Gapdh | CTCCCACTCTTCCACCTTCG | TAGGGCCTCTCTTGCTCAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, Y.; Yu, H.; Yang, S.; Tian, X.; Zhao, M.; Ren, L.; Guo, X.; Hu, C.; Jiang, J.; Wang, L. Enhancing the Therapeutic Efficacy of Berberine and Quercetin Through Salt Formulation for Liver Fibrosis Treatment. Int. J. Mol. Sci. 2025, 26, 2193. https://doi.org/10.3390/ijms26052193
Cheng Y, Yu H, Yang S, Tian X, Zhao M, Ren L, Guo X, Hu C, Jiang J, Wang L. Enhancing the Therapeutic Efficacy of Berberine and Quercetin Through Salt Formulation for Liver Fibrosis Treatment. International Journal of Molecular Sciences. 2025; 26(5):2193. https://doi.org/10.3390/ijms26052193
Chicago/Turabian StyleCheng, Yangyang, Haoyang Yu, Sitong Yang, Xiaolian Tian, Mengyu Zhao, Ling Ren, Xiuping Guo, Chujuan Hu, Jiandong Jiang, and Lulu Wang. 2025. "Enhancing the Therapeutic Efficacy of Berberine and Quercetin Through Salt Formulation for Liver Fibrosis Treatment" International Journal of Molecular Sciences 26, no. 5: 2193. https://doi.org/10.3390/ijms26052193
APA StyleCheng, Y., Yu, H., Yang, S., Tian, X., Zhao, M., Ren, L., Guo, X., Hu, C., Jiang, J., & Wang, L. (2025). Enhancing the Therapeutic Efficacy of Berberine and Quercetin Through Salt Formulation for Liver Fibrosis Treatment. International Journal of Molecular Sciences, 26(5), 2193. https://doi.org/10.3390/ijms26052193