Next Article in Journal
Candida utilis Ameliorates Dextran Sulfate Sodium-Induced Colitis in Mice via NF-κB/MAPK Suppression and Gut Microbiota Modulation
Previous Article in Journal
Exploration of Conditions for the Scaled Application of Laparoscopic Ovum Pick-Up in Sheep and Comparison of Follicular Development Differences Among Breeds
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Novel Camptothecin Derivative 9c with Enhanced Antitumor Activity via NSA2-EGFR-P53 Signaling Pathway

1
Key Laboratory of Marine Drugs, Chinese Ministry of Education, School of Medicine and Pharmacy, Ocean University of China, Qingdao 266003, China
2
Laboratory for Marine Drugs and Bioproducts of Qingdao National, Laboratory for Marine Science and Technology, Qingdao 266003, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(5), 1987; https://doi.org/10.3390/ijms26051987
Submission received: 16 January 2025 / Revised: 12 February 2025 / Accepted: 20 February 2025 / Published: 25 February 2025
(This article belongs to the Section Bioactives and Nutraceuticals)

Abstract

Therapeutic challenges persist in the management of non-small cell lung cancer (NSCLC) in oncology. Camptothecins have demonstrated as crucial agents in tumor therapy; however, their efficacy is significantly hindered by adverse effects and drug resistance. Herein, we present a novel camptothecin derivative named 9c, which exhibits impressive anti-NSCLC potency surpassing the widely recognized camptothecin analog FL118 through a novel mechanism. Our findings demonstrated that 9c effectively inhibited tumor malignancy through cell cycle arrest and apoptosis induction with the transcriptional downregulation of anti-apoptotic genes including survivin, Mcl-1, Bcl-2, and XIAP. Mechanistically, 9c induced a wild-type p53 expression by destabilizing the NSA2-EGFR axis, thus delaying the cell cycle progression and ultimately triggering apoptosis. 9c significantly inhibited the growth of the NSCLC xenograft in vivo without observed side toxicity. Importantly, it complemented the therapeutic advantages of the novel drug AMG510 for addressing KRAS-mutant NSCLC. Collectively, these findings position 9c as a promising candidate with innovative approaches to combat NSCLC.

1. Introduction

Lung cancer is one of the most common malignant tumors in the world, of which non-small cell lung cancer (NSCLC) is the majority, accounting for more than 80% of lung cancer [1]. The current therapeutic modalities for NSCLC include surgical resection, radiation therapy, chemotherapy, targeted therapies, and immunotherapy [2]. Chemotherapy is still the primary treatment for NSCLC, with cisplatin, docetaxel, gemcitabine (GEM), irinotecan, paclitaxel, and vinorelbine as the mainstay therapeutic agents [3]. However, although these drugs produce a good initial response and slightly increase the overall survival time of patients, patients will still inevitably develop drug resistance, resulting in poor treatment effects. In recent years, the use of immunotherapy in NSCLC holds great promise, but the clinical application of the approaches has been limited due to their low response and resistance. The emergence of precision medicine has heralded a new era in the treatment of non-small cell lung cancer (NSCLC), significantly expanding therapeutic options for patients with advanced stages of the disease. Although a variety of molecular targets are being explored for NSCLCs, such as EGFR, ALK, MEK and KRAS, etc. [4,5], which offer a means for the development of drugs to combat tumors through genetic and epigenetic cues, effective treatments for lung cancer without known specific targeting molecules remain elusive. Furthermore, it seems that the development of mutation-tailored drugs may be approaching a plateau, as recent exome sequencing studies of non-small cell lung cancer (NSCLC) have not uncovered a significant number of novel, potentially druggable targets; thus, NSCLC therapy remains an unsolved challenge in oncology. Notably, many newly developed compounds are focused on exceptionally rare genetic events recently [6,7,8], which paves an avenue to expedite the development of novel anti-cancer agents.
The quinoline alkaloid camptothecin (CPT), as a topoisomerase I (Topo I) inhibitor, is a famous isolated pharmaceutical agent [9]. In the past decades, a plethora of CPT derivatives has been synthesized and evaluated. Among these, semi-synthetic analogs like topotecan and irinotecan have garnered approval from the U.S. Food and Drug Administration (FDA) for the treatment of various malignancies, including lung cancer [10,11,12]. FL118, the (20S)-10,11-methylenedioxy-camptothecin, is a camptothecin analog similar in structure to irinotecan and exhibits remarkable anti-tumor efficacy across a spectrum of cancer types in vitro and in vivo [13,14]. Studies have revealed that, despite sharing an identical core structure with its counterparts, the antitumor efficacy of FL118 remains robust and unimpaired in the absence of targeted Topo I. Instead, FL118 inhibits gene promoter activities and endogenous expressions of anti-apoptotic proteins, such as survivin, Mcl-1, XIAP, and cIAP2 in a selective manner [13,15], thereby promoting to cell apoptosis induction and antitumor activity. Moreover, FL118 exhibits its remarkable efficacy independent of p53 status (wild-type, mutant, or null) in cells, and, thus, it stands as a potent therapeutic agent for cancers characterized by p53 dysfunction, in which most DNA damage drugs (if not all) show a remarkable lack of efficiency [13,16]. Nevertheless, the poor water solubility and adverse reactions of FL118 have seriously hindered its further research [15,17]. Revisiting the structure–activity relationship of camptothecin, as illuminated by the existing literature, reveals that 7-lipophilic substitution significantly amplifies its cytotoxicity and anti-tumor efficacy, even with the introduction of large lipophilic substituents and long-chain substituents, which may be related to rapid intracellular accumulation and lactone stability [18,19,20]. Evidence supports that several 7-substituted camptothecins have the ability to overcome drug resistance both in vitro and in vivo [21,22,23]. Furthermore, the strategic introduction of an appropriate aromatic heterocyclic ring at the C-7 position of substituted camptothecin significantly enhances cytotoxicity. The compound 9c (Figure 1) is thus modified in its structure 7-substituted 10,11-methylenedioxy-camptothecin via Suzuki reaction [24]. The new compound, with enhanced solubility, has been reported by us to have remarkable antitumor efficacy against drug-resistant small-cell lung cancer both in vivo and in vitro [24]. In another study, we discovered that 9c exhibited more cytotoxic activity in the NSCLC cells, particularly in the A549 cells. Currently, there is a dearth of efficacious targeted drugs and immunotherapy agents for the disease modeled by this cell line.
Herein, we further probed into the potential inhibitory effects and underlying mechanisms of 9c on the proliferation of NSCLC cells, mainly focusing on A549 cells, both in vitro and vivo. Our findings indicate that 9c displays impressive antitumor effects in vitro and in vivo by destabilizing the NSA2-EGFR axis, thus blocking downstream signaling, while having no observable apparent toxicity in mice. More importantly, compound 9c exhibits synergetic efficacy with AMG510, a well-known K-RASG12C inhibitor in the NCI-H358 xenograft mouse model.

2. Results

2.1. 9c Inhibits the Proliferation of A549 and H1975 Cells by Arresting G2/M Phase

The cytotoxic activities in vitro of compound 9c against various human tumor cells were determined by SRB assay or MTT assay. As shown in Figure 2A, 9c displayed quite varying inhibitory effects on different tumor cells following a 72 h treatment and had more significantly cytotoxic activity against NSCLC cells. A noteworthy aspect is that 9c exhibited the most cytotoxicity against the A549 and H1975 cells with the IC50 = 0.75 pM and 10 pM, which was about 4640-fold or 98-fold more potent than FL118. Furthermore, the anti-tumor spectrum of 9c is different from that of FL118, e.g., a certain type of cancer cell that is sensitive to FL118 is not sensitive to 9c. Notably, the cytotoxic effects of 9c were significantly less pronounced on the normal cell line Beas-2b (the inhibition rate at 1000 nM was only 53.4%) than on cancer cells (Figure 2B).
The plate clone formation assay is an effective method for evaluating the growth ability of cancer cells in vitro [25]. Accordingly, 9c significantly inhibited the colony-forming abilities of A549 and H1975 cells in a dose-dependent manner (Figure 2C,D and Figure S1A,B). Compared to the control group, the inhibition rates of A549 cells treated with 9c (0.001–0.1 nM) for 14 days were 27.6%, 79.7%, and 93.0% in A549 cells, 37.8%, 71.7%, and 81.5% in H1975 cells, respectively, and the inhibitory potential on A549 cells was stronger than that observed on H1975 cells (Figure 2E). In order to explore whether the cell cycle arrest contributes to 9c-induced proliferation inhibition, we further analyzed the cell cycle distribution upon 9c treatment and found that 9c was able to induce G2/M phase arrest in A549 cells. The proportion of G2/M phase cells in the control group was 23.9%, while it increased to 76.0% in the presence of 0.1 pM of 9c (Figure 2G). Furthermore, the levels of Cyclin B1 and p-cdc2, essential for the control of the cell cycle at the G2/M (mitosis) transition, were repressed significantly in a dose-dependent manner (Figure 2F and Figure S1C). These results reveal that 9c exerts a potent inhibitory effect on the proliferation of NSCLC cells by arresting the cell cycle at the G2/M phase.

2.2. 9c Induces Cell Apoptosis of A549 Cells and H1975 Cells

Next, we determined whether G2/M phase arrest induced by 9c resulted in cell apoptosis. Members of the caspase family of proteases play crucial roles in both the initiation and execution of apoptosis. Specifically, caspase-9 is typically the first caspase to be activated in response to apoptotic signals, while caspase-3 plays an essential role in apoptosis by cleaving PARP [26,27]. The ratio of Bax (an apoptosis promoter) to Bcl-2 (an apoptosis inhibitor), as a rheostat, was used to determine cell susceptibility to apoptosis [28,29]. As shown in Figure 3A and Figure S2A, the decrease in Bcl-2 expression was accompanied by the increase in Bak expression after 9c treatment. We also confirmed that cleaved caspase-9, cleaved caspase-3, and cleaved-PARP were significantly upregulated after 9c treatment in a dose-dependent manner. The levels of γ-H2AX, an critical marker of DNA double-strand breaks, was significantly elevated in a dose-dependent manner (Figure 3A), indicating that 9c induced DNA double-strand breaks. Meanwhile, the levels of caspase-8, an essential component of the death signal receptor pathway of apoptosis [30], remained unchanged following exposure to 9c treatment. Taken together, 9c induced A549 cell and H1975 cell apoptosis involved in the mitochondrial pathway rather than the death receptor pathway. Furthermore, we conducted an apoptosis analysis using Annexin V-FITC/PI staining and found that 9c facilitated a significant increase in the apoptosis rate of A549 cells. After a statistical analysis of the proportion of the apoptotic cells, it was observed that 0.1 pM, 1 pM, 10 pM, 100 pM, and 1000 pM 9c caused 8.65 ± 2.89%, 15.03 ± 5.07%, 15.84 ± 4.21%, 18.08 ± 3.53% and 20.99 ± 3.39% apoptotic cells, respectively, compared with 3.75 ± 1.93% apoptotic cells in the control group (Figure 3C). Taken together, these data clearly indicate that 9c suppresses the growth of A549 cells by G2/M phase arresting and then leads to cell apoptosis through the intrinsic mitochondrial pathway.
It was reported that FL118 inhibits the transcription and expression of survivin, XIAP and Mcl-1 [13]; these protein play important roles in suppressing apoptosis. Then, we further examined whether 9c has influences on the protein expression and mRNA transcription of these anti-apoptotic proteins (Figure 3D). Collectively, all these data illustrate that 9c possesses the capacity to induce cell apoptosis by restraining the genetic transcription and expressions of multiple anti-apoptosis-related proteins, similar to FL118.

2.3. 9c Inhibits Proliferation of A549 Cells Independent of Topo I Activitys

DNA topoisomerase I (Topo I) had been firmly demonstrated to be the molecular target of the CPT class of compounds [31]. However, the inhibitory effect of FL118 on topoisomerase I activity is not a primary determinant of its antitumor efficacy [13]. To ascertain whether 9c, with a similar molecular structure to CPT, plays an antitumor role as an inhibitor of Topoisomerase I, we employed the small interference targeting deletion of Topo I (si-Topo I) in A549 cells and then detected the inhibitory activity of 9c on the proliferation of A549 cells by SRB assay. The result showed that, after 9c treatment for 72 h, the presence of siTopo I had no discernible impact on the IC50 value of A549 cells (Figure 4A,B). However, the metabolically active substance SN38 of irinotecan was revealed, a marked reduction in its ability to inhibit the proliferation of A549 cells after the deletion of Topo I, which is 1766-fold higher in the IC50 value than the negative control group (Figure 4C). Thus, our results suggest that compound 9c exerts the suppression ability on the proliferation of A549 cells independent of Topo I activity.

2.4. Transcriptional and Proteomic Analysis of A549 Cells with or Without 9c Treatment

To explore and investigate the mechanism by which 9c elicits growth inhibition and cellular apoptosis, whole RNA sequencing was conducted to identify differentially DEGs by clustering the genes according to the similarity of gene expression profiles in 9c-treated A549 cells compared with its counterpart. Our data revealed 653 differentially expressed genes shown as a volcano plot (Figure 5A). The top 10 genes with the most obvious down-regulation are shown in Figure 5B. These genes are related to the cell cycle and cell proliferation; for example, CCNB2 and CENPF modulates the G2/M phase and cell division [32,33], which is consistent with our results above, i.e., blocking the G2/M phase to inhibit cell proliferation by 9c. Moreover, the DEGs were categorized based on cellular components (CCs), biological processes (BPs), and molecular functions (MFs). In the GO enrichment analysis, DEGs in 9c-treated cells were mainly enriched in the DNA damage response signal transduction by the p53 mediator, mitotic DNA damage checkpoint signaling, and the positive regulation of cysteine-type endopeptidase activity and were involved in the apoptotic process (Figure 5D). The KEGG enrichment analysis revealed a strong association of the DEGs in the 9c group with the regulation of the p53 signaling pathway, platinum drug resistance, and glioma and axon guidance (Figure 5C). Although transcription levels provide an overall indication of gene expression status, the post-translational regulation of RNA can impact the final abundance and activity of proteins to some extent. These effects may differ from those observed in a single transcription analysis. Therefore, we integrated a proteomic analysis to comprehensively elucidate the changes induced by 9c in A549 cells. The expression of DEPs in 9c-treated A549 cells was explored by clustering the proteins according to the similarity of proteins’ expression profiles of the samples. A heat map was generated to display the top 104 proteins with the smallest p-values, of which 44 proteins were up-regulated and 64 proteins were down-regulated in 9c-treated A549 cells. Different protein expression levels were indicated by different colors. For instance, the colors from blue to white to red denote expression levels from low to high, where blue indicates lowly expressed proteins and red indicates highly expressed proteins (Figure 5E). The functions of these DEPs were explored through KEGG enrichment analysis. Results showed that the top five categories with the most significant enrichment in the 9c group were largely associated with the PI3K-AKT signaling pathway, the p53 signaling pathway, pancreatic cancer, the Hippo signaling pathway, and the mTOR signaling pathway (Figure 5F). The aberrant activation of these signaling pathways is intricately associated with cell survival and proliferation, thereby contributing to the initiation and progression of cancer [31,32]. Correlation analysis between our transcriptome and proteome data yielded 22 overlapping genes, which were mainly enriched in the DNA damage, proliferation, and cell cycle in NSCLC cells (Table 1). Moreover, the p53 signaling pathway was identified through both data analyses. Collectively, these data support the view that 9c exerts potent inhibitory effects on the proliferation, cell cycle, and other malignant processes of NSCLC by regulating the p53 signaling pathway and PI3K-AKT-mTOR signaling pathway.

2.5. 9c Impairs the PI3K-AKT Pathway by Reducing the Stability of EGFRs

Stat3, Akt and ERK1/2 are signaling molecules in the downstream three main signal pathways of the EGFR, which is abnormally activated in various cancer cells [34,35,36]. In proteomic analysis, the PI3K-AKT-mTOR pathway showed a notable alteration in the 9c treatment group. Furthermore, we also discovered the reduced expression of the EGFR by 1.7-fold compared with the control group in the proteome data while not at the transcriptome level. We then examined the expressions and activations of these proteins as well as EGFRs by Western blot assay. As shown in Figure 6A and Figure S3A, after treatment with 0.1 pM, 1 pM, 10 pM and 100 pM of 9c for 24 h, 9c was confirmed to downregulate the protein level of EGFR in A549 and H1975 cells. The levels of stat3 and p-stat3 were not significantly changed, while the AKT and p-AKT were significantly decreased on A549 and H1975 cells in a concentration-dependent manner. On the contrary, p-ERK was markedly upregulated by 9c (Figure 6A and Figure S3A). It is worth noting that the above alterations upon 9c treatment were more pronounced than that of FL118 (Figure 6C and Figure S3B). Together, these data indicate that 9c exerts an anti-proliferative effect, potentially by impeding the EGFR-AKT pathway.
Subsequently, we sought to identify the specific mechanisms through which 9c downregulated the EGFR. Firstly, we determined the impact of 9c on the transcription of the EGFR to clarify the transcriptome data. It was revealed that there was no significant change with the mRNA level of the EGFR (Figure 6D), which is consistent with the transcription analysis. Therefore, it is considered that 9c may have influenced the protein degradation in the cytoplasm. The principal pathways responsible for protein degradation in eukaryote cells encompass the ubiquitin-proteasome pathway and autophagy lysosome pathway [37]. Firstly, lysosome inhibitor chloroquine was used to detect whether EGFR protein was degraded by the lysosome pathway. The results showed that chloroquine treatment did not prevent the reduction in EGFR protein levels (Figure 6E). However, treatment with the protease inhibitor MG132 [38] significantly rescued the 9c-induced downregulation of EGFR protein levels (Figure 6F). These results imply that 9c probably causes the degradation of EGFR protein via the ubiquitin-proteasome pathway. Subsequently, we treated the cells with cycloheximide (CHX), an inhibitor of protein synthesis in eukaryotic cells, to investigate the stability of the EGFR in the presence of compound 9c. As shown in Figure 6G compared with CHX treatment alone, the protein level of the EGFR decreased more expressively with the co-treatment of CHX and 9c, indicating that 9c shortens the lifetime of EGFR protein; that is, 9c has the ability to destabilize EGFR protein. To ensure the degradation of the EGFR-affected membrane recruitment of the EGFR, an immunofluorescence assay was utilized and demonstrated that 9c alleviated the abundance of EGFRs in the cell surface (Figure 6H). Overall, these results indicate that 9c induces EGFR protein degradation and lessens its membrane content through the ubiquitin proteasome pathway.

2.6. Degradation of EGFR Upregulates p53 by 9c Destabilizing NSA2

The p53 signaling pathway was recognized significantly in both proteomic and genomic KEGG enrichment analysis. It has been reported that the knockout of EGFRs promotes the expression of wild-type p53 but has no significant effect on mutant p53 [39]. In the previous results, we demonstrated that 9c induces the protein degradation of EGFRs, and, then, we determined the influence of 9c on the protein expression level of p53. The result showed that wild-type p53 in A549 rather than mutant p53 in H1975 cells was elevated noticeably in a dose and time-dependent manner upon 9c treatment (Figure 7A,B and Figure S4A). Naturally, in the p53-deficient cells, H358, no change was found in the p53 protein expression (Figure S4B). Furthermore, the cell proliferation ability was significantly alleviated in A549 cells with a knockdown of p53 upon 9c treatment, and its IC50 value exhibited a 1290-fold increase compared to the control group (Figure 7C,D). These findings indicate that 9c promotes p53 expression that is dependent on a decrease in EGFR protein levels, thereby enhancing the sensitivity of A549 to 9c treatment. To elucidate how 9c affects the EGFR-p53 signaling pathway, by mapping protein–protein interaction (PPI) networks of DEPs and their interactors, we identified a significant enrichment of NSA2 interactors (Figure 7E), suggesting that treatment with 9c potentially hampers cell proliferation, probably by impacting NSA2. The overexpression of NSA2 markedly enhanced tumor cell proliferation, which may be attributable to the downregulation of p53 expression [40]. In the proteomic data, we observed that 9c led to a significant decrease in the abundance of NSA2, which was confirmed by Western blot assay in A549 and H1975 cells in a dose-and time-dependent manner. In addition, the protein level of NSA2 was also found to be decreased in p53-deficient H358 cells at the same dose (Figure S4B). Because the NSA2 gene was not observed to be down-regulated in RNA sequencing analysis, we speculated that 9c affected the stability of NSA2 protein. To demonstrate the hypothesis, A549 cells were studied in the presence of protein synthesis inhibitor CHX following treatment with 9c. It was revealed that NSA2 was substantially destabilized by 55.2% as compared to CHX (Figure 7F). Moreover, the treatment with the protease inhibitor MG132 significantly rescued the 9c-induced downregulation of NSA2 in protein levels (Figure 7G). These data suggest that 9c abates the stability of NSA2 protein. Significantly, the knockdown of NSA2 decreased the EGFR protein level in p53 wild-type A549 cells, as well as in p53 mutant H1975 cells, but only increased p53 in A549 cells rather than in H1975 cells (Figure 7H and Figure S4C). Not only that, siNSA2 exhibited a more pronounced attenuation of the inhibitory effect of 9c on cell proliferation in A549 cells compared to H1975 cells, with the decrease in IC50 value by 527.3-fold in A549 cells and 14.73-fold in H1975 cells (Figure 7I and Figure S4D). Moreover, we proved that siRNA targeting the EGFR enhanced the p53 expression in A549 cells and had no apparent impact on p53 mutant H1975 cells, which is in line with previous reports [39]. Meanwhile, no significant alteration in the NSA2 protein level was found in both A549 and H1975 cells (Figure 7J and Figure S4E). These results imply that 9c exerts a proliferative inhibitory effect through the NSA2-EGFR signal pathway in p53 wild and p53 mutant cell lines. Collectively, all the findings indicate that 9c induces the degradation of EGFRs by mitigating the stability of NSA2 and exhibits more potent cytotoxicity in the cancer cells with wild-type p53 by upregulating p53 due to the degradation of EGFRs. Together, these data suggest that 9c exerts its anti-tumor effects mainly through inhibition of the NSA2-EGFR signaling pathway (Figure 7K).

2.7. 9c Suppresses the Growth of A549 Xenograft In Vivo

To observe that the efficacy of in vitro can be validated within the physiological context, a study was conducted utilizing the A549 xenograft model. 9c was given at various doses by intragastric administration once per week upon reaching a tumor volume of 100 mm3. The results are illustrated in Figure 8. The tumor volume exhibited a significant dose-dependent reduction in the 9c treatment group (Figure 8B). At the end of the experiment, tumor tissue is dissected and photographed (Figure 8A). The weights of both the tumor tissues and mice were measured. 9c significantly suppressed tumor growth, with tumor growth inhibitory rates of 44.22% (0.375 mg/kg), 56.33% (0.75 mg/kg), and 79.57% (1.5 mg/kg) in a dose-dependent manner, respectively (Figure 8C). Fortunately, the nude mice bodies weighed at the indicated dose of the 9c group were not obviously affected compared with control group (Figure 8D). These findings indicate that 9c has the capacity to repress non-small cell lung cancer growth in vivo with weak toxicity.

2.8. 9c in Combination with AMG510 Exerts Synergistic Antitumor Effects

The combination of conventional chemotherapy drugs and novel drugs is often considered to increase the benefit to patients. AMG510 is an orally active, first-in-class, small molecule inhibitor targeting against K-RASG12C, which inhibits the augmented activation of the RAS-ERK1/2 signaling pathway resulting from mutants of RAS. However, AMG510 leads to the activation of EGFR and PI3K-AKT pathways at advanced stages during treatment, thereby attenuating the efficacy and ultimately resulting in resistance [41]. As mentioned above, 9c facilitates the degradation of the EGFR and blocks the PI3K-AKT signaling pathway. Therefore, the combination treatment 9c with AMG510 may reinforce the antitumor efficacy of AMG510. Firstly, we examined the inhibitory proliferation ability of the co-administration of them in the H358 cell with the K-RASG12C mutant, we found that the cells up-regulated the expressions of the EGFR, p-EGFR, AKT and p-AKT after AMG510 treatment (Figure 9A), and we discovered that the combination had a synergistic effect on the cell growth of NCI-H358 cells, with the combination indices (CIs) less than 0.9 (Figure 9B,C). Subsequently, the in vivo effects of AMG510 and 9c combination therapy against NCI-H358 xenografts were assessed. Nude mice were inoculated with NCI-H358 cells and then received individual or combined drug treatments via intraperitoneal injection when the tumor volume reached 100 mm3. It was shown that neither AMG510 nor FL118 alone displayed significant efficacy against the tumor at the indicated dosage. In addition, CPT alone had no significant effectiveness on tumor progress at a dose of 0.75 mg/kg similar to 9c. Meanwhile, 9c was unveiled to repress the tumor growth with the inhibitory rate at 64.38% Furthermore, as anticipated, the pilot combination therapy (AMG510+9c) resulted in dramatically reduced tumor growths, with tumor growth inhibition rates up to 81.38% compared with control mice, and exhibited superiority over AMG510 monotherapy (Figure 9D–F). With these doses, all the mice in the treatment groups survived during the experiments. The body weight of mice treated with the combination of AMG510 and 9c was not reduced during 4 weeks after the treatment, indicating the negligible toxicity in the combination therapy (Figure 9G). At the end of the experiment, tumors were isolated, and signaling proteins were detected by Western blot. 9c had the capability to decrease the protein levels of the EGFR, p-AKT, P-ERK and NSA2 in tumor tissue from NCI-H358 xenografts (Figure 9H). Altogether, the combination therapy with AMG510 and 9c had superior anti-tumor benefits in K-RAS G12C mutant NSCLC.

3. Discussion

In the presence of this paper, we provide evidence to demonstrate that 9c, a novel camptothecin derivatives, exhibits impressively potential in combating the growth of NSCLC without known specific molecular targets in vitro and in vivo with efficacy superior to FL118, a well-known camptothecin analog. These above effects may be achieved by destabilizing the NSA2-EGFR axis by 9c.
Our data showed that 9c suppressed the proliferation of A549 and H1975 cells by arresting the cell cycle at the G2/M phase, thereby resulting in cell apoptosis. Furthermore, 9c induced apoptosis involved in the mitochondrial pathway by regulating transcriptions and expressions of multiple anti-apoptosis-related proteins, such as Mcl-1, Bcl-2, XIAP, and survivin, with a similar effect as FL118. Additionally, comparable to FL118, 9c was also observed to repress the proliferation of A549 cells independent of Topo I activity. Meanwhile, the anti-tumor spectrum of 9c was by no means different from that of FL118. CPT and its analogs target topoisomerase I (Topo I) as their therapeutic mechanism. In contrast, the sensitivity of human cancer cells or tumors to FL118 is independent of Topo I expression, similar to the behavior observed with 9c. Notably, FL118 inhibits cancer cell growth at concentrations ranging from high pM to nM, whereas its inhibition of Topo I activity occurs at micromolar μM levels [13]. The findings suggest that the 9c may act on alternative molecules in cancer cells.
Over the past years, intensive medicinal chemistry efforts have generated numerous CPT derivatives, and the variety of biological activities and medicinal applications exhibited by CPT analogs are impressive. It has already been noted that CPT may affect cellular function at loci other than Topo I, for example, functions as the inhibitor of acetylcholinesterase activity and HIF-1 [42]. FL118 has been reported to strongly bind to and degrade the DDX5 oncoprotein via the proteasome degradation pathway without decreasing DDX5 mRNA, thereby controlling the expression of multiple oncogenic proteins, including survivin, Mcl-1, XIAP, Ciap [43]. Additionally, FL118 was also suggested to inhibit p53 ubiquitination by blocking Mdm2–MdmX E3 complex formation via the targeting degradation of MdmX. Herein, we clarified that 9c induced the degradation of EGFRs by mitigating the stability of NSA2. All together, we speculate that FL118 and its derivatives can actually act as a ’molecular glue degrader’ to directly glue some protein and ubiquitination regulators together to degrade these protein, and which protein will be glued is highly dependent on the derivative primary structure and steric configuration although sharing the same core structure as them.
The frequent overexpression and/or mutation of EGFRs in lung cancer play an active role in facilitating cell proliferation [44,45], and EGFR-AKT, EGFR-STAT and EGFR-ERK signaling pathways play crucial roles in regulating various cellular processes essential for growth and survival. The abnormalities of these pathways have been extensively documented in numerous human tumors, and inhibitors against these pathways promote cell apoptosis [46,47]. We found that 9c distinctly decreased the protein levels of EGFRs through the ubiquitin-proteasome pathway thorough destabilizing NSA2 and subsequently inhibiting the down-streaming signaling pathway of EGFR-AKT. The advantage of EGFR degradation reduces the possibility of its secondary mutation. Surprisingly, compound 9c heightened the activation of ERK, probably due to the activation of alternative pathways in tumor cells resulting from the potent inhibition of EGFRs, as it has reported that the EGFR inhibitor causes the activation of ERK signaling mediated by SRC bypass [48]. The above characteristics of 9c prompted us to evaluate antitumor effects of the combination of 9c and AMG510, and the desired synergetic outcome has been attained. It has been reported that the upstream activation of several RTKs interferes with the KRASG12C blockade, and EGFR signaling appears to be a predominant mechanism underlying colorectal cancer resistance to AMG510 [49]. In our study, we found that the activation of the EGFR-AKT pathway occurred in the early treatment of AMG510. Therefore, 9c in combination with AMG510 probably impedes the resistance occurrence upon AMG510 therapy. Our findings present a significant application of 9c in the context of clinical combination therapy with a KRAS inhibitor in the future.
The tumor suppressor protein p53 serves as a stress-responsive transcription factor and a key determinant of cancer therapy responses [50,51]. p53 is activated in response to chemotherapy, radiation, and other DNA-damaging stresses. The activation of p53 leads to the repression of CDKs and cyclin B, which are essential for mitotic entry and contribute to G2/M phase arrest [52,53]. In addition, p53 binds physically to anti-apoptotic proteins (Bcl-2, Bcl-xL and Mcl-1) and inhibits the transcriptions and expressions of them, thereby indirectly inducing apoptosis [54]. The present results of 9c are in line with these reports. P53 is a wild-type in  50% of non-small cell lung cancers (NSCLCs) [51]. It has reported that FL118 exhibits cytotoxic effects in both a p53-independent and p53-dependent manner. Consistently, 9c demonstrated potent cytotoxicity against both wild-type and mutant p53 cancer cells. p53 wild-type status has been associated with improved therapy responses and better outcomes in NSCLCs in several studies [55,56,57]. Not surprisingly, 9c exhibits more potent cytotoxicity in the cancer cells with wild-type p53.
NSA2 is highly expressed in a variety of tumor cells, such as A549 and HepG2 cells [58]. However, the role of NSA2 in cancer development remains obscure. In this present study, 9c can be regarded as a molecular probe, and we disclose for the first time that NSA2 functions as a stabilizer of EGFR protein, in turn recruiting more EGFRs onto the cell membrane to enhance the PI3K-AKT proliferative signaling pathway along with the down-regulation of p53 in the wild-p53 cancer cells, which provides the possible mechanism of NSA2 in the cancer progress. Further research is required to demonstrate how 9c promotes NSA2 degradation, and the mechanism by which NSA2 induces the degradation of EGFRs remains to be elucidated.

4. Materials and Methods

4.1. Cell Culture

Human cell line MGC80-3, HCT116, ASPC-1, HepG2, SH-SY5Y, A549, H1299, Beas-2b, Bel7402, H1975, NCI-H358 and NCI-H446 were provided by the Institute of Biochemistry and Cell Biology, the Chinese Academy of Sciences (Shanghai, China). MCF-7, (Adriamycin-resistant) MCF-7/ADR, NCI-H446, MGC80-3, H1975, Beas-2b, NCI-H358, Bel7402, and ASPC-1 were cultured in 1640 medium (Gibco, Grand Island, NY, USA), which was supplemented with 10% fetal bovine serum, an additional 25 mg/L of glucose, and 1 mM of sodium pyruvate (Solarbio, Beijing, China). HCT116 and SH-SY5Y were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum. HepG2 was maintained in Minimum Essential Medium supplemented with 10% fetal bovine serum. A549 cells were cultured in F-12K medium supplemented with 10% fetal bovine serum. All cells were grown to confluence at 37 °C in a humidified atmosphere with 5% CO2.

4.2. Cell Transfection

si-Topo I, si-TP53, si-EGFR, si-NSA2 and the scrambled negative control were purchased from GenePharma (Shanghai, China). Cells were seeded in 6-well plates, incubated overnight, and then transiently transfected with siRNA and the negative control using Lipofectamine 3000 (Invitrogen, Inc., Waltham, MA, USA) according to the manufacturer’s instructions. Si-Topo I targets human Topo I at 5′-GAAAGGAAAUGACUAAUGAUU-3′, si-P53 at 5′-GACUCCAGUGGUAAUCUACTT-3′. si-EGFR at 5′-GAGGCAAAGUGCCUAUCAATT-3′.si-NSA2 #1 GAGCUAAAGUACUUUCCAATT, #2 GGGUGUUAUUACCAAAGGUTT. As a control, we used the negative-control siRNA from GenePharma (GenePharma Co., Ltd., Shanghai, China)

4.3. Extraction of Total RNA and RT-qPCR

Total RNA was extracted with the Trizol reagent (Invitrogen, Waltham, MA, USA). cDNA was synthesized with M-MLV reverse transcriptase (Promega, Fitchburg, WI, USA) and quantified by real-time qPCR using a Biosystems StepOne™ Real-Time PCR system and Fast SYBR Green Master Mix (Applied Biosystems, Foster, CA, USA), with β-actin as internal controls. PCR primers were designed with the NCBI online software Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome, accessed on 16 May 2023) and synthesized by Tsingke (Tsingke Biotechnology Co., Ltd., Beijing, China). The PCR conditions were as follows: 94 °C for 2 min, followed by 30 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min, and 72 °C for 10 min. The primer sequences were as follows: β-actin, forward 5′ CGAGATCCCTCCAAAATCAA 3′; and reverse, 5′ TTCACACCCATGACGAACAT 3′, survivin, forward 5′ TGGCGTA AGATGATGGA 3′; and reverse, 5′ TAGGGACGACGATGAAA 3′, XIAP, forward 5′ AACACGTACTTGTGCG 3′; and reverse, 5′ ACTTTGATCTGGCTCA 3′, Mcl-1, forward 5′ AAAGCCTGTCTGCCAAAT 3′; and reverse, 5′ TATAAACCCACCACT CCC 3′, Bcl-2, forward 5′ GCCTTCTTTGAGTTCG 3′; and reverse, 5′ CAGCCTC CGTTATCC 3′, EGFR, forward 5′-TCTCAGCAACATGTCGATGG-3′ reverse, 5′-TCGCACTTCTTACACTTGCC-3′.

4.4. Western Blot

Cells were lysed in cell lysis buffer for Western blot (Beyotime Biotechnology, Shanghai, China) supplemented with a protease inhibitor PMSF at 4 °C for 30 min. Protein concentrations of the lysates were measured using the BCA reagent (Beyotime Biotechnology). Equal amounts of protein were run on 10% SDS-PAGE gels, then transferred to nitrocellulose membranes (Pall), and probed with the indicated primary antibodies. Anti-rabbit and anti-mouse (1:5000) HRP-conjugated secondary antibodies were used. Blots were detected by chemiluminescence with the enhanced chemiluminescence detection reagents (PIERCE, Rockford, IL, USA). The primary antibodies included GAPDH (Abclonal, Wuhan, China, AC002), β-tubulin (Abclonal, China, AC021), Cyclin B1 (12231), cdc2 (77055), p-cdc2 (2543), Cleaved Caspase-3 (9664), Cleaved Caspase-9 (9505), Cleaved PARP (5625), Bak (12105), Bcl-2 (4223), Mcl-1 (5453), survivin (2808), γ-H2AX (2577), stat3 (12640), p-stat3 (9145), erk1/2 (4695), p-erk1/2 (9101), AKT (4691), and p-AKT (4060), EGFR (4267), p-EGFR (3777) (Cell Signaling Technology, Boston, MA, USA), NSA2 (ER61622) and p53 (ET1601-13) (HUABIO, Hangzhou, China). CPT and AMG510 were purchased from MedChemExpress (Hoboken, NJ, USA).

4.5. Cell Proliferation Assay

SRB assays, an MTT assay, and a CCK-8 assay were used to measure the inhibition of cancer cell proliferation. For the SRB assay, adherent cells were seeded in 96-well plates (5000 cells/well) and treated with various concentrations of the indicated samples. After 72 h, the cells are immobilized with TCA and tinted with an SRB stain. The SRB stain that bound to cells was dissolved and quantitatively analyzed at a wavelength of 515 nm. For the MTT assay, MTT was added and incubated at 37 °C for another 4 h. The formazan product was dissolved and quantitated by spectrophotometry at a wavelength of 570 nm. The cytotoxicity of compounds was expressed as IC50. For the CCK-8 assay, CCK-8 was added and incubated at 37 °C for another 1 h, and the CCK-8 was quantitatively analyzed at a wavelength of 450 nm. All experiments were repeated at least three times.

4.6. Colony Formation Assay

A549 and H1975 cells were plated into 6-well plates at a density of 500 cells per well, treated with various concentrations of 9c for 2 weeks. Then, cells were fixed in methanol at room temperature for 3 min and immersed in Giemsa for 15 min. Finally, the colonies were counted and photographed.

4.7. Flow Cytometry for Cell Apoptosis

The apoptosis was performed using the Annexin V-FITC/PI apoptosis detection kit (Absin Bioscience Inc., Shanghai, China) according to the manufacturer’s instructions. In brief, 1 × 106 cells were incubated with various concentrations of 9c for 24 h, then harvested by centrifugation, and washed with PBS twice. Cells were resuspended in a 100 μL binding buffer containing Annexin V-FITC (5 μL) and PI (5 μL) followed by incubation for 10 min at room temperature in the dark. Before flow cytometric analysis, 400 μL of binding buffer was added. After filtration, cells were analyzed by flow cytometry (MFLO XDP; Beckman Coulter, Brea, CA, USA).

4.8. Immunofluorescence Assay

A549 cells were permeabilized with 0.1% Triton X-100 in PBS and blocked with 1% bovine serum albumin followed by incubation with the indicated antibodies overnight. Cells were then stained with secondary antibodies. 4,6-Diamidino-2-phenylindole was used to visualize the nuclei.

4.9. RNA-Seq Analysis

Total RNA was extracted from the tissue using the TRIzol® Reagent according to the Manufacturer instructions. Then, RNA quality was determined by a 5300 Bioanalyzer (Agilent, Santa Clara, CA, USA) and quantified using the ND-2000 (NanoDrop Technologies, Wilmington, DE, USA). RNA purification, reverse transcription, library construction, and sequencing were performed at Shanghai Majorbio Bio-pharm Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer’s instructions (Illumina, San Diego, CA, USA). The XX RNA-seq transcriptome library was prepared following Illumina® Stranded mRNA Prep, Ligation from Illumina (San Diego, CA, USA), using 1 μg of total RNA.

4.10. Proteomic Analysis

In total, 300 μL of 8M urea was added to the sample, and the protease inhibitor was added at 10% of the lysate. After centrifuging at 14,100× g for 20 min, the supernatant was collected. The protein concentration was determined using the Bradford method, and rest was frozen to −80 °C. The proteins were identified by the LC–MS/MS approach (Qinglian Biotech Co., Ltd., Beijing, China). All RAW files were analyzed using the Proteome Discoverer suite (version 2.4, Thermo Fisher Scientific, Waltham, MA, USA).

4.11. Cell Cycle Analysis

A549 cells were incubated with various concentrations of 9c for 24 h. After that, the cells were collected and washed in PBS and fixed in ice-cold 70% (v/v) ethanol overnight at −20 °C. Cells were resuspended in PBS and stained with a mixture containing RNase (10 μg/mL) and PI (50 μg/mL) for 20 min in the dark. After filtration, cells were analyzed by flow cytometry (MFLO XDP; Beckman Coulter, Pasadena, CA, USA).

4.12. In Vivo Study

Male BALB/c-nu mice aged 4–6 weeks were purchased from Charles River. The mice were housed in a pathogen-free animal facility and randomly assigned to the control or experimental group. For each cell line, 8 × 106 A549 or NCI-H358 cells were resuspended in 200 μL of PBS and then subcutaneously injected into the BALB/c-nu mice. Tumor formation was monitored every three or four days by measuring the largest and smallest diameter of the formed tumors. The tumor volumes of these mice were checked to assess tumor growth. When the tumors reached about 100 mm3, the tumor-bearing mice were randomly allocated to various experimental groups and treated by intragastric administration with different drugs. When the tumor volume reached about 1500 mm3, tumors were excised, weighed, ground, and disrupted on ice for 30 min in the loading buffer, and, then, they were boiled for 15 min. Protein levels were analyzed by Western blot. Animal care practices and all experiments were reviewed and approved by the Committee on the Ethics of Animal Experiments of Ocean University of China.

4.13. Statistical Analysis

All statistical analyses were performed using SPSS 17.0 (SPSS, Chicago, IL, USA) with one-way ANOVA. All data are presented as the mean ± S.E.M. A p value less than 0.05 is indicated with *, and a value less than 0.01 is indicated with **.

5. Conclusions

In summary, 9c exerts a potential antitumor effect in non-small cell lung cancers in vitro and in vivo through the NSA2-EGFR signaling pathway, which is more effective in p53-wild-type NSCLCs. Moreover, 9c has the capability to significantly improve the antitumor effect of AMG510. Our finding indicates that 9c is a promising new CPT derivative worthy of studying in the future.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms26051987/s1.

Author Contributions

F.D. and A.Z.: methodology, writing—original draft. X.Q.: data curation. R.Y.: investigation. T.J.: conceptualization, the synthesis of compounds. J.L.: conceptualization, project administration, funding acquisition, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China [No. 82273847], the State Key Program of National Natural Science of China [82030074], and the Shandong Provincial Natural Science Foundation [ZR2023MH116].

Institutional Review Board Statement

All animal studies were approved the Institutional Animal Care and the Ethics for Animal Experiments committee of the Ocean University of China (OUC-AE-2022-086).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within this article or the Supplementary Materials.

Conflicts of Interest

All authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
MCL-1Myeloid cell leukemia 1
Bcl-2B-cell lymphoma-2
XIAPX-linked inhibitor of apoptosis protein
NSA2Nop seven-associated 2
EGFREpidermal growth factor receptor
KRASKirsten rat sarcoma viral oncogene homolog
SRBSulforhodamine B
MTT3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di- phenytetrazoliumromide
PARPPoly ADP-ribose polymerase
BaxBcl-2-associated X protein
Stat3Signal transducer and activator of transcription 3
AKTProtein Kinase B
ERKExtracellular-regulated protein kinase

References

  1. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef] [PubMed]
  2. Schrank, Z.; Chhabra, G.; Lin, L.; Iderzorig, T.; Osude, C.; Khan, N.; Kuckovic, A.; Singh, S.; Miller, R.J.; Puri, N. Current Molecular-Targeted Therapies in NSCLC and Their Mechanism of Resistance. Cancers 2018, 10, 224. [Google Scholar] [CrossRef] [PubMed]
  3. Favaretto, A.; Pasello, G.; Magro, C.; Schettino, C.; Gridelli, C. Second and third line treatment in non-small cell lung cancer. Crit. Rev. Oncol. Hematol. 2009, 71, 117–126. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, Z.; Fillmore, C.M.; Hammerman, P.S.; Kim, C.F.; Wong, K.K. Non-small-cell lung cancers: A heterogeneous set of diseases. Nat. Rev. Cancer 2014, 14, 535–546. [Google Scholar] [CrossRef]
  5. Imyanitov, E.N.; Iyevleva, A.G.; Levchenko, E.V. Molecular testing and targeted therapy for non-small cell lung cancer: Current status and perspectives. Crit. Rev. Oncol. Hematol. 2021, 157, 103194. [Google Scholar] [CrossRef]
  6. Imielinski, M.; Berger, A.H.; Hammerman, P.S.; Hernandez, B.; Pugh, T.J.; Hodis, E.; Cho, J.; Suh, J.; Capelletti, M.; Sivachenko, A.; et al. Mapping the hallmarks of lung adenocarcinoma with massively parallel sequencing. Cell 2012, 150, 1107–1120. [Google Scholar] [CrossRef]
  7. Kadara, H.; Choi, M.; Zhang, J.; Parra, E.R.; Rodriguez-Canales, J.; Gaffney, S.G.; Zhao, Z.; Behrens, C.; Fujimoto, J.; Chow, C.; et al. Whole-exome sequencing and immune profiling of early-stage lung adenocarcinoma with fully annotated clinical follow-up. Ann. Oncol. 2017, 28, 75–82. [Google Scholar] [CrossRef]
  8. Bodor, J.N.; Boumber, Y.; Borghaei, H. Biomarkers for immune checkpoint inhibition in non-small cell lung cancer (NSCLC). Cancer 2020, 126, 260–270. [Google Scholar] [CrossRef]
  9. Pommier, Y. Topoisomerase I inhibitors: Camptothecins and beyond. Nat. Rev. Cancer 2006, 6, 789–802. [Google Scholar] [CrossRef]
  10. Liew, S.T.; Yang, L.X. Design, synthesis and development of novel camptothecin drugs. Curr. Pharm. Des. 2008, 14, 1078–1097. [Google Scholar] [CrossRef]
  11. Li, Q.Y.; Zu, Y.G.; Shi, R.Z.; Yao, L.P. Review camptothecin: Current perspectives. Curr. Med. Chem. 2006, 13, 2021–2039. [Google Scholar] [CrossRef] [PubMed]
  12. Zunino, F.; Dallavalleb, S.; Laccabuea, D.; Berettaa, G.; Merlinib, L.; Pratesi, G. Current status and perspectives in the development of camptothecins. Curr. Pharm. Des. 2002, 8, 2505–2520. [Google Scholar] [CrossRef] [PubMed]
  13. Ling, X.; Cao, S.; Cheng, Q.; Keefe, J.T.; Rustum, Y.M.; Li, F. A novel small molecule FL118 that selectively inhibits surviving, Mcl-1, XIAP and cIAP2 in a p53-independent manner, shows superior antitumor activity. PLoS ONE 2012, 7, e45571. [Google Scholar] [CrossRef] [PubMed]
  14. Li, F. Anticancer drug FL118 is more than a survivin inhibitor: Where is the Achilles’ heel of cancer? Am. J. Cancer Res. 2014, 4, 304–311. [Google Scholar]
  15. Zhao, J.; Ling, X.; Cao, S.; Liu, X.; Wan, S.; Jiang, T.; Li, F. Antitumor activity of FL118, a surviving, Mcl-1, XIAP, and cIAP2 selective inhibitor, is highly dependent on its primary structure and steric configuration. Mol. Pharm. 2014, 11, 457–467. [Google Scholar] [CrossRef]
  16. Ling, X.; Xu, C.; Fan, C.; Zhong, K.; Li, F.; Wang, X. FL118 induces p53-dependent senescence in colorectal cancer cells by promoting degradation of MdmX. Cancer Res. 2014, 74, 7487–7497. [Google Scholar] [CrossRef]
  17. Wu, G.; Mai, X.; Liu, F.; Lin, M.; Dong, X.; Xu, Q.; Hao, C.; Zhang, L.; Yu, R.; Jiang, T. Synthesis of novel 10,11-methylenedioxy-camptothecin glycoside derivatives and investigation of their anti-tumor effects in vivo. RSC Adv. 2019, 9, 11142–11150. [Google Scholar] [CrossRef]
  18. Pommier, Y.; Kohlhagen, G.; Kohn, K.W.; Leteurtre, F.; Wani, M.C.; Wall, M.E. Interaction of an alkylating camptothecin derivative with a DNA base at topoisomerase I-DNA cleavage sites. Proc. Natl. Acad. Sci. USA 1995, 92, 8861–8865. [Google Scholar] [CrossRef]
  19. Dallavalle, S.; Delsoldato, T.; Ferrari, A.; Merlini, L.; Penco, S.; Carenini, N.; Perego, P.; De Cesare, M.; Pratesi, G.; Zunino, F. Novel 7-substituted camptothecins with potent antitumor activity. J. Med. Chem. 2000, 43, 3963–3969. [Google Scholar] [CrossRef]
  20. Dallavalle, S.; Merlini, L.; Morini, G.; Musso, L.; Penco, S.; Beretta, G.L.; Tinelli, S.; Zunino, F. Synthesis and cytotoxic activity of substituted 7-aryliminomethyl derivatives of camptothecin. Eur. J. Med. Chem. 2004, 39, 507–513. [Google Scholar] [CrossRef]
  21. Perego, P.; De Cesare, M.; De Isabella, P.; Carenini, N.; Beggiolin, G.; Pezzoni, G.; Palumbo, M.; Tartaglia, L.; Pratesi, G.; Pisano, C.; et al. A novel 7-modified camptothecin analog overcomes breast cancer resistance protein-associated resistance in a mitoxantrone-selected colon carcinoma cell line. Cancer Res. 2001, 61, 6034–6037. [Google Scholar] [PubMed]
  22. De Cesare, M.; Beretta, G.L.; Tinelli, S.; Benedetti, V.; Pratesi, G.; Penco, S.; Dallavalle, S.; Merlini, L.; Pisano, C.; Carminati, P.; et al. Preclinical efficacy of ST1976, a novel camptothecin analog of the 7-oxyiminomethyl series. Biochem. Pharmacol. 2007, 73, 656–664. [Google Scholar] [CrossRef] [PubMed]
  23. Pisano, C.; De Cesare, M.; Beretta, G.L.; Zuco, V.; Pratesi, G.; Penco, S.; Vesci, L.; Fodera, R.; Ferrara, F.F.; Guglielmi, M.B.; et al. Preclinical profile of antitumor activity of a novel hydrophilic camptothecin, ST1968. Mol. Cancer Ther. 2008, 7, 2051–2059. [Google Scholar] [CrossRef] [PubMed][Green Version]
  24. Zhang, G.; Yin, R.; Dai, X.; Wu, G.; Qi, X.; Yu, R.; Li, J.; Jiang, T. Design, synthesis, and biological evaluation of novel 7-substituted 10,11-methylenedioxy-camptothecin derivatives against drug-resistant small-cell lung cancer in vitro and in vivo. Eur. J. Med. Chem. 2022, 241, 114610. [Google Scholar] [CrossRef]
  25. Ling, X.; Liu, X.; Zhong, K.; Smith, N.; Prey, J.; Li, F. FL118, a novel camptothecin analogue, overcomes irinotecan and topotecan resistance in human tumor xenograft models. Am. J. Transl. Res. 2015, 7, 1765–1781. [Google Scholar]
  26. Boulares, A.H.; Yakovlev, A.G.; Ivanova, V.; Stoica, B.A.; Wang, G.; Iyer, S.; Smulson, M. Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells. J. Biol. Chem. 1999, 274, 22932–22940. [Google Scholar] [CrossRef]
  27. Boice, A.; Bouchier-Hayes, L. Targeting apoptotic caspases in cancer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118688. [Google Scholar] [CrossRef]
  28. Cosentino, K.; Hertlein, V.; Jenner, A.; Dellmann, T.; Gojkovic, M.; Pena-Blanco, A.; Dadsena, S.; Wajngarten, N.; Danial, J.S.H.; Thevathasan, J.V.; et al. The interplay between BAX and BAK tunes apoptotic pore growth to control mitochondrial-DNA-mediated inflammation. Mol. Cell 2022, 82, 933–949.e9. [Google Scholar] [CrossRef]
  29. Song, S.; Jacobson, K.N.; McDermott, K.M.; Reddy, S.P.; Cress, A.E.; Tang, H.; Dudek, S.M.; Black, S.M.; Garcia, J.G.; Makino, A.; et al. ATP promotes cell survival via regulation of cytosolic [Ca2+] and Bcl-2/Bax ratio in lung cancer cells. Am. J. Physiol. Cell Physiol. 2016, 310, C99–C114. [Google Scholar] [CrossRef]
  30. Yu, J.W.; Shi, Y. FLIP and the death effector domain family. Oncogene 2008, 27, 6216–6227. [Google Scholar] [CrossRef]
  31. Liu, L.F.; Desai, S.D.; Li, T.K.; Mao, Y.; Sun, M.; Sim, S.P. Mechanism of action of camptothecin. Ann. N. Y. Acad. Sci. 2000, 922, 1–10. [Google Scholar] [CrossRef] [PubMed]
  32. Li, J.; Huang, H.Y.; Lin, Y.C.; Zuo, H.; Tang, Y.; Huang, H.D. Cinnamomi ramulus inhibits cancer cells growth by inducing G2/M arrest. Front. Pharmacol. 2023, 14, 1121799. [Google Scholar] [CrossRef] [PubMed]
  33. Huang, Y.G.; Li, D.; Wang, L.; Su, X.M.; Tang, X.B. CENPF/CDK1 signaling pathway enhances the progression of adrenocortical carcinoma by regulating the G2/M-phase cell cycle. J. Transl. Med. 2022, 20, 78. [Google Scholar] [CrossRef] [PubMed]
  34. Mohassab, A.M.; Hassan, H.A.; Abdelhamid, D.; Abdel-Aziz, M. STAT3 transcription factor as target for anti-cancer therapy. Pharmacol. Rep. 2020, 72, 1101–1124. [Google Scholar] [CrossRef]
  35. Miricescu, D.; Totan, A.; Stanescu, S., II; Badoiu, S.C.; Stefani, C.; Greabu, M. PI3K/AKT/mTOR Signaling Pathway in Breast Cancer: From Molecular Landscape to Clinical Aspects. Int. J. Mol. Sci. 2020, 22, 173. [Google Scholar] [CrossRef]
  36. Sugiura, R.; Satoh, R.; Takasaki, T. ERK: A Double-Edged Sword in Cancer. ERK-Dependent Apoptosis as a Potential Therapeutic Strategy for Cancer. Cells 2021, 10, 2509. [Google Scholar] [CrossRef]
  37. Wang, X.J.; Yu, J.; Wong, S.H.; Cheng, A.S.; Chan, F.K.; Ng, S.S.; Cho, C.H.; Sung, J.J.; Wu, W.K. A novel crosstalk between two major protein degradation systems: Regulation of proteasomal activity by autophagy. Autophagy 2013, 9, 1500–1508. [Google Scholar] [CrossRef]
  38. Myung, J.; Kim, K.B.; Crews, C.M. The ubiquitin-proteasome pathway and proteasome inhibitors. Med. Res. Rev. 2001, 21, 245–273. [Google Scholar] [CrossRef]
  39. Ding, J.; Li, X.; Khan, S.; Zhang, C.; Gao, F.; Sen, S.; Wasylishen, A.R.; Zhao, Y.; Lozano, G.; Koul, D.; et al. EGFR suppresses p53 function by promoting p53 binding to DNA-PKcs: A noncanonical regulatory axis between EGFR and wild-type p53 in glioblastoma. Neuro. Oncol. 2022, 24, 1712–1725. [Google Scholar] [CrossRef]
  40. Li, W.; Song, A.P.; Zhao, F.; Hu, Y.M.; Hua, M. A novel human TINP1 gene promotes cell proliferation through inhibition of p53 and p21 expression. Oncol. Rep. 2013, 30, 1848–1852. [Google Scholar] [CrossRef]
  41. Chan, C.H.; Chiou, L.W.; Lee, T.Y.; Liu, Y.R.; Hsieh, T.H.; Yang, C.Y.; Jeng, Y.M. PAK and PI3K pathway activation confers resistance to KRAS(G12C) inhibitor sotorasib. Br. J. Cancer 2023, 128, 148–159. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, Y.Q.; Li, W.Q.; Morris-Natschke, S.L.; Qian, K.; Yang, L.; Zhu, G.X.; Wu, X.B.; Chen, A.L.; Zhang, S.Y.; Nan, X.; et al. Perspectives on biologically active camptothecin derivatives. Med. Res. Rev. 2015, 35, 753–789. [Google Scholar] [CrossRef] [PubMed]
  43. Ling, X.; Wu, W.; Aljahdali, I.A.M.; Liao, J.; Santha, S.; Fountzilas, C.; Boland, P.M.; Li, F. FL118, acting as a ‘molecular glue degrader’, binds to dephosphorylates and degrades the oncoprotein DDX5 (p68) to control c-Myc, survivin and mutant Kras against colorectal and pancreatic cancer with high efficacy. Clin. Transl. Med. 2022, 12, e881. [Google Scholar] [CrossRef] [PubMed]
  44. Soria, J.C.; Ohe, Y.; Vansteenkiste, J.; Reungwetwattana, T.; Chewaskulyong, B.; Lee, K.H.; Dechaphunkul, A.; Imamura, F.; Nogami, N.; Kurata, T.; et al. Osimertinib in Untreated EGFR-Mutated Advanced Non-Small-Cell Lung Cancer. N. Engl. J. Med. 2018, 378, 113–125. [Google Scholar] [CrossRef]
  45. Pore, M.M.; Hiltermann, T.J.; Kruyt, F.A. Targeting apoptosis pathways in lung cancer. Cancer Lett. 2013, 332, 359–368. [Google Scholar] [CrossRef]
  46. Steelman, L.S.; Abrams, S.L.; Whelan, J.; Bertrand, F.E.; Ludwig, D.E.; Basecke, J.; Libra, M.; Stivala, F.; Milella, M.; Tafuri, A.; et al. Contributions of the Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways to leukemia. Leukemia 2008, 22, 686–707. [Google Scholar] [CrossRef]
  47. Scaltriti, M.; Baselga, J. The epidermal growth factor receptor pathway: A model for targeted therapy. Clin. Cancer Res. 2006, 12, 5268–5272. [Google Scholar] [CrossRef]
  48. Ye, M.; Zhang, Y.; Gao, H.; Xu, Y.; Jing, P.; Wu, J.; Zhang, X.; Xiong, J.; Dong, C.; Yao, L.; et al. Activation of the Aryl Hydrocarbon Receptor Leads to Resistance to EGFR TKIs in Non-Small Cell Lung Cancer by Activating Src-Mediated Bypass Signaling. Clin. Cancer Res. 2018, 24, 1227–1239. [Google Scholar] [CrossRef]
  49. Amodio, V.; Yaeger, R.; Arcella, P.; Cancelliere, C.; Lamba, S.; Lorenzato, A.; Arena, S.; Montone, M.; Mussolin, B.; Bian, Y.; et al. EGFR Blockade Reverts Resistance to KRAS Inhibition in Colorectal Cancer. Cancer Discov. 2020, 10, 1129–1139. [Google Scholar] [CrossRef]
  50. Gudkov, A.V.; Komarova, E.A. The role of p53 in determining sensitivity to radiotherapy. Nat. Rev. Cancer 2003, 3, 117–129. [Google Scholar] [CrossRef]
  51. Weller, M. Predicting response to cancer chemotherapy: The role of p53. Cell Tissue Res. 1998, 292, 435–445. [Google Scholar] [CrossRef] [PubMed]
  52. Fischer, M.; Quaas, M.; Steiner, L.; Engeland, K. The p53-p21-DREAM-CDE/CHR pathway regulates G2/M cell cycle genes. Nucleic Acids Res. 2016, 44, 164–174. [Google Scholar] [CrossRef] [PubMed]
  53. Taylor, W.R.; Stark, G.R. Regulation of the G2/M transition by p53. Oncogene 2001, 20, 1803–1815. [Google Scholar] [CrossRef] [PubMed]
  54. Wei, H.; Qu, L.; Dai, S.; Li, Y.; Wang, H.; Feng, Y.; Chen, X.; Jiang, L.; Guo, M.; Li, J.; et al. Structural insight into the molecular mechanism of p53-mediated mitochondrial apoptosis. Nat. Commun. 2021, 12, 2280. [Google Scholar] [CrossRef] [PubMed]
  55. Viktorsson, K.; De Petris, L.; Lewensohn, R. The role of p53 in treatment responses of lung cancer. Biochem. Biophys. Res. Commun. 2005, 331, 868–880. [Google Scholar] [CrossRef]
  56. Mogi, A.; Kuwano, H. TP53 mutations in nonsmall cell lung cancer. BioMed Res. Int. 2011, 2011, 583929. [Google Scholar] [CrossRef]
  57. Ahrendt, S.A.; Hu, Y.; Buta, M.; McDermott, M.P.; Benoit, N.; Yang, S.C.; Wu, L.; Sidransky, D. p53 mutations and survival in stage I non-small-cell lung cancer: Results of a prospective study. J. Natl. Cancer Inst. 2003, 95, 961–970. [Google Scholar] [CrossRef]
  58. Zhang, H.; Ma, X.; Shi, T.; Song, Q.; Zhao, H.; Ma, D. NSA2, a novel nucleolus protein regulates cell proliferation and cell cycle. Biochem. Biophys. Res. Commun. 2010, 391, 651–658. [Google Scholar] [CrossRef]
Figure 1. Chemical structure of 9c.
Figure 1. Chemical structure of 9c.
Ijms 26 01987 g001
Figure 2. 9c inhibits cell proliferation by blocking the cell cycle at the G2/M phase in A549 cells: (A) Various cancer cells are treated with indicated concentrations of 9c for 72 h. Cell proliferation is determined using SRB and MTT assay. The data are presented as means ± SD from three independent experiments. (B) Proliferation inhibition of 9c on Beas-2b cells. The cells are treated with 9c for 72 h and detected by the CCK-8 method. (C) 9c inhibits the colony formation. A549 cells are treated with (0.001–0.1 pM) 9c for 14 d. One well plate scale = 35 mm. (D) The number of clones in plates is quantified. Data are shown as mean ± SD. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01. 9c vs. control. (E) The inhibition rate of colonies. The inhibition rate of relative A549 vs. H1975. ns, not statistically significant p > 0.05, * p < 0.05, A549 vs. H1975. (F) Compound 9c inhibits proteins related to G2/M phase cells. The cell cycle-related protein levels are assessed by Western blot analysis, with β-tubulin serving as a loading control. The densities of the protein band are quantified relative to β-tubulin (right panel). ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01. 9c vs. 0 pM group. (G) 9c affects cell cycle distribution. The cell cycle distribution is performed on A549 cells after treatment with 9c for 24 h. The DNA content is detected by flow cytometry.
Figure 2. 9c inhibits cell proliferation by blocking the cell cycle at the G2/M phase in A549 cells: (A) Various cancer cells are treated with indicated concentrations of 9c for 72 h. Cell proliferation is determined using SRB and MTT assay. The data are presented as means ± SD from three independent experiments. (B) Proliferation inhibition of 9c on Beas-2b cells. The cells are treated with 9c for 72 h and detected by the CCK-8 method. (C) 9c inhibits the colony formation. A549 cells are treated with (0.001–0.1 pM) 9c for 14 d. One well plate scale = 35 mm. (D) The number of clones in plates is quantified. Data are shown as mean ± SD. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01. 9c vs. control. (E) The inhibition rate of colonies. The inhibition rate of relative A549 vs. H1975. ns, not statistically significant p > 0.05, * p < 0.05, A549 vs. H1975. (F) Compound 9c inhibits proteins related to G2/M phase cells. The cell cycle-related protein levels are assessed by Western blot analysis, with β-tubulin serving as a loading control. The densities of the protein band are quantified relative to β-tubulin (right panel). ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01. 9c vs. 0 pM group. (G) 9c affects cell cycle distribution. The cell cycle distribution is performed on A549 cells after treatment with 9c for 24 h. The DNA content is detected by flow cytometry.
Ijms 26 01987 g002
Figure 3. 9c promotes the apoptosis of non-small cell lung cancer cell lines: (A,B) Western blot analysis of the effect of 9c or FL118 on apoptosis-related proteins at 24 h. GAPDH is chosen as the internal control. The densities of the protein band are quantified relative to GAPDH (right panel). ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 vs. 0 pM group. (C) 9c induces the apoptosis of cancer A549 cells. Apoptosis is analyzed by flow cytometry. A549 cells are treated with 9c for 24 h, and apoptosis is analyzed by flow cytometry. Quantification of the Annexin-V positive cells (right panel). ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 vs. DMSO. (D) Upon exposure to 9c (0–1000 pM) for 24 h, RT-qPCR is used to detect the mRNA levels of apoptotic molecules. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 vs. DMSO.
Figure 3. 9c promotes the apoptosis of non-small cell lung cancer cell lines: (A,B) Western blot analysis of the effect of 9c or FL118 on apoptosis-related proteins at 24 h. GAPDH is chosen as the internal control. The densities of the protein band are quantified relative to GAPDH (right panel). ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 vs. 0 pM group. (C) 9c induces the apoptosis of cancer A549 cells. Apoptosis is analyzed by flow cytometry. A549 cells are treated with 9c for 24 h, and apoptosis is analyzed by flow cytometry. Quantification of the Annexin-V positive cells (right panel). ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 vs. DMSO. (D) Upon exposure to 9c (0–1000 pM) for 24 h, RT-qPCR is used to detect the mRNA levels of apoptotic molecules. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 vs. DMSO.
Ijms 26 01987 g003
Figure 4. 9c inhibits the proliferation of A549 cells independent of Topo I activity: (A) A549 cells are transfected with the Topo I targeting siRNA using Lipo3000 transfection reagents. After 48 h, the transfection efficiency is examined by Western blot. The protein level is assessed by Western blot analysis. The densities of the protein band are quantified relative to GAPDH (right panel) ** p < 0.01. si-Topo I vs. NC. (B,C) A549 cells with Topo I-knockdown are treated with indicated concentrations of 9c or SN38 compounds for 72 h, and cell viability is determined by SRB assay.
Figure 4. 9c inhibits the proliferation of A549 cells independent of Topo I activity: (A) A549 cells are transfected with the Topo I targeting siRNA using Lipo3000 transfection reagents. After 48 h, the transfection efficiency is examined by Western blot. The protein level is assessed by Western blot analysis. The densities of the protein band are quantified relative to GAPDH (right panel) ** p < 0.01. si-Topo I vs. NC. (B,C) A549 cells with Topo I-knockdown are treated with indicated concentrations of 9c or SN38 compounds for 72 h, and cell viability is determined by SRB assay.
Ijms 26 01987 g004
Figure 5. Association analysis of differential genes and differential proteins: (A) Volcano plot of differentially expressed genes between the 9c group and the control group. (B) Top 10 downregulated genes in 9c vs. control. (C,D) GO and KEGG enrichment analyses performed on the DEGs in A549 transcriptome. Column charts show the top 20 significantly enriched terms. (E) The cluster heat map in the A549 proteomics. The abscissa indicates the number of samples, whereas the ordinate indicates DEPs. The histogram in the upper right corner represents the color level; each rectangle corresponds to the expression value of a sample. (F) Column charts show the top 20 significantly enriched KEGG terms in the A549 proteomics.
Figure 5. Association analysis of differential genes and differential proteins: (A) Volcano plot of differentially expressed genes between the 9c group and the control group. (B) Top 10 downregulated genes in 9c vs. control. (C,D) GO and KEGG enrichment analyses performed on the DEGs in A549 transcriptome. Column charts show the top 20 significantly enriched terms. (E) The cluster heat map in the A549 proteomics. The abscissa indicates the number of samples, whereas the ordinate indicates DEPs. The histogram in the upper right corner represents the color level; each rectangle corresponds to the expression value of a sample. (F) Column charts show the top 20 significantly enriched KEGG terms in the A549 proteomics.
Ijms 26 01987 g005
Figure 6. 9c inhibits the EGFR-PI3K-AKT pathway: (AC) The effects of 9c on the expression levels of signaling molecules associated with proliferation. A549 cells are treated with 9c (A) or FL118 (B) for 24 h. GAPDH is used as a loading control. (C) Protein band densities are quantified by normalizing to GAPDH. (D) A549 cells are treated with 9c for 24 h. Then, the EGFR mRNA level is measured by quantitative-PCR. The quantitative PCR is run to quantify the mRNA level of the EGFR. (E,F) A549 cells are pretreated with proteasome inhibitor MG132 (2 μM) or lysosomal inhibitor Chloroquine (CQ, 10 μM) for 2h as indicated, and, then, 100 pM 9c is added to cells for 15 h. The EGFR protein level is assessed by Western blot analysis, with β-tubulin or GAPDH serving as a loading control. The densities of the protein band are quantified relative to β-tubulin or GAPDH (right panel or lower panel). (G) A549 cells are treated with a 40ng /mL protein synthesis inhibitor cycloheximide (CHX) with or without 1 nM of 9c for indicated lengths of time. The EGFR protein level was assessed by Western blot analysis. The densities of the protein band are quantified relative to GAPDH (right panel). (H) A549 cells are treated with 9c for 24h. Cells are then stained anti-EGFR (labeling EGFR, green). Scale bar 1000 um. Data are presented as means ± SD. All experiments are performed in three replicates. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 versus control.
Figure 6. 9c inhibits the EGFR-PI3K-AKT pathway: (AC) The effects of 9c on the expression levels of signaling molecules associated with proliferation. A549 cells are treated with 9c (A) or FL118 (B) for 24 h. GAPDH is used as a loading control. (C) Protein band densities are quantified by normalizing to GAPDH. (D) A549 cells are treated with 9c for 24 h. Then, the EGFR mRNA level is measured by quantitative-PCR. The quantitative PCR is run to quantify the mRNA level of the EGFR. (E,F) A549 cells are pretreated with proteasome inhibitor MG132 (2 μM) or lysosomal inhibitor Chloroquine (CQ, 10 μM) for 2h as indicated, and, then, 100 pM 9c is added to cells for 15 h. The EGFR protein level is assessed by Western blot analysis, with β-tubulin or GAPDH serving as a loading control. The densities of the protein band are quantified relative to β-tubulin or GAPDH (right panel or lower panel). (G) A549 cells are treated with a 40ng /mL protein synthesis inhibitor cycloheximide (CHX) with or without 1 nM of 9c for indicated lengths of time. The EGFR protein level was assessed by Western blot analysis. The densities of the protein band are quantified relative to GAPDH (right panel). (H) A549 cells are treated with 9c for 24h. Cells are then stained anti-EGFR (labeling EGFR, green). Scale bar 1000 um. Data are presented as means ± SD. All experiments are performed in three replicates. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 versus control.
Ijms 26 01987 g006
Figure 7. 9c induced wild-type p53 expression by destabilizing NSA2-EGFR axis: (A,B) Effects of 9c on the expressions of p53 and NSA2. A549 cells are treated with 9c for indicated time. GAPDH is used as a loading control. (C) A549 cells are transfected with the p53 targeting siRNA using Lipo3000 transfection reagents. After 48 h, the transfection efficiency is examined by Western blot. (D) A549 cells with p53-knockdown are treated with indicated concentrations of 9c compound for 72 h, and cell viability is determined by SRB assay. (E) The 20 proteins with the highest degree in the PPI relationship analysis of DEPs, and the color depth of the node represents the number of differentially expressed proteins that interacted with the protein. (F) A549 cells are treated with a 40ng/mL protein synthesis inhibitor cycloheximide (CHX) with or without 100 pM of 9c for indicated lengths of time. NSA2 protein level is assessed by Western blot analysis, with β-tubulin serving as a loading control. The densities of the protein bands are quantified relative to β-tubulin (right panel). (G) A549 cells are pretreated with proteasome inhibitor MG132 (2 μM) for 2h as indicated, and then 100pM of 9c was added to cells for 15 h. Cells are lysed, and NSA2 protein level are assessed by Western blot analysis, with β-tubulin serving as a loading control. The densities of the protein bands are quantified relative to β-tubulin (lower panel). (H) A549 cells are transfected with the NSA2 targeting siRNA using Lipo3000 transfection reagents. After 48 hours, protein levels are assessed by Western blot analysis, with GAPDH serving as a loading control. The densities of the protein bands are quantified relative to GAPDH (right panel). (I) A549 cells are transfected with the NSA2 targeting siRNA using Lipo3000 transfection reagents. After 48 h, the transfection efficiency is examined by Western blot. A549 cells with NSA2-knockdown are treated with indicated concentrations of 9c for 72 h, and cell viability is determined by SRB assay. (J) A549 cells are transfected with the EGFR targeting siRNA using Lipo3000 transfection reagents. After 48 h, protein levels are assessed by Western blot analysis, with GAPDH serving as a loading control. The densities of the protein bands are quantified relative to GAPDH (right panel). (K) The schematic diagram of 9c inhibiting the NSCLC progression. 9c exerts a potential antitumor effect in non-small cell lung cancers in vitro and in vivo through the NSA2-EGFR signaling pathway. Data are presented as means ± SD. All experiments are performed in three replicates. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 versus control.
Figure 7. 9c induced wild-type p53 expression by destabilizing NSA2-EGFR axis: (A,B) Effects of 9c on the expressions of p53 and NSA2. A549 cells are treated with 9c for indicated time. GAPDH is used as a loading control. (C) A549 cells are transfected with the p53 targeting siRNA using Lipo3000 transfection reagents. After 48 h, the transfection efficiency is examined by Western blot. (D) A549 cells with p53-knockdown are treated with indicated concentrations of 9c compound for 72 h, and cell viability is determined by SRB assay. (E) The 20 proteins with the highest degree in the PPI relationship analysis of DEPs, and the color depth of the node represents the number of differentially expressed proteins that interacted with the protein. (F) A549 cells are treated with a 40ng/mL protein synthesis inhibitor cycloheximide (CHX) with or without 100 pM of 9c for indicated lengths of time. NSA2 protein level is assessed by Western blot analysis, with β-tubulin serving as a loading control. The densities of the protein bands are quantified relative to β-tubulin (right panel). (G) A549 cells are pretreated with proteasome inhibitor MG132 (2 μM) for 2h as indicated, and then 100pM of 9c was added to cells for 15 h. Cells are lysed, and NSA2 protein level are assessed by Western blot analysis, with β-tubulin serving as a loading control. The densities of the protein bands are quantified relative to β-tubulin (lower panel). (H) A549 cells are transfected with the NSA2 targeting siRNA using Lipo3000 transfection reagents. After 48 hours, protein levels are assessed by Western blot analysis, with GAPDH serving as a loading control. The densities of the protein bands are quantified relative to GAPDH (right panel). (I) A549 cells are transfected with the NSA2 targeting siRNA using Lipo3000 transfection reagents. After 48 h, the transfection efficiency is examined by Western blot. A549 cells with NSA2-knockdown are treated with indicated concentrations of 9c for 72 h, and cell viability is determined by SRB assay. (J) A549 cells are transfected with the EGFR targeting siRNA using Lipo3000 transfection reagents. After 48 h, protein levels are assessed by Western blot analysis, with GAPDH serving as a loading control. The densities of the protein bands are quantified relative to GAPDH (right panel). (K) The schematic diagram of 9c inhibiting the NSCLC progression. 9c exerts a potential antitumor effect in non-small cell lung cancers in vitro and in vivo through the NSA2-EGFR signaling pathway. Data are presented as means ± SD. All experiments are performed in three replicates. ns, not statistically significant p > 0.05, * p < 0.05, ** p < 0.01 versus control.
Ijms 26 01987 g007
Figure 8. 9c inhibits A549 xenograft growth in vivo: (AD) A549 cells are inoculated into the right flank of Balb/c-nude mice. Once the tumor nodules reach a volume of 100 mm³, the animals are randomly allocated to four groups and, respectively, intragastrically injected with the control (n = 6), 9c, 0.375 mg/kg (n = 6), 0.75 mg/kg (n = 6), and 1.5 mg/kg (n = 6). After 23 days of treatment, mice are sacrificed and tumors are harvested. The tumor image is photographed (A,B). The tumor volume is measured every 2 days. (C) Tumors are weighed, and the mice body weights (D) are measured every day. Data are presented as mean ± S.D. (n = 6); ns, not statistically significant, p > 0.05; ** p < 0.01, compared with the control group.
Figure 8. 9c inhibits A549 xenograft growth in vivo: (AD) A549 cells are inoculated into the right flank of Balb/c-nude mice. Once the tumor nodules reach a volume of 100 mm³, the animals are randomly allocated to four groups and, respectively, intragastrically injected with the control (n = 6), 9c, 0.375 mg/kg (n = 6), 0.75 mg/kg (n = 6), and 1.5 mg/kg (n = 6). After 23 days of treatment, mice are sacrificed and tumors are harvested. The tumor image is photographed (A,B). The tumor volume is measured every 2 days. (C) Tumors are weighed, and the mice body weights (D) are measured every day. Data are presented as mean ± S.D. (n = 6); ns, not statistically significant, p > 0.05; ** p < 0.01, compared with the control group.
Ijms 26 01987 g008
Figure 9. 9c in combination with AMG510 exerts antitumor effects in vitro and vivo: (A) Western blot detected the differences in the EGFR and AKT between H358 parental and NCI-H358 AMG510 resistant strains. GAPDH was used as a loading control. Protein band densities are quantified by normalizing to GAPDH (right panel). (B) NCI-H358 cells are treated with indicated concentrations of 9c or AMG510 for 72 h. Cell proliferation is determined using SRB assay. The data are presented as means ± SD from three independent experiments. (C) The representative combination indices (CIs) of 9c (T) in combination with AMG510: CI < 0.9 signifies synergy, CI ranging from 0.9 to 1.1 indicates additivity a, and CI > 1.1 suggests antagonism. (DG) NCI-H358 cells are injected into the right flank of Balb/c-nude mice. When the volumes of tumor nodules reached 100 mm3, the mice are randomly assigned to indicated groups and, respectively, intragastrically (ig) or intraperitoneally (ip) injected with the control (n = 5), 0.75 mg/kg of CPT (n = 5), 0.75 mg/kg of 9c (n = 5), 0.75 mg/kg of FL118, 3 mg/kg of AMG510, and the combination (9c + AMG510, n = 5). After 28 days of treatment, mice are sacrificed and tumors are harvested. (D,F)The tumor image is photographed, (D) and the tumor volumes (F) are measured every 2 days. (E) Tumors are weighed, and the mice body weight (G) are measured every day. (H) Effect of 9c on the expressions of proteins in tumors. Tumors are excised and lysed. Protein levels are assessed by Western blot analysis, with GAPDH serving as a loading control. The densities of the protein bands are quantified relative to GAPDH (right panel). Data are presented as mean ± s.d. (n = 5); ns, not statistically significant p > 0.05; * p < 0.05; ** p < 0.01; compared with the control group.
Figure 9. 9c in combination with AMG510 exerts antitumor effects in vitro and vivo: (A) Western blot detected the differences in the EGFR and AKT between H358 parental and NCI-H358 AMG510 resistant strains. GAPDH was used as a loading control. Protein band densities are quantified by normalizing to GAPDH (right panel). (B) NCI-H358 cells are treated with indicated concentrations of 9c or AMG510 for 72 h. Cell proliferation is determined using SRB assay. The data are presented as means ± SD from three independent experiments. (C) The representative combination indices (CIs) of 9c (T) in combination with AMG510: CI < 0.9 signifies synergy, CI ranging from 0.9 to 1.1 indicates additivity a, and CI > 1.1 suggests antagonism. (DG) NCI-H358 cells are injected into the right flank of Balb/c-nude mice. When the volumes of tumor nodules reached 100 mm3, the mice are randomly assigned to indicated groups and, respectively, intragastrically (ig) or intraperitoneally (ip) injected with the control (n = 5), 0.75 mg/kg of CPT (n = 5), 0.75 mg/kg of 9c (n = 5), 0.75 mg/kg of FL118, 3 mg/kg of AMG510, and the combination (9c + AMG510, n = 5). After 28 days of treatment, mice are sacrificed and tumors are harvested. (D,F)The tumor image is photographed, (D) and the tumor volumes (F) are measured every 2 days. (E) Tumors are weighed, and the mice body weight (G) are measured every day. (H) Effect of 9c on the expressions of proteins in tumors. Tumors are excised and lysed. Protein levels are assessed by Western blot analysis, with GAPDH serving as a loading control. The densities of the protein bands are quantified relative to GAPDH (right panel). Data are presented as mean ± s.d. (n = 5); ns, not statistically significant p > 0.05; * p < 0.05; ** p < 0.01; compared with the control group.
Ijms 26 01987 g009
Table 1. Representative genes differentially expressed in the A549 and 9c-treated A549 at the mRNA and protein levels.
Table 1. Representative genes differentially expressed in the A549 and 9c-treated A549 at the mRNA and protein levels.
mRNA
Information
Protein
Information
mRNA Sig
p-Value
Protein Sig
p-Value
Regulation Type
(mRNA/Protein)
ZNF385AQ96PM9yesyesUp/Down
TP53I3Q53FA7yesNoUp/Up
TM7SF2O76062yesNoUp/Up
TAP1Q03518yesyesUp/Up
SFNP31947yesyesUp/Up
RRM2BQ7LG56yesNoUp/Down
PTGS2P35354yesNoUp/Down
PLK1P53350yesyesDown/Down
KPNA2P52292yesNoDown/Down
HSPA4LO95757yesNoUp/Up
HRNRQ86YZ3yesyesUp/Up
H2AC20Q16777yesyesDown/Down
FBXO22Q8NEZ5yesyesUp/Up
EML2O95834yesNoUp/Up
DPYSL4O14531yesyesUp/Up
DDB2Q92466yesNoUp/Up
CYFIP2Q96F07yesyesUp/Up
CMBLQ96DG6yesNoUp/Up
BOLA2Q9H3K6yesNoDown/Up
AS3MTQ9HBK9yesNoUp/No
ARL6IP1Q15041yesyesDown/Up
APOBEC3CQ9NRW3yesupUp/Up
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Du, F.; Zhang, A.; Qi, X.; Yin, R.; Jiang, T.; Li, J. Novel Camptothecin Derivative 9c with Enhanced Antitumor Activity via NSA2-EGFR-P53 Signaling Pathway. Int. J. Mol. Sci. 2025, 26, 1987. https://doi.org/10.3390/ijms26051987

AMA Style

Du F, Zhang A, Qi X, Yin R, Jiang T, Li J. Novel Camptothecin Derivative 9c with Enhanced Antitumor Activity via NSA2-EGFR-P53 Signaling Pathway. International Journal of Molecular Sciences. 2025; 26(5):1987. https://doi.org/10.3390/ijms26051987

Chicago/Turabian Style

Du, Fu, Aotong Zhang, Xin Qi, Ruijuan Yin, Tao Jiang, and Jing Li. 2025. "Novel Camptothecin Derivative 9c with Enhanced Antitumor Activity via NSA2-EGFR-P53 Signaling Pathway" International Journal of Molecular Sciences 26, no. 5: 1987. https://doi.org/10.3390/ijms26051987

APA Style

Du, F., Zhang, A., Qi, X., Yin, R., Jiang, T., & Li, J. (2025). Novel Camptothecin Derivative 9c with Enhanced Antitumor Activity via NSA2-EGFR-P53 Signaling Pathway. International Journal of Molecular Sciences, 26(5), 1987. https://doi.org/10.3390/ijms26051987

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop