cDNA Cloning, Bioinformatics, and Expression Analysis of ApsANS in Acer pseudosieboldianum
Abstract
1. Introduction
2. Results
2.1. Screening and Expression Analysis of the ANS Gene in Acer pseudosieboldianum
2.2. Screening and Quantitative Analysis of Differential Metabolites
2.3. Cloning and Characterization of ApsANS cDNA
2.4. Physicochemical Properties of the ApsANS Protein
2.5. Structural Analysis of the ApsANS Protein
2.6. miRNA Prediction of ApsANS in Acer pseudosieboldianum
2.7. Multiple Sequence Alignment and Evolutionary Tree Construction for the ApsANS Protein
3. Discussion
4. Materials and Methods
4.1. Plant Material, Strains, and Vectors
4.2. Isolation of Total RNA and Synthesis of First-Strand cDNA
4.3. Determination of Anthocyanin Content
4.4. Quantification of Anthocyanin Metabolites Through UPLC-ESI-MS/MS
4.5. Screening and Expression Analysis of ANS Genes
4.6. Analysis of Physicochemical Properties of the ApsANS Protein
4.7. Conservative Domain of the ApsANS Protein and miRNA Prediction
4.8. Sequence Alignment Analysis and Construction of Phylogenetic Tree
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| Aps | Acer pseudosieboldianum |
| Ap | Acer palmatum |
| Ay | Acer yangbiense |
| Dl | Dimocarpus longan |
| Tc | Theobroma cacao |
| Pv | Pistacia vera |
| Dz | Durio zibethinus |
| Cf | Cephalotus follicularis |
| Cc | Corchorus capsularis |
| Mi | Mangifera indica |
| Pt | Populus tomentosa |
| Cf | Carpinus fangiana |
| Pe | Populus euphratica |
| Sd | Salix dunnii |
| Pt | Populus trichocarpa |
Appendix A
| Species Names | GenBank ID |
|---|---|
| Acer palmatum | AWN08246.1 |
| Acer yangbiense | TXG51020.1 |
| Dimocarpus longan | QRV61372.1 |
| Dimocarpus longan | ACK76231.1 |
| Theobroma cacao | XP_007040068.2 |
| Pistacia vera | XP_031284664.1 |
| Durio zibethinus | XP_022736758.1 |
| Cephalotus follicularis | GAV79604.1 |
| Corchorus capsularis | OMO89673.1 |
| Mangifera indica | XP_044476538.1 |
| Theobroma cacao | EOY24569.1 |
| Durio zibethinus | XP_022732774.1 |
| Populus tomentosa | KAG6780998.1 |
| Carpinus fangiana | KAE8055211.1 |
| Populus euphratica | XP_011033842.1 |
| Salix dunnii | KAF9685756.1 |
| Theobroma cacao | ADD51356.1 |
| Populus trichocarpa | XP_002304452.1 |
| Theobroma cacao | EOY24568.1 |
References
- Li, H.; Liu, J.; Pei, T.; Bai, Z.; Han, R.; Liang, Z. Overexpression of SmANS Enhances Anthocyanin Accumulation and Alters Phenolic Acids Content in Salvia miltiorrhiza and Salvia miltiorrhiza Bge f. alba Plantlets. Int. J. Mol. Sci. 2019, 20, 2225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Tang, W.; Hu, Y.; Zhang, Y.; Sun, J.; Guo, X.; Liu, Y. A MYB/bHLH complex regulates tissue-specific anthocyanin biosynthesis in the inner pericarp of red-centered kiwifruit Actinidia chinensis cv. Hongyang. Plant J. 2019, 99, 359–378. [Google Scholar] [CrossRef] [Scilit]
- Norberto, S.; Silva, S.; Meireles, M.; Faria, A.; Pintado, M.; Calhau, C. Blueberry anthocyanins in health promotion: A metabolic overview. J. Funct. Foods. 2013, 5, 1518–1528. [Google Scholar] [CrossRef] [Scilit]
- Cai, X.; Du, X.; Cui, D.; Wang, X.; Yang, Z.; Zhu, G. Improvement of stability of blueberry anthocyanins by carboxymethyl starch/xanthan gum combinations microencapsulation. Food Hydrocolloid. 2019, 91, 238–245. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Li, D.; Li, S.; Liu, Y.; Chen, H. SmBICs Inhibit Anthocyanin Biosynthesis in Eggplant (Solanum melongena L.). Plant Cell Physiol. 2021, 62, 1001–1011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, T.; Zhang, M.; Wen, C.; Xie, X.; Liu, L. Integrated metabolomic and transcriptomic analysis of the anthocyanin regulatory networks in Salvia miltiorrhiza Bge. flowers. BMC Plant Biol. 2020, 20, 349. [Google Scholar] [CrossRef] [Scilit]
- Nuraini, L.; Tatsuzawa, F.; Ochiai, M.; Suzuki, K.; Nakatsuka, T. Two Independent Spontaneous Mutations Related to Anthocyanin-less Flower Coloration in Matthiola incana Cultivars. Hortic. J. 2021, 90, 85–96. [Google Scholar] [CrossRef] [Scilit]
- Shen, T.; Han, M.; Liu, Q.; Yang, C.; Li, H. Pigment profile and gene analysis revealed the reasons of petal color difference of crabapples. Braz. J. Bot. 2021, 44, 287–296. [Google Scholar] [CrossRef] [Scilit]
- Dellaporta, S.L.; Greenblatt, I.; Kermicle, J.L.; Hicks, J.B.; Wessler, S.R. Molecular cloning of the maize R-nj allele by transposon tagging with Ac. In Chromosome Structure and Function; Impact New Concepts; Springer: Boston, MA, USA, 1988; pp. 263–282. [Google Scholar]
- Wilmouth, R.C.; Turnbull, J.J.; Welford, R.W.; Clifton, I.J.; Prescott, A.G.; Schofield, C.J. Structure and mechanism of anthocyanidin synthase from Arabidopsis thaliana. Structure 2002, 10, 93–103. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.H.; Lee, J.R.; Hong, S.T.; Yoo, Y.-K.; An, G.; Kim, S.-R. Molecular cloning and analysis of anthocyanin biosynthesis genes preferentially expressed in apple skin. Plant Sci. 2003, 165, 403–413. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Wang, W.; Zhang, P.; Pan, Q.; Zhan, J.; Huang, W. Gene transcript accumulation, tissue and subcellular localization of anthocyanidin synthase (ANS) in developing grape berries. Plant Sci. 2010, 179, 103–113. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.Z.; Hu, F.C.; Hu, G.B.; Li, X.J.; Huang, X.M.; Wang, H.C. Differential expression of anthocyanin biosynthetic genes in relation to anthocyanin accumulation in the pericarp of Litchi chinensis Sonn. PLoS ONE 2011, 6, e19455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Z.; Chen, Y.; Gao, A.; Huang, J. Cloning and expression of anthocyanidin synthase (ANS) gene from peel of mango (Mangifera indica Linn). Afr. J. Plant Sci. 2014, 8, 147–152. [Google Scholar] [CrossRef] [Scilit]
- Jin, Q.F.; Chen, Z.D.; Sun, W.J.; Lin, F.M.; Xue, Z.H.; Huang, Y.; Tang, X.H. Cloning and bioinformatics analysis of tea tree CsANS gene and its promoter. Tea Sci. 2016, 36, 219–228. [Google Scholar]
- Zhang, J.; Sui, C.; Wang, Y.; Liu, S.; Liu, H.; Zhang, Z.; Liu, H. Transcriptome-Wide Analysis Reveals Key DEGs in Flower Color Regulation of Hosta plantaginea (Lam.) Aschers. Genes 2020, 11, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Zhu, D.; Sun, Y.; Wang, Q.; Zhu, L.; Zeng, H. Metabonomic Profiling Analyses Reveal ANS Upregulation to Enhance the Flavonoid Pathway of Purple-Fleshed Sweet Potato Storage Root in Response to Deep Shading. Agronomy 2021, 11, 737. [Google Scholar] [CrossRef] [Scilit]
- Ni, H.; Suo, H.; Zhang, X.; Hu, L.; Yuan, F.; Zhang, M.; Zhang, S. Genome-Wide Identification and Characterization of the ANS Gene Family in Pomegranate (Punica granatum L.). Horticulturae. 2023, 9, 468. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Zhao, X.; Zhang, J.; Yang, B.; Yu, Y.; Liu, T.; Song, B. Functional analysis of an anthocyanin synthase gene StANS in potato. Sci. Hortic. 2020, 272, 109569. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.T.; Chen, Y.L.; Zhang, X.H.; Cai, M.L.; Yu, Z.C.; Peng, C.L. ANS-deficient Arabidopsis is sensitive to high light due to impaired anthocyanin photoprotection. Funct. Plant Biol. 2019, 46, 756–765. [Google Scholar] [CrossRef] [Scilit]
- Mattus-Araya, E.; Guajardo, J.; Herrera, R.; Moya-Leon, M.A. ABA Speeds Up the Progress of Color in Developing F. chiloensis Fruit through the Activation of PAL, CHS and ANS, Key Genes of the Phenylpropanoid/Flavonoid and Anthocyanin Pathways. Int. J. Mol. Sci. 2022, 23, 3854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, Y.; Sun, X.; Fang, B.; Sheng, X.; Yuan, D. The Cds.71 on TMS5 May Act as a Mutation Hotspot to Originate a TGMS Trait in Indica Rice Cultivars. Front. Plant Sci. 2020, 11, 1189. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Wei, Y.; Liang, C.; Guo, J.; Niu, T.; Zhang, P.; Wen, P. VvANR silencing promotes expression of VvANS and accumulation of anthocyanin in grape berries. Protoplasma 2022, 259, 743–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, T.; Li, P.; Li, L.; Zhang, Q. Research advances in and prospects of ornamental plant genomics. Hortic. Res. 2021, 8, 65. [Google Scholar] [CrossRef] [Scilit]
- Dai, S.L.; Huang, H.; Fu, J.X.; Hong, Y. Advances in molecular breeding of ornamental plants. Chin. Bull. Bot. 2013, 48, 589–607. [Google Scholar] [CrossRef] [Scilit]
- Ren, J.; Chen, Z.; Tang, F.; Xuan, Y.; Yang, F.; Lu, X.Y.; Fu, S.L. Study on leaf color related chemicals components based on comparing. J. Anhui Agric. Univ. 2019, 46, 420–425. [Google Scholar] [CrossRef]
- Li, Y.K.; Fang, J.B.; Qi, X.J.; Lin, M.M.; Zhong, Y.P.; Sun, L.M.; Cui, W. Combined analysis of the fruit metabolome and transcriptome reveals candidate genes involved in flavonoid biosynthesis in Actinidia arguta. Int. J. Mol. Sci. 2018, 19, 1471. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Muhammad, W.H.; Tao, L.; Zhang, R.; Yun, Q.; Peter, H.; Zhiling, D.; Luo, G.; Guo, H.; Ma, Y. De novo genome assembly of the endangered Acer yangbiense, a plant species with extremely small populations endemic to Yunnan Province, China. GigaScience 2019, 8, giz085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grossman, J.J. Evidence of Constrained Divergence and Conservatism in Climatic Niches of the Temperate Maples (Acer L.). Forests 2021, 12, 535. [Google Scholar] [CrossRef] [Scilit]
- Gelderen, D.; Jong, P.; Oterdoom, H.J. Maples of the World; Timber Press: Portland, OR, USA, 1994. [Google Scholar]
- Ma, Q.; Sun, T.; Li, S.; Wen, J.; Zhu, L.; Yin, T.; Yan, K.; Xu, X.; Li, S.; Mao, J.; et al. The Acer truncatum genome provides insights into nervonic acid biosynthesis. Plant J. 2020, 104, 662–678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quambusch, M.; Bucker, C.; Haag, V.; Meier-Dinkel, A.; Liesebach, H. Growth performance and wood structure of wavy grain sycamore maple (Acer pseudoplatanus L.) in a progeny trial. Ann. For. Sci. 2021, 78, 15. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Li, D.Z.; Tian, B. Diversity in seed oil content and fatty acid composition in Acer species with potential as sources of nervonic acid. Plant Divers. 2021, 43, 86–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Z.; Xu, X.; Zhang, S.; Zhao, Q.; Li, H.; Cui, Y.; Li, X.; Wang, L.; Chen, S.; Zhao, X. Transcriptomics profiling of Acer pseudosieboldianum molecular mechanism against freezing stress. Int. J. Mol. Sci. 2022, 23, 14676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.F.; Zhao, D.H.; Zhang, J.Q.; Chen, J.S.; Li, J.L.; Weng, Z.; Rong, L.P. De novo transcriptome sequencing and anthocyanin metabolite analysis reveals leaf color of Acer pseudosieboldianum in autumn. BMC Genom. 2021, 22, 383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Cai, K.; Han, Z.; Zhang, S.; Sun, A.; Xie, Y.; Zhao, X. Chromosome-level genome assembly for Acer pseudosieboldianum and highlights to mechanisms for leaf color and shape change. Front. Plant Sci. 2022, 13, 850054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Weng, Z.; Li, X.; Xu, B.; Gao, Y.; Rong, L. De novo transcriptome revealed genes involved in anthocyanin biosynthesis, transport, and regulation in a mutant of Acer pseudosieboldianum. BMC Genom. 2022, 23, 567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, L.; Wang, J.; Zhao, J.; Zheng, Y.; Wang, H.F.; Wu, X.; Xian, C.; Lei, J. Study on cyanidin metabolism in petals of pink-flowered strawberry based on transcriptome sequencing and metabolite analysis. BMC Plant Biol. 2019, 19, 423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, H.R.; Wang, L.R.; Cui, G.X.; Zhou, X.H.; Duan, X.R.; Yang, H.S. Identification of the regulatory networks and hub genes controlling alfalfa floral pigmentation variation using RNA-sequencing analysis. BMC Plant Biol. 2020, 20, 1205–1361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.S.; Tian, H.; Chen, M.X.; Xiong, J.B.; Cai, H.; Liu, Y. Transcriptome analysis reveals potential genes involved in flower pigmentation in a red-flowered mutant of white clover (Trifolium repens L.). Genomics 2018, 110, 191–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Zhai, Y.H.; Luo, X.N.; Zhang, Y.; Shi, Q.Q. Comparative transcriptome analyses reveal genes related to pigmentation in the petals of red and white Primula vulgaris cultivars. Physiol. Mol. Biol. Plants 2019, 25, 1029–1041. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Lu, N.; Liu, C.; Dixon, R.A.; Wu, Q.; Mao, Y.; Yang, Y.; Zheng, X.; He, L.; Zhao, B.; et al. Mtgstf7, a tt19-like gst gene, is essential for accumulation of anthocyanins, but not proanthocyanins in medicago truncatula. J. Exp. Bot. 2022, 73, 4129–4146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koes, R.; Verweij, W.; Quattrocchio, F. Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 2005, 10, 236–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hichri, I.; Barrieu, F.; Bogs, J.; Kappel, C.; Delrot, S.; Lauvergeat, V. Recent advances in the transcriptional regulation of the flavonoid biosynthetic pathway. J. Exp. Bot. 2011, 62, 2465–2483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saito, K.; Kobayashi, M.; Gong, Z.; Tanaka, Y.; Yamazaki, M. Direct evidence for anthocyanidin synthase as a 2-oxoglutaratedependent oxygenase: Molecular cloning and functional expression of cDNA from a red forma of Perilla frutescens. Plant J. 1999, 17, 181–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Luo, Y.; Wang, Q.; Sun, Y.; Duan, N.; Chen, Z.; Zeng, H. Spray treatment of leaves with Fe2+ promotes procyanidin biosynthesis by upregulating the expression of the F3H and ANS genes in red rice grains (Oryza sativa L.). J. Cereal Sci. 2021, 100, 103231. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Shi, Y.; Li, K.; Yang, D.; Liu, N.; Zhang, L.; Wang, P. Roles of the 2-Oxoglutarate-Dependent Dioxygenase Superfamily in the Flavonoid Pathway: A Review of the Functional Diversity of F3H, FNS I, FLS, and LDOX/ANS. Molecules 2021, 26, 6745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Zhou, H.; Song, L.; Yang, Z.; Qiu, M.; Wang, J.; Shi, S. Anthocyanins: Promising Natural Products with Diverse Pharmacological Activities. Molecules 2021, 26, 3807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, B.; Li, Y.; Zhao, W.; Meng, Z.; Ji, W.; Wang, C. Transcriptomic and Lipidomic Analysis of Lipids in Forsythia suspensa. Front. Genet. 2021, 12, 758362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sunil, L.; Shetty, N.P. Biosynthesis and regulation of anthocyanin pathway genes. Appl. Microbiol. Biot. 2022, 106, 1783–1798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tirumalai, V.; Swetha, C.; Nair, A.; Pandit, A.; Shivaprasad, P.V. miR828 and miR858 regulate VvMYB114 to promote anthocyanin and flavonol accumulation in grapes. J. Exp. Bot. 2019, 70, 4775–4791. [Google Scholar] [CrossRef] [Scilit]
- Tang, R.F.; Zhou, Y.J.; Chen, Z.S.; Zeng, J.; Huang, H.; Jiang, Y.M.; Zhu, H. Involvement of miRNA-mediated anthocyanin and energy metabolism in the storability of litchi fruit. Postharvest Biol. Technol. 2020, 165, 111200. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Ma, Y.; Hu, M.; Zhao, Y.; Liu, B.; Wang, C.; Mu, G. Multi-Omics and miRNA Interaction Joint Analysis Highlight New Insights Into Anthocyanin Biosynthesis in Peanuts (Arachis hypogaea L.). Front. Plant Sci. 2022, 13, 1690. [Google Scholar] [CrossRef] [Scilit]
- Vale, M.; Rodrigues, J.; Badim, H.; Geros, H.; Conde, A. Exogenous Application of Non-mature miRNA-Encoded miPEP164c Inhibits Proanthocyanidin Synthesis and Stimulates Anthocyanin Accumulation in Grape Berry Cells. Front. Plant Sci. 2021, 12, 700679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Xu, S.; Ma, H.; Duan, X.; Gao, S.; Zhou, X.; Cheng, Y. The R2R3-MYB gene PsMYB58 positively regulates anthocyanin biosynthesis in tree peony flowers. Plant Physiol. Biochem. 2021, 164, 279–288. [Google Scholar] [CrossRef] [Scilit]
- Rabino, I.; Mancinelli, A.L. Light, temperature, and anthocyanin production. Plant Physiol. 1986, 81, 922–924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, S.; Chen, M.; He, N.; Chen, X.; Wang, N.; Sun, Q.; Zhang, T.; Xu, H.; Fang, H.; Wang, Y.; et al. MdGSTF6, activated by MdMYB1, plays an essential role in anthocyanin accumulation in apple. Hortic. Res. 2019, 6, 40. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(T)(-delta delta c) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein identification and analysis tools on the ExPASy server. In The Proteomics Protocols Handbook; Humana: Louisville, KY, USA, 2005; pp. 571–607. [Google Scholar] [CrossRef] [Scilit]
- Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37 (Suppl. S2), W202–W208. [Google Scholar] [CrossRef] [Scilit]
- Cui, Y.; Fan, J.; Lu, C.; Ren, J.; Qi, F.; Huang, H.; Dai, S. ScGST3 and multiple R2R3-MYB transcription factors function in anthocyanin accumulation in Senecio cruentus. Plant Sci. 2021, 313, 111094. [Google Scholar] [CrossRef] [Scilit] [PubMed]










| Amino Acid Number | Molecular Weight (kDa) | pI | Instability | Hydropathicity |
|---|---|---|---|---|
| 360 | 40.684 | 5.84 | 49.75 | −0.413 |
| Target Gene | miRNA Expectation | Target Accessibility | Target Beginning and End | miRNA Sequence |
|---|---|---|---|---|
| ApsANS | miR6200 | 4 | 474~494 | UUUGGCCAACUAGAUCUAUGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, M.; Weng, Z.; Gong, Z.; Li, X.; Ye, J.; Gao, Y.; Rong, L. cDNA Cloning, Bioinformatics, and Expression Analysis of ApsANS in Acer pseudosieboldianum. Int. J. Mol. Sci. 2025, 26, 1865. https://doi.org/10.3390/ijms26051865
Li M, Weng Z, Gong Z, Li X, Ye J, Gao Y, Rong L. cDNA Cloning, Bioinformatics, and Expression Analysis of ApsANS in Acer pseudosieboldianum. International Journal of Molecular Sciences. 2025; 26(5):1865. https://doi.org/10.3390/ijms26051865
Chicago/Turabian StyleLi, Mingrui, Zhuo Weng, Zihan Gong, Xiaoyu Li, Jiayi Ye, Yufu Gao, and Liping Rong. 2025. "cDNA Cloning, Bioinformatics, and Expression Analysis of ApsANS in Acer pseudosieboldianum" International Journal of Molecular Sciences 26, no. 5: 1865. https://doi.org/10.3390/ijms26051865
APA StyleLi, M., Weng, Z., Gong, Z., Li, X., Ye, J., Gao, Y., & Rong, L. (2025). cDNA Cloning, Bioinformatics, and Expression Analysis of ApsANS in Acer pseudosieboldianum. International Journal of Molecular Sciences, 26(5), 1865. https://doi.org/10.3390/ijms26051865
