ADCY5 Gene Affects Seasonal Reproduction in Dairy Goats by Regulating Ovarian Granulosa Cells Steroid Hormone Synthesis
Abstract
1. Introduction
2. Results
2.1. Follicle Diameter and Follicle Number
2.2. Transcriptome Analysis of Goat Ovarian Tissue
2.3. ADCY5 Is Involved in Regulating the Proliferation of GCs
2.4. ADCY5 Is Involved in Regulating the Steroidogenesis of GCs
2.5. ADCY5 Is Responsible for the Activation of the CREB
3. Discussion
4. Materials and Methods
4.1. Animals and Diets
4.2. Experimental Design
4.3. Short Daylight Control and Male Effect
4.4. Ovaries Collection and Follicle Counting
4.5. RNA Extraction, Sequencing Libraries, and RNA-seq Analyses
4.6. GCs Isolation and Culture
4.7. RNA Interference and Overexpression of ADCY5
4.8. 8-Br-cAMP Adding Assay
4.9. Real-Time Quantitative PCR
4.10. Western Blot Analysis
4.11. Cell Proliferation Assay
4.12. Elisa Assay
4.13. RNA-Fluorescence In Situ Hybridization
4.14. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
P4 | Progesterone |
PMSG | Pregnant mare serum gonadotropin |
E2 | Estradiol |
PGF2α | Prostaglandin F2 α |
FSH | Follicle-stimulating hormone |
ADCY5 | Adenylyl cyclase 5 |
MAPK p38 | Mitogen-activated protein kinase p38 |
CDK1 | Cyclin-dependent kinase 1 |
CDK2 | Cyclin-dependent kinase 2 |
CYP11A1 | Cytochrome P450 family 11 subfamily A member 1 |
CYP19A1 | Cytochrome P450 family19 subfamily A member 1 |
StAR | Steroidogenic acute regulatory protein |
3βHSD | 3β-Hydroxysteroid dehydrogenase |
LDLR | Low-density lipoprotein receptor |
PIK3R1 | Phosphoinositide-3-kinase regulatory subunit 1 |
GDF10 | Growth differentiation factor 10 |
HSD11β1 | Hydroxysteroid dehydrogenase 11β-1 |
IGFBP3 | Insulin-like growth factor binding protein 3 |
PKA | Protein kinase A |
References
- Fatet, A.; Pellicer-Rubio, M.T.; Leboeuf, B. Reproductive cycle of goats. Anim. Reprod. Sci. 2011, 124, 211–219. [Google Scholar] [CrossRef] [PubMed]
- El-Mokadem, M.Y.; El-Din, A.; Ramadan, T.A.; Rashad, A.M.A.; Taha, T.A.; Samak, M.A. Manipulation of reproductive sea sonality using melatonin implantation in Anglo-Nubian does treated with controlled internal drug release and equine chorionic gonadotropin during the nonbreeding season. J. Dairy Sci. 2017, 100, 5028–5039. [Google Scholar] [CrossRef] [PubMed]
- Delgadillo, J.A.; Hernández, H.; Abecia, J.A.; Keller, M.; Chemineau, P. Is it time to reconsider the relative weight of sociosexual relationships compared with photoperiod in the control of reproduction of small ruminant females? Domest. Anim. Endocrinol. 2020, 73, 106468. [Google Scholar] [CrossRef]
- Fleisch, A.; Bollwein, H.; Piechotta, M.; Janett, F. Reproductive performance of Lacaune dairy sheep exposed to artificial long days followed by natural photoperiod without and with additional progestagen treatment during the nonbreeding season. Theriogenology 2015, 83, 320–325. [Google Scholar] [CrossRef]
- Arikan, M.S.; Mat, B.; Alkan, H.; Cevrimli, M.B.; Akin, A.C.; Sahin, T.S.; Tekindal, M.A. A meta-analysis of the effects of synchronization protocols applied to sheep in Turkey on pregnancy rates during breeding and non-breeding seasons. Vet. Med. Sci. 2021, 7, 2280–2289. [Google Scholar] [CrossRef] [PubMed]
- Horoz, H.; Kasikçi, G.; Ak, K.; Alkan, S.; Sönmez, C. Controlling the breeding season using melatonin and progestagen in Kivircik ewes. Turk. J. Vet. Anim. Sci. 2003, 27, 301–305. [Google Scholar]
- Knights, M.; Baptiste, Q.S.; Dixon, A.B.; Pate, J.L.; Marsh, D.J.; Inskeep, E.K.; Lewis, P.E. Effects of dosage of FSH, vehicle and time of treatment on ovulation rate and prolificacy in ewes during the anestrous season. Small Rumin. Res. 2003, 50, 1–9. [Google Scholar] [CrossRef]
- Carpenter, R.H.; Spitzer, J.C. Response of anestrous ewes to norgestomet and PMSG. Theriogenology 1981, 15, 389–393. [Google Scholar] [CrossRef] [PubMed]
- Morris, S.T.; Morel, P.C.H.; Kenyon, P.R.; Kemp, P.D.; Pomroy, W.E. Year-round lamb production in the Manawatu region-results from year one. In Proceedings of the New Zealand Grassland Association, 2004; Available online: https://www.grassland.org.nz/publications/nzgrassland_publication_440.pdf (accessed on 1 August 2024).
- Denicolo, G.; Morris, S.T.; Kenyon, P.R.; Morel, P.C.H. Effect of weaning preor post-mating on performance of spring-mated ewes and their lambs in New Zealand. N. Zeal. J. Agric. Res. 2006, 49, 255–260. [Google Scholar] [CrossRef]
- Mitchell, L.M.; Dingwall, W.S.; Mylne, M.J.A.; Hunton, J.; Matthews, K.; Gebbie, F.E.; McCallum, G.J.; McEvoy, T.G. Season affects characteristics of the pre-ovulatory LH surge and embryo viability in superovulated ewes. Anim. Reprod. Sci. 2002, 74, 163–174. [Google Scholar] [CrossRef]
- Manjunatha, B.M.; Al-Hosni, A.; Al-Bulushi, S. Effect of advancing the breeding season on reproductive performance of dromedary camels. Theriogenology 2022, 179, 230–236. [Google Scholar] [CrossRef] [PubMed]
- Nogueira, D.M.; Cavalieri, J.; Gummow, B.; Parker, A.J. Comparison of follicular dynamics and hormone profiles in Boer goats examined during the breeding and non-breeding seasons in the tropics of Queensland, Australia. Small Rumin. Res. 2015, 125, 93–100. [Google Scholar] [CrossRef]
- Evans, A.C.O. Characteristics of ovarian follicle development in domestic animals. Reprod. Domest. Anim. 2003, 38, 240–246. [Google Scholar] [CrossRef]
- González-Sanz, S.; Barreñada, O.; Rial, E.; Brieño-Enriquez, M.A.; del Mazo, J. The antiandrogenic vinclozolin induces differentiation delay of germ cells and changes in energy metabolism in 3D cultures of fetal ovaries. Sci. Rep. 2020, 10, 18036. [Google Scholar] [CrossRef]
- Na, Z.J.; Jiang, H.Y.; Meng, Y.X.; Song, J.H.; Feng, D.; Fang, Y.Y.; Shi, B.; Li, D. Association of galactose and insulin resistance in polycystic ovary syndrome: A case-control study. eClinicalMedicine 2022, 47, 101379. [Google Scholar] [CrossRef] [PubMed]
- Blagojevic, I.P.; Eror, T.; Pelivanovic, J.; Jelic, S.; Kotur-Stevuljevic, J.; Ignjatovic, S. Women with Polycystic Ovary Syndrome and Risk of Cardiovascular Disease. J. Med. Biochem. 2017, 36, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.; Park, Y.B.; Lim, S.W.; Lim, B.; Kim, J.M. Time Series Ovarian Transcriptome Analyses of the Porcine Estrous Cycle Reveals Gene Expression Changes during Steroid Metabolism and Corpus Luteum Development. Animals 2022, 12, 376. [Google Scholar] [CrossRef]
- Bonnet, A.; Servin, B.; Mulsant, P.; Mandon-Pepin, B. Spatio-Temporal Gene Expression Profiling during Early Ovarian Folliculogenesis: Integrated Transcriptomic Study and Molecular Signature of Early Follicular Growth. PLoS ONE 2015, 10, e0141482. [Google Scholar] [CrossRef] [PubMed]
- Jia, B.Y.; Xiang, D.C.; Shao, Q.Y.; Hong, Q.H.; Quan, G.B.; Wu, G.Q. Proteomic Exploration of Porcine Oocytes During Meiotic Maturation Using an Accurate TMT-Based Quantitative Approach. Front. Vet. Sci. 2022, 8, 792869. [Google Scholar] [CrossRef]
- Xia, Q.; Li, Q.L.; Gan, S.Q.; Guo, X.F.; Zhang, X.S.; Zhang, J.L.; Chu, M.X. Exploring the roles of fecundity-related long non-coding RNAs and mRNAs in the adrenal glands of small-tailed Han Sheep. BMC Genet. 2020, 21, 39. [Google Scholar] [CrossRef] [PubMed]
- Du, X.L.; He, X.Y.; Liu, Q.Y.; Di, R.; Liu, Q.Q.; Chu, M.X. Comparative Transcriptomics Reveals the Key lncRNA and mRNA of Sunite Sheep Adrenal Gland Affecting Seasonal Reproduction. Front. Vet. Sci. 2022, 9, 816241. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.J.; Xia, G.L. Hormonal control of mammalian oocyte meiosis at diplotene stage. Cell Mol. Life Sci. 2012, 69, 1279–1288. [Google Scholar] [CrossRef]
- Li, J.; Shen, C.L.; Zhang, K.J.; Niu, Z.H.; Liu, Z.Q.; Zhang, S.L.; Wang, Y.S.; Lan, X.Y. Polymorphic variants of bovine gene identified in GWAS analysis were significantly associated with ovarian morphological related traits. Gene 2021, 766, 145158. [Google Scholar] [CrossRef] [PubMed]
- Kouamo, J.; Dawaye, S.M.; Zoli, A.P.; Bah, G.S. Evaluation of bovine (Bos indicus) ovarian potential for in vitro embryo production in the Adamawa plateau (Cameroon). Open Vet. J. 2014, 4, 128–136. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Albertini, D.F. The road to maturation: Somatic cell interaction and self-organization of the mammalian oocyte. Nat. Rev. Mol. Cell Bio 2013, 14, 141–152. [Google Scholar] [CrossRef] [PubMed]
- Yuan, F.F.; Wang, Z.J.; Sun, Y.L.; Wei, H.W.; Cui, Y.Y.; Wu, Z.Y.; Zhang, C.Y.; Xie, K.P.; Wang, F.C.; Zhang, M.J. deletion elevates S1P levels, contributing to NPR2 inactivity and p21 expression that block germ cell development. Cell Death Dis. 2021, 12, 574. [Google Scholar] [CrossRef] [PubMed]
- Pandey, S.; Djibo, R.; Darracq, A.; Calendo, G.; Zhang, H.H.; Henry, R.A.; Andrews, A.J.; Baylin, S.B.; Madzo, J.; Najmanovich, R.; et al. Selective CDK9 Inhibition by Natural Compound Toyocamycin in Cancer Cells. Cancers 2022, 14, 3340. [Google Scholar] [CrossRef] [PubMed]
- Diril, M.K.; Ratnacaram, C.K.; Padmakumar, V.C.; Du, T.H.; Wasser, M.; Coppola, V.; Tessarollo, L.; Kaldis, P. Cyclin-dependent kinase 1 (Cdk1) is essential for cell division and suppression of DNA re-replication but not for liver regeneration. Proc. Natl. Acad. Sci. USA 2012, 109, 3826–3831. [Google Scholar] [CrossRef]
- Peng, T.; Peng, J.J.; Miao, G.Y.; Tan, Z.Q.; Liu, B.; Zhou, E. miR-125/CDK2 axis in cochlear progenitor cell proliferation. Mol. Med. Rep. 2021, 23, 102. [Google Scholar] [CrossRef] [PubMed]
- Griffin, S.V.; Krofft, R.D.; Pippin, J.W.; Shankland, S.J. Limitation of podocyte proliferation improves renal function in experimental crescentic glomerulonephritis. Kidney Int. 2005, 67, 977–986. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Miller, W.L.; Auchus, R.J. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. 2011, 32, 81–151. [Google Scholar] [CrossRef]
- Mizutani, T.; Ishikane, S.; Kawabe, S.; Umezawa, A.; Miyamoto, K. Transcriptional regulation of genes related to progesterone production. Endocr. J. 2015, 62, 757–763. [Google Scholar] [CrossRef] [PubMed]
- Menchaca, A.; Cuadro, F.; Dos Santos-Neto, P.C.; Bosolasco, D.; Barrera, N.; de Brun, V.; Crispo, M. Oocyte developmental competence is improved by relatively greater circulating progesterone concentrations during preovulatory follicular growth. Anim. Reprod. Sci. 2018, 195, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Bernuci, M.P.; Bulgareli, D.L.; Vireque, A.A.; Pitangui, C.P.; de Sa, M.F.; Rosa-e-Silva, A.C. Exposing bovine cumulus-oocyte complexes to aromatizable androgen restore serum-induced low estradiol production in vitro. Zygote 2014, 22, 496–499. [Google Scholar] [CrossRef]
- Clark, B.J.; Ranganathan, V.; Combs, R. Steroidogenic acute regulatory protein expression is dependent upon post-translational effects of cAMP-dependent protein kinase A. Mol. Cell Endocrinol. 2001, 173, 183–192. [Google Scholar] [CrossRef]
- Wen, A.Y.; Sakamoto, K.M.; Miller, L.S. The Role of the Transcription Factor CREB in Immune Function. J. Immunol. 2010, 185, 6413–6419. [Google Scholar] [CrossRef]
- De Falco, V.; Tamburrino, A.; Ventre, S.; Castellone, M.D.; Malek, M.; Manié, S.N.; Santoro, M. CD44 Proteolysis Increases CREB Phosphorylation and Sustains Proliferation of Thyroid Cancer Cells. Cancer Res. 2012, 72, 1449–1458. [Google Scholar] [CrossRef] [PubMed]
- Chuang, H.L.; Kumar, V.B.; Day, C.H.; Ho, C.C.; Ho, T.J.; Chen, R.J.; Padma, V.V.; Kuo, W.W.; Huang, C.Y. Epimedium promotes steroidogenesis by CREB activation-mediated mitochondrial fusion in endosulfan treated leydig cells. Environ. Toxicol. 2021, 36, 1873–1879. [Google Scholar] [CrossRef] [PubMed]
- Martinot, E.; Boerboom, D. Slit/Robo signaling regulates Leydig cell steroidogenesis. Cell Commun. Signal 2021, 19, 8. [Google Scholar] [CrossRef] [PubMed]
- Mellett, M.; Atzei, P.; Jackson, R.; O’Neill, L.A.; Moynagh, P.N. Mal Mediates TLR-Induced Activation of CREB and Expression of IL-10. J. Immunol. 2011, 186, 4925–4935. [Google Scholar] [CrossRef] [PubMed]
- Haldar, S.; Agrawal, H.; Saha, S.; Straughn, A.R.; Roy, P.; Kakar, S.S. Overview of follicle stimulating hormone and its receptors in reproduction and in stem cells and cancer stem cells. Int. J. Biol. Sci. 2022, 18, 675–692. [Google Scholar] [CrossRef]
- Li, X.C.; Heng, B.C.; Bai, Y.Y.; Wang, Q.Q.; Gao, M.; He, Y.; Zhang, X.W.; Deng, X.L.; Zhang, X.H. Electrical charge on ferroelectric nanocomposite membranes enhances SHED neural differentiation. Bioact. Mater. 2023, 20, 81–92. [Google Scholar] [CrossRef]
- Wu, H.; Fan, Z.Q.; Brandsrud, M.; Meng, Q.G.; Bobbitt, M.; Regouski, M.; Stott, R.; Sweat, A.; Crabtree, J.; Hogan, R.J.; et al. Generation of H7N9-specific human polyclonal antibodies from a transchromosomic goat (caprine) system. Sci. Rep. 2019, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.A.; Zhou, Z.Y.; Wang, P.; He, X.Y.; Liu, Y.F.; Chu, M.X. The SLC19A1-AS/miR-1343/WNT11 axis is a novel positive regulatory ceRNA network governing goat granulosa cell proliferation. Int. J. Biol. Macromol. 2024, 264, 130658. [Google Scholar] [CrossRef]
- Diao, Y.C.; Li, Y.W.; Wang, Z.X.; Wang, S.R.; Li, P.; Kong, B.H. SF3B4 promotes ovarian cancer progression by regulating alternative splicing of RAD52. Cell Death Dis. 2022, 13, 179. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Gao, J.; Zheng, R.; Yu, M.; Ren, Y.; Yan, T.; Huang, Y.; Li, Y. Antagonizing circRNA_002581-miR-122-CPEB1 axis alleviates NASH through restoring PTEN-AMPK-mTOR pathway regulated autophagy. Cell Death Dis. 2020, 11, 123. [Google Scholar] [CrossRef]
Items | Experiment 1 | Experiment 2 | p-Value | ||
---|---|---|---|---|---|
Non-Breeding Season | Breeding Season | ||||
Small-sized | C1 | 7.25 ± 1.71 | C2 | 2.67 ± 1.15 | 0.011 |
LM1 | 7.00 ± 1.41 | M2 | 3.67 ± 1.53 | 0.031 | |
Large-sized | C1 | 0.75 ± 0.96 | C2 | 4.00 ± 2.00 | 0.034 |
LM1 | 3.25 ± 1.50 | M2 | 11.67 ± 1.15 | 0.00048 | |
Total | C1 | 8.00 ± 1.15 | C2 | 6.67 ± 1.15 | 0.191 |
LM1 | 10.25 ± 1.89 | M2 | 15.33 ± 2.08 | 0.02 |
Experiments | Seasons | Grouping | Body Weight (kg) | Number | Average Feed Intake (Air-Dry Basis, kg) |
---|---|---|---|---|---|
Experiment 1 | Non-breeding season (March to May) | C1: natural long daylight (control) | 46.18 ± 6.97 | 20 | 1.18 ± 0.08 |
LM1: simulated short daylight and male effect | 47.03 ± 6.54 | 20 | 1.20 ± 0.06 | ||
Experiment 2 | Breeding season (August to October) | C2: natural short daylight (control) | 48.98 ± 8.09 | 20 | 1.16 ± 0.02 |
M2: natural short daylight and male effect | 47.75 ± 8.31 | 20 | 1.28 ± 0.05 |
Gene Name | Primer Sequence (5′-3′) | Product Size (bp) | Accession Number |
---|---|---|---|
CDK1 | F: CCAATAATGAAGTGTGGCCAGAAG | 164 | XM_054367252.1 |
R: AGAAATTCGTTTGGCAGGATCATAG | |||
CDK2 | F: AACAAGTTGACGGGAGAAG | 237 | NM_052827.4 |
R: AAGAGGAATGCCAGTGAGT | |||
StAR | F: GGGGATGAGGTGCTGAGTAA | 163 | XM_013975437.2 |
R: TCTGCAGGACCTTGATCTCC | |||
CYP11A1 | F: TGGAGGATGTCAAGGCCAAT | 239 | NM_001287574.1 |
R: CACGGAGATAGGGTGGAGTC | |||
CYP19A1 | F: ACCAGGTCCCAGCTACTTTC | 246 | XM_013967046.2 |
R: TCATGCATGCCGATGAACTG | |||
ADCY5 | F: AGTTCCCATCGGACAAGCTG | 198 | XM_018045751.1 |
R: CGGCCATAACGAGGATCACA | |||
ADCY5-CDs | F: ATGTCCAGCTCCAAAAGCGTGAG | 3780 | XM_018045751.1 |
R: CTAACTGGGCGGGGGCCCTCCGTTGAGGAA | |||
β-actin | F: GGACTTCGAGCAGGAGATGG | 140 | NM_001314342.1 |
R: CCAGGAAGGAAGGCTGGAAG |
Antibodies | Cat No. | Source | Dilution |
---|---|---|---|
CDK1 | 310007 | Zen-bio, Chengdu, China | 1:1000 |
CDK2 | 10122-1-AP | Proteintech, Wuhan, China | 1:1000 |
ADCY5 | Ab66037 | Abcam, Cambridge, UK | 1:1000 |
StAR | A16432 | Abclonal, Woburn, MA, USA | 1:1000 |
CYP11A1 | A16363 | Abclonal | 1:1000 |
CYP19A1 | A12684 | Abclonal | 1:1000 |
3βHSD | A8035 | Abclonal | 1:1000 |
β-Tubulin | YM3030 | Immunoway, Plano, TX, USA | 1:1000 |
CREB | 9197 | Cell Signaling, Danvers, MA, USA | 1:1000 |
p-CREB | 9198 | Cell Signaling | 1:1000 |
p38 | 14064-1-AP | Proteintech | 1:1000 |
p-p38 | AF4001 | Affinity Biosciences, Cincinnati, OH, USA | 1:1000 |
Goat anti-Rabbit IgG HRP Conjugated | CW0103S | Cwbio, Taizhou, China | 1:5000 |
Goat anti-Mouse IgG HRP Conjugated | CW0102S | Cwbio | 1:5000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, C.; Zhang, F.; He, Q.; Man, J.; Mu, Y.; Zhao, J.; Zhu, L.; Loor, J.J.; Luo, J. ADCY5 Gene Affects Seasonal Reproduction in Dairy Goats by Regulating Ovarian Granulosa Cells Steroid Hormone Synthesis. Int. J. Mol. Sci. 2025, 26, 1622. https://doi.org/10.3390/ijms26041622
Shi C, Zhang F, He Q, Man J, Mu Y, Zhao J, Zhu L, Loor JJ, Luo J. ADCY5 Gene Affects Seasonal Reproduction in Dairy Goats by Regulating Ovarian Granulosa Cells Steroid Hormone Synthesis. International Journal of Molecular Sciences. 2025; 26(4):1622. https://doi.org/10.3390/ijms26041622
Chicago/Turabian StyleShi, Chenbo, Fuhong Zhang, Qiuya He, Jianjun Man, Yuanpan Mu, Jianqing Zhao, Lu Zhu, Juan J. Loor, and Jun Luo. 2025. "ADCY5 Gene Affects Seasonal Reproduction in Dairy Goats by Regulating Ovarian Granulosa Cells Steroid Hormone Synthesis" International Journal of Molecular Sciences 26, no. 4: 1622. https://doi.org/10.3390/ijms26041622
APA StyleShi, C., Zhang, F., He, Q., Man, J., Mu, Y., Zhao, J., Zhu, L., Loor, J. J., & Luo, J. (2025). ADCY5 Gene Affects Seasonal Reproduction in Dairy Goats by Regulating Ovarian Granulosa Cells Steroid Hormone Synthesis. International Journal of Molecular Sciences, 26(4), 1622. https://doi.org/10.3390/ijms26041622