Methionine Modulates the Growth and Development of Heat-Stressed Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Cell Morphological Identification
2.2. Impacts of Methionine on Intracellular Enzyme Concentrations and Cell Viability
2.3. Effects of Methionine on Protein Levels in Heat-Stressed Hair Papilla Cells
2.4. Effects of Methionine on Cell Senescence and Apoptosis
2.5. Effects of Methionine on Gene Expression in Heat-Stressed Hair Papilla Cells
2.6. Effects of Wnt Pathway Activators and Inhibitors on the Activity of Related Enzymes
2.7. Reflections of Wnt Pathway Activators and Inhibitors on Cell Senescence and Apoptosis
2.8. Effects of Wnt Pathway Activators and Inhibitors on Gene and Protein Expression
3. Discussion
4. Materials and Methods
4.1. Isolation, Culture, and Identification of Primary Dermal Papilla Cells
4.2. Experimental Design
4.3. Cell Proliferation and Viability
4.4. Correlative Enzymes Activity and Protein Levels
4.5. Cell Senescence
4.6. Flow Cytometry
4.7. Quantitative Real-Time RT-PCR
4.8. Identification of Molecular Mechanisms
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Périard, J.D.; Eijsvogels, T.M.H.; Daanen, H.A.M. Exercise under Heat Stress: Thermoregulation, Hydration, Performance Implications, and Mitigation Strategies. Physiol. Rev. 2021, 101, 1873–1979. [Google Scholar] [CrossRef] [PubMed]
- Bettaieb, A.; Wrzal, P.K.; Averill-Bates, D.A. Hyperthermia: Cancer Treatment and Beyond; InTech: Vitória, Brazil, 2013. [Google Scholar]
- Richter, K.; Haslbeck, M.; Buchner, J. The Heat Shock Response: Life on the Verge of Death. Mol. Cell 2010, 40, 253–266. [Google Scholar] [CrossRef] [PubMed]
- Toussaint, O.; Royer, V.; Salmon, M.; Remacle, J. Stress-induced premature senescence and tissue ageing. Biochem. Pharmacol. 2002, 64, 1007–1009. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Schmitt, C.A. The dynamic nature of senescence in cancer. Nat. Cell Biol. 2019, 21, 94–101. [Google Scholar] [CrossRef]
- Herranz, N.; Gil, J. Mechanisms and functions of cellular senescence. J. Clin. Investig. 2018, 128, 1238–1246. [Google Scholar] [CrossRef]
- Kruta, M.; Sunshine, M.J.; Chua, B.A.; Fu, Y.; Chawla, A.; Dillingham, C.H.; Hidalgo San Jose, L.; De Jong, B.; Zhou, F.J.; Signer, R.A.J. Hsf1 promotes hematopoietic stem cell fitness and proteostasis in response to ex vivo culture stress and aging. Cell Stem Cell 2021, 28, 1950–1965.e1956. [Google Scholar] [CrossRef]
- Morgan, B.A. The dermal papilla: An instructive niche for epithelial stem and progenitor cells in development and regeneration of the hair follicle. Cold Spring Harb. Perspect. Med. 2014, 4, a015180. [Google Scholar] [CrossRef]
- Banerjee, D.; Upadhyay, R.C.; Chaudhary, U.B.; Kumar, R.; Singh, S.; Ashutosh; G, J.M.; Polley, S.; Mukherjee, A.; Das, T.K.; et al. Seasonal variation in expression pattern of genes under HSP70: Seasonal variation in expression pattern of genes under HSP70 family in heat- and cold-adapted goats (Capra hircus). Cell Stress Chaperones 2014, 19, 401–408. [Google Scholar] [CrossRef]
- Yue, Z.; Liu, M.; Zhang, B.; Li, F.; Li, C.; Chen, X.; Li, F.; Liu, L. Vitamin A regulates dermal papilla cell proliferation and apoptosis under heat stress via IGF1 and Wnt10b signaling. Ecotoxicol. Environ. Saf. 2023, 262, 115328. [Google Scholar] [CrossRef]
- Driskell, R.R.; Clavel, C.; Rendl, M.; Watt, F.M. Hair follicle dermal papilla cells at a glance. J. Cell Sci. 2011, 124, 1179–1182. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.L.; Qiu, X.X.; Liao, X.H. Dermal Papilla Cells: From Basic Research to Translational Applications. Biology 2024, 13, 842. [Google Scholar] [CrossRef]
- Chi, W.; Wu, E.; Morgan, B.A. Dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. Development 2013, 140, 1676–1683. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Li, Z.; Lutz, H.; Huang, K.; Su, T.; Cores, J.; Dinh, P.C.; Cheng, K. Dermal exosomes containing miR-218-5p promote hair regeneration by regulating β-catenin signaling. Sci. Adv. 2020, 6, eaba1685. [Google Scholar] [CrossRef] [PubMed]
- Närhi, K.; Järvinen, E.; Birchmeier, W.; Taketo, M.M.; Mikkola, M.L.; Thesleff, I. Sustained epithelial beta-catenin activity induces precocious hair development but disrupts hair follicle down-growth and hair shaft formation. Development 2008, 135, 1019–1028. [Google Scholar] [CrossRef] [PubMed]
- Soe, Z.C.; Ei, Z.Z.; Visuttijai, K.; Chanvorachote, P. Potential Natural Products Regulation of Molecular Signaling Pathway in Dermal Papilla Stem Cells. Molecules 2023, 28, 5517. [Google Scholar] [CrossRef]
- Huelsken, J.; Vogel, R.; Erdmann, B.; Cotsarelis, G.; Birchmeier, W. beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 2001, 105, 533–545. [Google Scholar] [CrossRef] [PubMed]
- Ito, M.; Yang, Z.; Andl, T.; Cui, C.; Kim, N.; Millar, S.E.; Cotsarelis, G. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature 2007, 447, 316–320. [Google Scholar] [CrossRef]
- Resham, K.; Sharma, S.S. Pharmacologic Inhibition of Porcupine, Disheveled, and β-Catenin in Wnt Signaling Pathway Ameliorates Diabetic Peripheral Neuropathy in Rats. J. Pain 2019, 20, 1338–1352. [Google Scholar] [CrossRef]
- Qiao, X.; Wu, J.H.; Wu, R.B.; Su, R.; Li, C.; Zhang, Y.J.; Wang, R.J.; Zhao, Y.H.; Fan, Y.X.; Zhang, W.G.; et al. Discovery of differentially expressed genes in cashmere goat (Capra hircus) hair follicles by RNA sequencing. Genet. Mol. Res. 2016, 15, 10-4238. [Google Scholar] [CrossRef] [PubMed]
- Martínez, Y.; Li, X.; Liu, G.; Bin, P.; Yan, W.; Más, D.; Valdivié, M.; Hu, C.A.; Ren, W.; Yin, Y. The role of methionine on metabolism, oxidative stress, and diseases. Amino Acids 2017, 49, 2091–2098. [Google Scholar] [CrossRef]
- MacKay, D.S.; Brophy, J.D.; McBreairty, L.E.; McGowan, R.A.; Bertolo, R.F. Intrauterine growth restriction leads to changes in sulfur amino acid metabolism, but not global DNA methylation, in Yucatan miniature piglets. J. Nutr. Biochem. 2012, 23, 1121–1127. [Google Scholar] [CrossRef] [PubMed]
- Achilli, C.; Ciana, A.; Minetti, G. The discovery of methionine sulfoxide reductase enzymes: An historical account and future perspectives. Biofactors 2015, 41, 135–152. [Google Scholar] [CrossRef] [PubMed]
- Stadtman, E.R. Oxidation of free amino acids and amino acid residues in proteins by radiolysis and by metal-catalyzed reactions. Annu. Rev. Biochem. 1993, 62, 797–821. [Google Scholar] [CrossRef]
- Le, D.T.; Lee, B.C.; Marino, S.M.; Zhang, Y.; Fomenko, D.E.; Kaya, A.; Hacioglu, E.; Kwak, G.H.; Koc, A.; Kim, H.Y.; et al. Functional analysis of free methionine-R-sulfoxide reductase from Saccharomyces cerevisiae. J. Biol. Chem. 2009, 284, 4354–4364. [Google Scholar] [CrossRef] [PubMed]
- Grimaud, R.; Ezraty, B.; Mitchell, J.K.; Lafitte, D.; Briand, C.; Derrick, P.J.; Barras, F. Repair of oxidized proteins. Identification of a new methionine sulfoxide reductase. J. Biol. Chem. 2001, 276, 48915–48920. [Google Scholar] [CrossRef]
- Stadtman, E.R.; Van Remmen, H.; Richardson, A.; Wehr, N.B.; Levine, R.L. Methionine oxidation and aging. Biochim. Biophys. Acta 2005, 1703, 135–140. [Google Scholar] [CrossRef] [PubMed]
- Stadtman, E.R.; Moskovitz, J.; Levine, R.L. Oxidation of methionine residues of proteins: Biological consequences. Antioxid. Redox Signal. 2003, 5, 577–582. [Google Scholar] [CrossRef] [PubMed]
- Thompson, S.M.; Jondal, D.E.; Butters, K.A.; Knudsen, B.E.; Anderson, J.L.; Stokes, M.P.; Jia, X.; Grande, J.P.; Roberts, L.R.; Callstrom, M.R.; et al. Heat stress induced, ligand-independent MET and EGFR signalling in hepatocellular carcinoma. Int. J. Hyperth. 2018, 34, 812–823. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Liu, G.; Liu, L.; Li, F. Methionine can subside hair follicle development prejudice of heat-stressed rex rabbits. FASEB J. 2022, 36, e22464. [Google Scholar] [CrossRef]
- Wang, Z.; Luo, X.; Luo, Z.; Tan, Y.; He, G.; Li, P.; Yang, X. Transcriptome sequencing reveals neurotoxicity in embryonic neural stem/progenitor cells under heat stress. Toxicol. Vitro 2023, 86, 105486. [Google Scholar] [CrossRef]
- National Research Council (US) Committee on Guidelines for the Humane Transportation of Laboratory Animals. The National Academies Collection: Reports funded by National Institutes of Health. In Guidelines for the Humane Transportation of Research Animals; National Academy of Sciences: Washington, DC, USA, 2006. [Google Scholar]
- Saadeldin, I.M.; Swelum, A.A.; Elsafadi, M.; Mahmood, A.; Alfayez, M.; Alowaimer, A.N. Differences between the tolerance of camel oocytes and cumulus cells to acute and chronic hyperthermia. J. Therm. Biol. 2018, 74, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Velichko, A.K.; Petrova, N.V.; Razin, S.V.; Kantidze, O.L. Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress. Nucleic Acids Res. 2015, 43, 6309–6320. [Google Scholar] [CrossRef] [PubMed]
- Gidalevitz, T.; Prahlad, V.; Morimoto, R.I. The stress of protein misfolding: From single cells to multicellular organisms. Cold Spring Harb. Perspect. Biol. 2011, 3, a009704. [Google Scholar] [CrossRef] [PubMed]
- Beere, H.M. Death versus survival: Functional interaction between the apoptotic and stress-inducible heat shock protein pathways. J. Clin. Investig. 2005, 115, 2633–2639. [Google Scholar] [CrossRef] [PubMed]
- Chermnykh, E.S.; Vorotelyak, E.A.; Gnedeva, K.Y.; Moldaver, M.V.; Yegorov, Y.E.; Vasiliev, A.V.; Terskikh, V.V. Dermal papilla cells induce keratinocyte tubulogenesis in culture. Histochem. Cell Biol. 2010, 133, 567–576. [Google Scholar] [CrossRef]
- Rosic, N.; Delamare-Deboutteville, J.; Dove, S. Heat stress in symbiotic dinoflagellates: Implications on oxidative stress and cellular changes. Sci. Total Environ. 2024, 944, 173916. [Google Scholar] [CrossRef] [PubMed]
- Levine, R.L.; Mosoni, L.; Berlett, B.S.; Stadtman, E.R. Methionine residues as endogenous antioxidants in proteins. Proc. Natl. Acad. Sci. USA 1996, 93, 15036–15040. [Google Scholar] [CrossRef] [PubMed]
- Moskovitz, J.; Flescher, E.; Berlett, B.S.; Azare, J.; Poston, J.M.; Stadtman, E.R. Overexpression of peptide-methionine sulfoxide reductase in Saccharomyces cerevisiae and human T cells provides them with high resistance to oxidative stress. Proc. Natl. Acad. Sci. USA 1998, 95, 14071–14075. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.B.; Ferket, P.; Park, I.; Malheiros, R.D.; Kim, S.W. Effects of feed grade L-methionine on intestinal redox status, intestinal development, and growth performance of young chickens compared with conventional DL-methionine. J. Anim. Sci. 2015, 93, 2977–2986. [Google Scholar] [CrossRef]
- Roufayel, R.; Johnston, D.S.; Mosser, D.D. The elimination of miR-23a in heat-stressed cells promotes NOXA-induced cell death and is prevented by HSP70. Cell Death Dis. 2014, 5, e1546. [Google Scholar] [CrossRef]
- Chen, L.; Willis, S.N.; Wei, A.; Smith, B.J.; Fletcher, J.I.; Hinds, M.G.; Colman, P.M.; Day, C.L.; Adams, J.M.; Huang, D.C. Differential targeting of prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary apoptotic function. Mol. Cell 2005, 17, 393–403. [Google Scholar] [CrossRef] [PubMed]
- Stankiewicz, A.R.; Livingstone, A.M.; Mohseni, N.; Mosser, D.D. Regulation of heat-induced apoptosis by Mcl-1 degradation and its inhibition by Hsp70. Cell Death Differ. 2009, 16, 638–647. [Google Scholar] [CrossRef]
- Kühl, N.M.; Rensing, L. Heat shock effects on cell cycle progression. Cell. Mol. Life Sci. 2000, 57, 450–463. [Google Scholar] [CrossRef]
- Furusawa, Y.; Iizumi, T.; Fujiwara, Y.; Zhao, Q.L.; Tabuchi, Y.; Nomura, T.; Kondo, T. Inhibition of checkpoint kinase 1 abrogates G2/M checkpoint activation and promotes apoptosis under heat stress. Apoptosis 2012, 17, 102–112. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Zeng, Q.; Liu, Y.; Wu, B. Effect of methionine deficiency on the apoptosis and cell cycle of kidney in broilers. Res. Vet. Sci. 2021, 135, 228–236. [Google Scholar] [CrossRef]
- Albrecht, L.V.; Bui, M.H.; De Robertis, E.M. Canonical Wnt is inhibited by targeting one-carbon metabolism through methotrexate or methionine deprivation. Proc. Natl. Acad. Sci. USA 2019, 116, 2987–2995. [Google Scholar] [CrossRef]
- Sun, L.; Lamont, S.J.; Cooksey, A.M.; McCarthy, F.; Tudor, C.O.; Vijay-Shanker, K.; DeRita, R.M.; Rothschild, M.; Ashwell, C.; Persia, M.E.; et al. Transcriptome response to heat stress in a chicken hepatocellular carcinoma cell line. Cell Stress Chaperones 2015, 20, 939–950. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Fan, Z.; Xiao, X.; Kong, D.; Han, J.; Chu, W. Epidermal ET-1 signal induces activation of resting hair follicles by upregulating the PI3K/AKT pathway in the dermis. FASEB J. 2024, 38, e23476. [Google Scholar] [CrossRef]
- Han, J.; Chu, W.; Lin, K.; Wang, X.; Gao, Y. β-catenin activation in Gli-1+ stem cells leads to reprograming of the hair follicle. Eur. J. Dermatol. 2023, 33, 710–712. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.J.; Xie, W.Y.; Pan, N.X.; Wang, X.Q.; Yan, H.C.; Gao, C.Q. Methionine improves feather follicle development in chick embryos by activating Wnt/β-catenin signaling. Poult. Sci. 2020, 99, 4479–4487. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Bai, L.; Li, S.; Liu, H.; Zhu, Y.; Sun, H.; Gao, S.; Jiang, W.; Li, F. Isolation, culture and growth characteristics of dermal papilla cells from Rex rabbits. Tissue Cell 2020, 65, 101348. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Deng, Z.; Li, A.; Li, R.; Huang, W.; Cui, J.; Chen, S.; Li, B.; Zhang, S. β-Catenin promotes long-term survival and angiogenesis of peripheral blood mesenchymal stem cells via the Oct4 signaling pathway. Exp. Mol. Med. 2022, 54, 1434–1449. [Google Scholar] [CrossRef]
- Ding, H.; Yin, C.; Yang, M.; Zhou, R.; Wang, X.; Pan, X. Screening of differentially methylated genes in skeletal fluorosis of rats with different types and involvement of aberrant methylation of Cthrc1. Environ. Pollut. 2023, 332, 121931. [Google Scholar] [CrossRef]
- Clevers, H.; Nusse, R. Wnt/β-catenin signaling and disease. Cell 2012, 149, 1192–1205. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.M.; Mishina, Y.M.; Liu, S.; Cheung, A.; Stegmeier, F.; Michaud, G.A.; Charlat, O.; Wiellette, E.; Zhang, Y.; Wiessner, S.; et al. Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 2009, 461, 614–620. [Google Scholar] [CrossRef] [PubMed]








| Genes | GenBank Accession No. | Primer Sequence (5′-3′) | Product Size/bp |
|---|---|---|---|
| LRP5 | AB017499.1 | F: CCTTTACGAGCGGAACCAC R:GCAGGGTAGAACACGTCCAT | 144 |
| Hes5 | NM_008253710 | F:AGACCGCATCAACAGCAGCATC R:ATCTCCAGGATGTCCGCCTTCTC | 105 |
| VCAN | XM_008261907.3 | F:AATCATCCCTTTAGTCACCG R:CCTGTGGATAATCTGTCTGG | 126 |
| DVL2 | XM_008270807 | F:ACTCCACCATGTCCCTCAA R:CGATGTAGATGCCTCCGTCT | 117 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Wang, X.; Liu, G.; Li, F. Methionine Modulates the Growth and Development of Heat-Stressed Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway. Int. J. Mol. Sci. 2025, 26, 1495. https://doi.org/10.3390/ijms26041495
Li S, Wang X, Liu G, Li F. Methionine Modulates the Growth and Development of Heat-Stressed Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway. International Journal of Molecular Sciences. 2025; 26(4):1495. https://doi.org/10.3390/ijms26041495
Chicago/Turabian StyleLi, Shu, Xiaosong Wang, Gongyan Liu, and Fuchang Li. 2025. "Methionine Modulates the Growth and Development of Heat-Stressed Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway" International Journal of Molecular Sciences 26, no. 4: 1495. https://doi.org/10.3390/ijms26041495
APA StyleLi, S., Wang, X., Liu, G., & Li, F. (2025). Methionine Modulates the Growth and Development of Heat-Stressed Dermal Papilla Cells via the Wnt/β-Catenin Signaling Pathway. International Journal of Molecular Sciences, 26(4), 1495. https://doi.org/10.3390/ijms26041495

