Polychlorinated Biphenyls Induce Cytotoxicity and Inflammation in an In Vitro Model of an Ocular Barrier
Abstract
1. Introduction
2. Results
2.1. HCEpiC Viability
2.2. Transendothelial Electrical Resistance (TEER)
2.3. HCEpiC Migration
2.4. cPLA2 Protein Expression
2.5. cPLA2 Activity and Prostaglandins E2 Release
2.6. ERK and p38 Protein Expression
2.7. Cytokine mRNA Transcription
2.8. NF-kB Protein Expression
3. Discussion
4. Materials and Methods
4.1. Methods
Cell Cultures and Treatments
4.2. Cell Viability Assay
4.3. Transendothelial Electrical Resistance Measurement (TEER)
4.4. Wound Healing Assay
4.5. Total RNA Isolation and Real-Time Quantitative RT-PCR
4.6. Phospholipase A2 Assay and PGE2 Release
4.7. Immunoblot Analyses
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Giesy, J.P.; Kannan, K. Dioxin-like and Non-Dioxin-like Toxic Effects of Polychlorinated Biphenyls (PCBs): Implications for Risk Assessment. Crit. Rev. Toxicol. 1998, 28, 511–569. [Google Scholar] [CrossRef] [PubMed]
- Montano, L.; Pironti, C.; Pinto, G.; Ricciardi, M.; Buono, A.; Brogna, C.; Venier, M.; Piscopo, M.; Amoresano, A.; Motta, O. Polychlorinated Biphenyls (PCBs) in the Environment: Occupational and Exposure Events, Effects on Human Health and Fertility. Toxics 2022, 10, 365. [Google Scholar] [CrossRef] [PubMed]
- Vorkamp, K. An Overlooked Environmental Issue? A Review of the Inadvertent Formation of PCB-11 and Other PCB Congeners and Their Occurrence in Consumer Products and in the Environment. Sci. Total Environ. 2016, 541, 1463–1476. [Google Scholar] [CrossRef] [PubMed]
- McFarland, V.A.; Clarke, J.U. Environmental Occurrence, Abundance, and Potential Toxicity of Polychlorinated Biphenyl Congeners: Considerations for a Congener-Specific Analysis. Environ. Health Perspect. 1989, 81, 225–239. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Jiang, H.; Qin, J.; Qin, Y.; Zhou, X.; Shi, S.; Shu, Z.; Gao, Y.; Tan, J. Unexpectedly High Levels and Health Risks of Atmospheric Polychlorinated Biphenyls in Modern Mechanical Dismantling of Obsolete Electrical Equipment: Investigations in a Large Integrated e-Waste Dismantling Industrial Estate. Environ. Int. 2023, 182, 108333. [Google Scholar] [CrossRef]
- Montano, D. Chemical and Biological Work-Related Risks across Occupations in Europe: A Review. J. Occup. Med. Toxicol. 2014, 9, 28. [Google Scholar] [CrossRef]
- Niemeier, R.T.; Williams, P.R.D.; Rossner, A.; Clougherty, J.E.; Rice, G.E. A Cumulative Risk Perspective for Occupational Health and Safety (OHS) Professionals. Int. J. Environ. Res. Public Health 2020, 17, 6342. [Google Scholar] [CrossRef]
- Guillotin, S.; Delcourt, N. Studying the Impact of Persistent Organic Pollutants Exposure on Human Health by Proteomic Analysis: A Systematic Review. Int. J. Mol. Sci. 2022, 23, 14271. [Google Scholar] [CrossRef]
- Schmidt, C. How PCBs Are like Grasshoppers. Environ. Sci. Technol. 2010, 44, 2752. [Google Scholar] [CrossRef]
- DelMonte, D.W.; Kim, T. Anatomy and Physiology of the Cornea. J. Cataract. Refract. Surg. 2011, 37, 588–598. [Google Scholar] [CrossRef]
- Zhu, Q.; Zhu, Y.; Tighe, S.; Liu, Y.; Hu, M. Engineering of Human Corneal Endothelial Cells In Vitro. Int. J. Med. Sci. 2019, 16, 507–512. [Google Scholar] [CrossRef] [PubMed]
- Beeken, L.J.; Ting, D.S.J.; Sidney, L.E. Potential of Mesenchymal Stem Cells as Topical Immunomodulatory Cell Therapies for Ocular Surface Inflammatory Disorders. Stem Cells Transl. Med. 2021, 10, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Segars, K.L.; Trinkaus-Randall, V. Glycosaminoglycans: Roles in Wound Healing, Formation of Corneal Constructs and Synthetic Corneas. Ocul. Surf. 2023, 30, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Sendra, V.G.; Tau, J.; Zapata, G.; Lasagni Vitar, R.M.; Illian, E.; Chiaradía, P.; Berra, A. Polluted Air Exposure Compromises Corneal Immunity and Exacerbates Inflammation in Acute Herpes Simplex Keratitis. Front. Immunol. 2021, 12, 618597. [Google Scholar] [CrossRef]
- Anfuso, C.D.; Olivieri, M.; Fidilio, A.; Lupo, G.; Rusciano, D.; Pezzino, S.; Gagliano, C.; Drago, F.; Bucolo, C. Gabapentin Attenuates Ocular Inflammation: In Vitro and In Vivo Studies. Front. Pharmacol. 2017, 8, 173. [Google Scholar] [CrossRef]
- Giurdanella, G.; Longo, A.; Distefano, A.; Olivieri, M.; Cristaldi, M.; Cosentino, A.; Agafonova, A.; Caporarello, N.; Lupo, G.; Anfuso, C.D. The Anti-Inflammatory Effect of the Β1-Adrenergic Receptor Antagonist Metoprolol on High Glucose Treated Human Microvascular Retinal Endothelial Cells. Cells 2021, 11, 51. [Google Scholar] [CrossRef]
- Tithof, P.K.; Schiamberg, E.; Peters-Golden, M.; Ganey, P.E. Phospholipase A2 Is Involved in the Mechanism of Activation of Neutrophils by Polychlorinated Biphenyls. Environ. Health Perspect. 1996, 104, 52–58. [Google Scholar] [CrossRef]
- Forsell, P.K.A.; Olsson, A.O.; Andersson, E.; Nallan, L.; Gelb, M.H. Polychlorinated Biphenyls Induce Arachidonic Acid Release in Human Platelets in a Tamoxifen Sensitive Manner via Activation of Group IVA Cytosolic Phospholipase A2-Alpha. Biochem. Pharmacol. 2005, 71, 144–155. [Google Scholar] [CrossRef]
- Kodavanti, P.R.S. Cell Signaling and Neurotoxicity: 3H-Arachidonic Acid Release (Phospholipase A2) in Cerebellar Granule Neurons. Methods Mol. Biol. 2011, 758, 321–328. [Google Scholar] [CrossRef]
- Umannová, L.; Neca, J.; Andrysík, Z.; Vondrácek, J.; Upham, B.L.; Trosko, J.E.; Hofmanová, J.; Kozubík, A.; Machala, M. Non-Dioxin-like Polychlorinated Biphenyls Induce a Release of Arachidonic Acid in Liver Epithelial Cells: A Partial Role of Cytosolic Phospholipase A2 and Extracellular Signal-Regulated Kinases 1/2 Signalling. Toxicology 2008, 247, 55–60. [Google Scholar] [CrossRef][Green Version]
- Liu, Z.; Ruan, H.-J.; Gu, P.-Q.; Ding, W.-Y.; Luo, X.-H.; Huang, R.; Zhao, W.; Gao, L.-J. The Roles of P38 MAPK and ERK1/2 in Coplanar Polychlorinated Biphenyls-Induced Apoptosis of Human Extravillous Cytotrophoblast-Derived Transformed Cells. Cell Physiol. Biochem. 2015, 36, 2418–2432. [Google Scholar] [CrossRef] [PubMed]
- Peinado, F.M.; Artacho-Cordón, F.; Barrios-Rodríguez, R.; Arrebola, J.P. Influence of Polychlorinated Biphenyls and Organochlorine Pesticides on the Inflammatory Milieu. A Systematic Review of in Vitro, in Vivo and Epidemiological Studies. Environ. Res. 2020, 186, 109561. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Perkins, J.T.; Hennig, B. EGCG Prevents PCB-126-Induced Endothelial Cell Inflammation via Epigenetic Modifications of NF-κB Target Genes in Human Endothelial Cells. J. Nutr. Biochem. 2016, 28, 164–170. [Google Scholar] [CrossRef]
- Xu, X.; Zeng, X.; Boezen, H.M.; Huo, X. E-Waste Environmental Contamination and Harm to Public Health in China. Front. Med. 2015, 9, 220–228. [Google Scholar] [CrossRef]
- Moustardas, P.; Aberdam, D.; Lagali, N. MAPK Pathways in Ocular Pathophysiology: Potential Therapeutic Drugs and Challenges. Cells 2023, 12, 617. [Google Scholar] [CrossRef]
- Yang, S.; Zhang, J.; Tan, Y.; Wang, Y. Unraveling the Mechanobiology of Cornea: From Bench Side to the Clinic. Front. Bioeng. Biotechnol. 2022, 10, 953590. [Google Scholar] [CrossRef]
- Oesterling, E.; Majkova, Z.; Reiterer, G.; Guo, H.; Toborek, M.; Hennig, B. Polychlorinated Biphenyl-Mediated Inflammatory Signaling: Implications in Atherosclerosis. In Environmental Health in Central and Eastern Europe; Donnelly, K.C., Cizmas, L.H., Eds.; Springer: Dordrecht, The Netherlands, 2006; pp. 115–122. ISBN 978-1-4020-4844-9. [Google Scholar]
- Imayasu, M.; Shimada, S. Phosphorylation of MAP Kinase in Corneal Epithelial Cells during Wound Healing. Curr. Eye Res. 2003, 27, 133–141. [Google Scholar] [CrossRef]
- Sharma, G.-D.; He, J.; Bazan, H.E.P. P38 and ERK1/2 Coordinate Cellular Migration and Proliferation in Epithelial Wound Healing: Evidence of Cross-Talk Activation between MAP Kinase Cascades. J. Biol. Chem. 2003, 278, 21989–21997. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, J.; Yi, X.; Yu, F.-S.X. Activation of ERK1/2 MAP Kinase Pathway Induces Tight Junction Disruption in Human Corneal Epithelial Cells. Exp. Eye Res. 2004, 78, 125–136. [Google Scholar] [CrossRef]
- Mediero, A.; Guzmán-Aranguez, A.; Crooke, A.; Peral, A.; Pintor, J. Corneal Re-Epithelialization Stimulated by Diadenosine Polyphosphates Recruits RhoA/ROCK and ERK1/2 Pathways. Investig. Ophthalmol. Vis. Sci. 2008, 49, 4982–4992. [Google Scholar] [CrossRef]
- Nagai, N.; Fukuoka, Y.; Ishii, M.; Otake, H.; Yamamoto, T.; Taga, A.; Okamoto, N.; Shimomura, Y. Instillation of Sericin Enhances Corneal Wound Healing through the ERK Pathway in Rat Debrided Corneal Epithelium. Int. J. Mol. Sci. 2018, 19, 1123. [Google Scholar] [CrossRef] [PubMed]
- Byun, Y.-S.; Yoo, Y.-S.; Kwon, J.-Y.; Joo, J.-S.; Lim, S.-A.; Whang, W.-J.; Mok, J.-W.; Choi, J.-S.; Joo, C.-K. Diquafosol Promotes Corneal Epithelial Healing via Intracellular Calcium-Mediated ERK Activation. Exp. Eye Res. 2016, 143, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Nakahara, M.; Okumura, N.; Nakano, S.; Koizumi, N. Effect of a P38 Mitogen-Activated Protein Kinase Inhibitor on Corneal Endothelial Cell Proliferation. Investig. Ophthalmol. Vis. Sci. 2018, 59, 4218–4227. [Google Scholar] [CrossRef] [PubMed]
- Hongo, A.; Okumura, N.; Nakahara, M.; Kay, E.P.; Koizumi, N. The Effect of a P38 Mitogen-Activated Protein Kinase Inhibitor on Cellular Senescence of Cultivated Human Corneal Endothelial Cells. Investig. Ophthalmol. Vis. Sci. 2017, 58, 3325–3334. [Google Scholar] [CrossRef]
- Mao, Y.; Ou, S.; Zhu, C.; Lin, S.; Liu, X.; Liang, M.; Yu, J.; Wu, Y.; He, H.; Zong, R.; et al. Downregulation of P38 MAPK Signaling Pathway Ameliorates Tissue-Engineered Corneal Epithelium. Tissue Eng. Part A 2022, 28, 977–989. [Google Scholar] [CrossRef]
- Joko, T.; Shiraishi, A.; Akune, Y.; Tokumaru, S.; Kobayashi, T.; Miyata, K.; Ohashi, Y. Involvement of P38MAPK in Human Corneal Endothelial Cell Migration Induced by TGF-β(2). Exp. Eye Res. 2013, 108, 23–32. [Google Scholar] [CrossRef]
- Saika, S. TGF-Beta Signal Transduction in Corneal Wound Healing as a Therapeutic Target. Cornea 2004, 23, S25–S30. [Google Scholar] [CrossRef]
- Li, Z.-Y.; Chen, Z.-L.; Zhang, T.; Wei, C.; Shi, W.-Y. TGF-β and NF-κB Signaling Pathway Crosstalk Potentiates Corneal Epithelial Senescence through an RNA Stress Response. Aging 2016, 8, 2337–2354. [Google Scholar] [CrossRef]
- Teng, M.; Wang, J.; Su, X.; Tian, Y.; Ye, X.; Zhang, Y. Causal Associations between Circulating Inflammatory Cytokines and Blinding Eye Diseases: A Bidirectional Mendelian Randomization Analysis. Front. Aging Neurosci. 2024, 16, 1324651. [Google Scholar] [CrossRef]
- Paimela, T.; Ryhänen, T.; Kauppinen, A.; Marttila, L.; Salminen, A.; Kaarniranta, K. The Preservative Polyquaternium-1 Increases Cytoxicity and NF-kappaB Linked Inflammation in Human Corneal Epithelial Cells. Mol. Vis. 2012, 18, 1189–1196. [Google Scholar]
- Yu, Q.; Biswas, S.; Ma, G.; Zhao, P.; Li, B.; Li, J. Canonical NF-κB Signaling Maintains Corneal Epithelial Integrity and Prevents Corneal Aging via Retinoic Acid. eLife 2021, 10, e67315. [Google Scholar] [CrossRef] [PubMed]
- Moilanen, E. Two Faces of Inflammation: An Immunopharmacological View. Basic Clin. Pharmacol. Toxicol. 2014, 114, 2–6. [Google Scholar] [CrossRef] [PubMed]
- Romeo, A.; Musumeci, T.; Carbone, C.; Bonaccorso, A.; Corvo, S.; Lupo, G.; Anfuso, C.D.; Puglisi, G.; Pignatello, R. Ferulic Acid-Loaded Polymeric Nanoparticles for Potential Ocular Delivery. Pharmaceutics 2021, 13, 687. [Google Scholar] [CrossRef] [PubMed]
- Lupo, G.; Anfuso, C.D.; Ragusa, N.; Strosznajder, R.P.; Walski, M.; Alberghina, M. T-Butyl Hydroperoxide and Oxidized Low Density Lipoprotein Enhance Phospholipid Hydrolysis in Lipopolysaccharide-Stimulated Retinal Pericytes. Biochim. Biophys. Acta 2001, 1531, 143–155. [Google Scholar] [CrossRef]
- Caporarello, N.; Olivieri, M.; Cristaldi, M.; Scalia, M.; Toscano, M.A.; Genovese, C.; Addamo, A.; Salmeri, M.; Lupo, G.; Anfuso, C.D. Blood–Brain Barrier in a Haemophilus Influenzae Type a In Vitro Infection: Role of Adenosine Receptors A2A and A2B. Mol. Neurobiol. 2018, 55, 5321–5336. [Google Scholar] [CrossRef]
- Giurdanella, G.; Longo, A.; Salerno, L.; Romeo, G.; Intagliata, S.; Lupo, G.; Distefano, A.; Platania, C.B.M.; Bucolo, C.; Li Volti, G.; et al. Glucose-Impaired Corneal Re-Epithelialization Is Promoted by a Novel Derivate of Dimethyl Fumarate. Antioxidants 2021, 10, 831. [Google Scholar] [CrossRef]
- Scuderi, M.R.; Anfuso, C.D.; Lupo, G.; Motta, C.; Romeo, L.; Guerra, L.; Cappellani, A.; Ragusa, N.; Cantarella, G.; Alberghina, M. Expression of Ca2+-Independent and Ca2+-Dependent Phospholipases A2 and Cyclooxygenases in Human Melanocytes and Malignant Melanoma Cell Lines. Biochim. Biophys. Acta (BBA)—Mol. Cell Biol. Lipids 2008, 1781, 635–642. [Google Scholar] [CrossRef]
- Genovese, C.; Cambria, M.T.; D’Angeli, F.; Addamo, A.P.; Malfa, G.A.; Siracusa, L.; Pulvirenti, L.; Anfuso, C.D.; Lupo, G.; Salmeri, M. The Double Effect of Walnut Septum Extract (Juglans regia L.) Counteracts A172 Glioblastoma Cell Survival and Bacterial Growth. Int. J. Oncol. 2020, 57, 1129–1144. [Google Scholar] [CrossRef]
- Platania, C.B.M.; Pittalà, V.; Pascale, A.; Marchesi, N.; Anfuso, C.D.; Lupo, G.; Cristaldi, M.; Olivieri, M.; Lazzara, F.; Di Paola, L.; et al. Novel Indole Derivatives Targeting HuR-mRNA Complex to Counteract High Glucose Damage in Retinal Endothelial Cells. Biochem. Pharmacol. 2020, 175, 113908. [Google Scholar] [CrossRef]








| Treatment (μg/mL) | PLA2 Activity (pmol/min/mg) |
|---|---|
| Control | 46.3 ± 5.6 |
| Aroclor 0.1 | 49.8 ± 3.9 |
| Aroclor 1.0 | 86.1 ± 6.2 * |
| Aroclor 10 | 115.1 ± 9.3 * |
| Treatment (μg/mL) | PGE2 (pg/mL) |
|---|---|
| Control | 354 ± 45 |
| Aroclor 0.1 | 333 ± 58 |
| Aroclor 1.0 | 535 ± 46 * |
| Aroclor 10 | 786 ± 61 * |
| Gene | Sequence (5′-3′) |
|---|---|
| TGF-β1 | Fw CGTCTGCTGAGGCTCAAGT Rv CGCCAGGAATTGTTGCTGTA |
| cPLA2 | Fw CTC TTG AAG TTT GCT CAT GCC CAG AC Rv GCA AAC ATC AGC TCT GAA ACG TCA GG |
| TNF-α | Fw AGC CCA TGT TGT AGC AAA CC Rv TGA GGT ACA GGC CCT CTG AT |
| IL-1β | Fw AGCTACGAATCTCCGACCAC Rv CGTTATCCCATGTGTCGAAGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cosentino, A.; Agafonova, A.; Cavallaro, L.; Musumeci, R.E.; Prinzi, C.; Lombardo, C.; Cambria, M.T.; Anfuso, C.D.; Lupo, G. Polychlorinated Biphenyls Induce Cytotoxicity and Inflammation in an In Vitro Model of an Ocular Barrier. Int. J. Mol. Sci. 2025, 26, 916. https://doi.org/10.3390/ijms26030916
Cosentino A, Agafonova A, Cavallaro L, Musumeci RE, Prinzi C, Lombardo C, Cambria MT, Anfuso CD, Lupo G. Polychlorinated Biphenyls Induce Cytotoxicity and Inflammation in an In Vitro Model of an Ocular Barrier. International Journal of Molecular Sciences. 2025; 26(3):916. https://doi.org/10.3390/ijms26030916
Chicago/Turabian StyleCosentino, Alessia, Aleksandra Agafonova, Luca Cavallaro, Rosaria Ester Musumeci, Chiara Prinzi, Cinzia Lombardo, Maria Teresa Cambria, Carmelina Daniela Anfuso, and Gabriella Lupo. 2025. "Polychlorinated Biphenyls Induce Cytotoxicity and Inflammation in an In Vitro Model of an Ocular Barrier" International Journal of Molecular Sciences 26, no. 3: 916. https://doi.org/10.3390/ijms26030916
APA StyleCosentino, A., Agafonova, A., Cavallaro, L., Musumeci, R. E., Prinzi, C., Lombardo, C., Cambria, M. T., Anfuso, C. D., & Lupo, G. (2025). Polychlorinated Biphenyls Induce Cytotoxicity and Inflammation in an In Vitro Model of an Ocular Barrier. International Journal of Molecular Sciences, 26(3), 916. https://doi.org/10.3390/ijms26030916

