Tetrahydrocurcumin Alleviates Metabolic Dysfunction-Associated Steatohepatitis in Mice by Regulating Serum Lipids, Bile Acids, and Gut Microbiota
Abstract
1. Introduction
2. Results
2.1. Effects of THC on Liver Function-Related Biochemical Indicators in MASH Mice
2.2. Effects of THC on Liver Histopathology in Mice
2.3. Effects of THC on Serum Lipidomics
2.4. Effects of THC on Composition of Gut Microbiota in MASH Mice
2.5. Effect of THC on Serum Bile Acids in MASH Mice
2.6. Effect of THC on Genes Related to Fatty Acid Biosynthesis and Bile Acid Homeostasis in Mice
2.7. Correlation Analysis of Differentially Changed Lipids, Bile Acids, and Microbiota
3. Discussion
4. Methods and Materials
4.1. Materials
4.2. Animals, Diets, and Treatments
4.3. Serum and Liver Biochemical Indicators
4.4. Liver Histopathology
4.5. Serum Lipidomics Analysis
4.6. Serum Bile Acid Analysis
4.7. Analysis of 16S Gene-Targeted Sequencing of Intestinal Microbiota
4.8. Real-Time q-PCR
4.9. Data Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| Abbreviation | Full Name |
| MALFD | Malonyl-CoA decarboxylase |
| MASH | Mast Cell Activation Syndrome |
| MCS | Methionine- and choline-supplemented diet |
| MCD | Methionine- and choline-deficient diet |
| THC | Tetrahydrocurcumin |
| OCA | Obeticholic acid |
| TG | Triglycerides |
| MDA | Malondialdehyde |
| ALT | Alanine aminotransferase |
| AST | Aspartate aminotransferase |
| FFA | Free fatty acid |
| PE | Phosphatidylethanolamine |
| 12,13-EpOME | 12,13-Epoxyoctadecadienoic Acid |
| 9,10-EpOME | 9,10-Epoxyoctadecadienoic Acid |
| 9,10-DiHOME | 9,10-Dihydroxyoctadecanoic Acid |
| 14(S)-HDHA | 14(S)-Hydroxydocosahexaenoic Acid |
| LPC | Lysophosphatidylcholine |
| LPE | Lysophosphatidylethanolamine |
| PC | Phosphatidylcholine |
| PI | Phosphatidylinositol |
| PA | Phosphatidic acid |
| CE | Cholesteryl ester |
| TxB3 | Thromboxane B3 |
| SM | Sphingomyelin |
| 23-DCA | 23-deoxycholic acid |
| β-MCA | Beta-muricholic acid |
| ω-MCA | Omega-muricholic acid |
| 7-KDCA | 7-ketodeoxycholic acid |
| UCA | Ursocholic acid |
| CA | Cholic acid |
| HDCA | Hyodeoxycholic acid |
| TDCA | Taurodeoxycholic acid |
| Cyp7a1 | Cytochrome P450 7A1 |
| Cyp27a1 | Cytochrome P450 27A1 |
| Mrp2 | Multidrug Resistance-associated Protein 2 |
| Bsep | Bile Salt Export Pump |
| Ntcp | Na⁺/taurocholate-cotransporting polypeptide |
| Oatp1b2 | Organic Anion-Transporting Polypeptide 1B2 |
| Srebp1c | Sterol Regulatory Element-binding Protein 1c |
| Fas | Fatty acid synthase |
| Scd1 | Stearoyl-CoA Desaturase 1 |
| Acc1 | Acetyl-CoA Carboxylase 1 |
References
- Younossi, Z.M.; Golabi, P.; Paik, J.M.; Henry, A.; Van Dongen, C.; Henry, L. The global epidemiology of nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH): A systematic review. Hepatology 2023, 77, 1335–1347. [Google Scholar] [CrossRef]
- Younossi, Z.M.; Kalligeros, M.; Henry, L. Epidemiology of Metabolic Dysfunction-Associated Steatotic Liver Disease. Clin. Mol. Hepatol. 2024. [Google Scholar] [CrossRef]
- Huby, T.; Gautier, E.L. Immune cell-mediated features of non-alcoholic steatohepatitis. Nat. Rev. Immunol. 2022, 22, 429–443. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, L.; Dong, B. Molecular mechanisms in MASLD/MASH-related HCC. Hepatology 2024, 10–1097. [Google Scholar] [CrossRef]
- Musso, G.; Cassader, M.; Paschetta, E.; Gambino, R. Bioactive lipid species and metabolic pathways in progression and resolution of nonalcoholic steatohepatitis. Gastroenterology 2018, 155, 282–302.e8. [Google Scholar] [CrossRef] [PubMed]
- Neuschwander-Tetri, B.A. Nontriglyceride hepatic lipotoxicity: The new paradigm for the pathogenesis of NASH. Curr. Gastroenterol. Rep. 2010, 12, 49–56. [Google Scholar] [CrossRef]
- Josh-Barve, S.; Barve, S.S.; Amancherla, K.; Gobejishvili, L.; Hill, D.; Cave, M.; Hote, P.; McClain, C.J. Palmitic acid induces production of proinflammatory cytokine interleukin-8 from hepatocytes. Hepatology 2007, 46, 823–830. [Google Scholar] [CrossRef] [PubMed]
- Pusl, T.; Wild, N.; Vennegeerts, T.; Wimmer, R.; Göke, B.; Brand, S.; Rust, C. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochem. Biophys. Res. Commun. 2008, 371, 441–445. [Google Scholar] [CrossRef]
- Tanaka, N.; Matsubara, T.; Krausz, K.W.; Patterson, A.D.; Gonzalez, F.J. Disruption of phospholipid and bile acid homeostasis in mice with nonalcoholic steatohepatitis. Hepatology 2012, 56, 118–129. [Google Scholar] [CrossRef] [PubMed]
- Gottlieb, A.; Canbay, A. Why bile acids are so important in non-alcoholic fatty liver disease (NAFLD) progression. Cells 2019, 8, 1358. [Google Scholar] [CrossRef]
- Caussy, C.; Hsu, C.; Singh, S.; Bassirian, S.; Kolar, J.; Faulkner, C.; Sinha, N.; Bettencourt, R.; Gara, N.; Valasek, M.A.; et al. Serum bile acid patterns are associated with the presence of NAFLD in twins, and dose-dependent changes with increase in fibrosis stage in patients with biopsy-proven NAFLD. Aliment. Pharmacol. Ther. 2019, 49, 183–193. [Google Scholar] [CrossRef]
- Xie, G.; Wang, X.; Huang, F.; Zhao, A.; Chen, W.; Yan, J.; Zhang, Y.; Lei, S.; Ge, K.; Zheng, X.; et al. Dysregulated hepatic bile acids collaboratively promote liver carcinogenesis. Int. J. Cancer 2016, 139, 1764–1775. [Google Scholar] [CrossRef]
- Mouzaki, M.; Wang, A.Y.; Bandsma, R.; Comelli, E.M.; Arendt, B.M.; Zhang, L.; Fung, S.; Fischer, S.E.; McGilvray, I.G.; Allard, J.P. Bile acids and dysbiosis in non-alcoholic fatty liver disease. PLoS ONE 2016, 11, e0151829. [Google Scholar] [CrossRef] [PubMed]
- He, B.; Jiang, J.; Shi, Z.; Wu, L.; Yan, J.; Chen, Z.; Luo, M.; Cui, D.; Xu, S.; Yan, M.; et al. Pure total flavonoids from citrus attenuate non-alcoholic steatohepatitis via regulating the gut microbiota and bile acid metabolism in mice. Biomed. Pharmacother. 2021, 135, 111183. [Google Scholar] [CrossRef] [PubMed]
- de Faria Ghetti, F.; Oliveira, D.G.; de Oliveira, J.M.; de Castro Ferreira, L.E.V.V.; Cesar, D.E.; Moreira, A.P.B. Influence of gut microbiota on the development and progression of nonalcoholic steatohepatitis. Eur. J. Nutr. 2018, 57, 861–876. [Google Scholar] [CrossRef] [PubMed]
- Ikegami, T.; Honda, A. Reciprocal interactions between bile acids and gut microbiota in human liver diseases. Hepatol. Res. 2018, 48, 15–27. [Google Scholar] [CrossRef] [PubMed]
- Jia, E.; Liu, Z.; Pan, M.; Lu, J.F.; Ge, Q.Y. Regulation of bile acid metabolism-related signaling pathways by gut microbiota in diseases. J. Zhejiang Univ.-Sci. B 2019, 20, 781–792. [Google Scholar] [CrossRef]
- Alkhatib, D.H.; Jaleel, A.; Tariq, M.N.M.; Feehan, J.; Apostolopoulos, V.; Cheikh Ismail, L.; Stojanovska, L.; Dhaheri, A.S.A. The Role of Bioactive Compounds from Dietary Spices in the Management of Metabolic Syndrome: An Overview. Nutrients 2022, 14, 175. [Google Scholar] [CrossRef] [PubMed]
- Islam, T.; Scoggin, S.; Gong, X.; Kalupahana, N.S.; Moustaid-Moussa, N. Anti-Inflammatory Mechanisms of Curcumin and Its Metabolites in White Adipose Tissue and Cultured Adipocytes. Nutrients 2023, 16, 70. [Google Scholar] [CrossRef]
- Zhu, H.; Zhang, L.; Jia, H.; Xu, L.; Cao, Y.; Zhai, M.; Li, K.; Xia, L.; Jiang, L.; Li, X.; et al. Tetrahydrocurcumin improves lipopolysaccharide-induced myocardial dysfunction by inhibiting oxidative stress and inflammation via JNK/ERK signaling pathway regulation. Phytomedicine 2022, 104, 154283. [Google Scholar] [CrossRef]
- Chen, J.W.; Kong, Z.L.; Tsai, M.L.; Lo, C.Y.; Ho, C.T.; Lai, C.S. Tetrahydrocurcumin ameliorates free fatty acid-induced hepatic steatosis and improves insulin resistance in HepG2 cells. J. Food Drug Anal. 2018, 26, 1075–1085. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.H.; Chen, J.W.; Kong, Z.L.; Wu, J.C.; Ho, C.T.; Lai, C.S. Attenuation by tetrahydrocurcumin of adiposity and hepatic steatosis in mice with high-fat-diet-induced obesity. J. Agric. Food Chem. 2018, 66, 12685–12695. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Guan, F.; Huang, H.; Chen, H.; Liu, Y.; Zhang, S.; Li, M.; Chen, J. Tetrahydrocurcumin ameliorates hepatic steatosis by restoring hepatocytes lipophagy through mTORC1-TFEB pathway in nonalcoholic steatohepatitis. Biomed. Pharmacother. 2024, 178, 117297. [Google Scholar] [CrossRef]
- Gao, F.; Chen, M.; Yu, J.; Zhang, Y.; Gao, Y.; Ran, L.; Yi, L.; Mi, M.; Zhang, Q. Tetrahydrocurcumin protects against nonalcoholic fatty liver disease by improving lipid metabolism and redox homeostasis. J. Funct. Foods 2022, 89, 104957. [Google Scholar] [CrossRef]
- Boden, G. Obesity, insulin resistance and free fatty acids. Curr. Opin. Endocrinol. Diabetes Obes. 2011, 18, 139–143. [Google Scholar] [CrossRef]
- Zhu, L.; Xue, Y.; Feng, J.; Wang, Y.; Lu, Y.; Chen, C. Tetrahydrocurcumin as a stable and highly active curcumin derivative: A review of synthesis, bioconversion, detection and application. Food Biosci. 2023, 53, 102591. [Google Scholar] [CrossRef]
- Różański, G.; Tabisz, H.; Zalewska, M.; Niemiro, W.; Kujawski, S.; Newton, J.; Zalewski, P.; Słomko, J. Meta-analysis of exploring the effect of curcumin supplementation with or without other advice on biochemical and anthropometric parameters in patients with metabolic-associated fatty liver disease (MAFLD). Int. J. Environ. Res. Public Health 2023, 20, 4266. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Chen, X.; Li, Y.; Liang, Y.; Hong, T.; Yang, J.; Cao, Z.; Mai, H.; Yao, J.; Zhang, T.; et al. Curcumin supplementation alleviates hepatic fat content associated with modulation of gut microbiota-dependent bile acid metabolism in patients with nonalcoholic simple fatty liver disease: A randomized controlled trial. Am. J. Clin. Nutr. 2024, 120, 66–79. [Google Scholar] [CrossRef] [PubMed]
- Panahi, Y.; Khalili, N.; Sahebi, E.; Namazi, S.; Reiner, Ž.; Majeed, M.; Sahebkar, A. Curcuminoids modify lipid profile in type 2 diabetes mellitus: A randomized controlled trial. Complement. Ther. Med. 2017, 33, 1–5. [Google Scholar] [CrossRef]
- Shafabakhsh, R.; Asemi, Z.; Reiner, Z.; Soleimani, A.; Aghadavod, E.; Bahmani, F. The Effects of Nano-curcumin on Metabolic Status in Patients with Diabetes on Hemodialysis, a Randomized, Double Blind, Placebo-controlled Trial. Iran. J. Kidney Dis. 2020, 14, 290–299. [Google Scholar]
- Hirsova, P.; Ibrabim, S.H.; Gores, G.J.; Malhi, H. Lipotoxic lethal and sublethal stress signaling in hepatocytes: Relevance to NASH pathogenesis. J. Lipid Res. 2016, 57, 1758–1770. [Google Scholar] [CrossRef]
- Esser-von Bieren, J. Immune-regulation and -functions of eicosanoid lipid mediators. Biol. Chem. 2017, 398, 1177–1191. [Google Scholar] [CrossRef]
- Viswanathan, S.; Hammock, B.D.; Newman, J.W.; Meerarani, P.; Toborek, M.; Hennig, B. Involvement of CYP 2C9 in mediating the proinflammatory effects of linoleic acid in vascular endothelial cells. J. Am. Coll. Nutr. 2003, 22, 502–510. [Google Scholar] [CrossRef]
- Totani, Y.; Saito, Y.; Ishizaki, T.; Sasaki, F.; Ameshima, S.; Miyamori, I. Leukotoxin and its diol induce neutrophil chemotaxis through signal transduction different from that of fMLP. Eur. Respir. J. 2000, 15, 75–79. [Google Scholar] [CrossRef] [PubMed]
- Lecka-Czernik, B.; Moerman, E.J.; Grant, D.F.; Lehmann, J.M.; Manolagas, S.C.; Jilka, R.L. Divergent effects of selective peroxisome proliferator-activated receptor-γ2 ligands on adipocyte versus osteoblast differentiation. Endocrinology 2002, 143, 2376–2384. [Google Scholar] [CrossRef]
- Ellis, E.F.; Police, R.J.; Rice, L.Y.; Grabeel, M.; Holt, S. Increased plasma PGE2, 6-keto-PGF1α, and 12-HETE levels following experimental concussive brain injury. J. Neurotrauma 1989, 6, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, N.; Yamaguchi, H.; Mano, N. Transport of eicosapentaenoic acid-Derived PGE3, PGF3α, and TXB3 by ABCC4. PLoS ONE 2014, 9, e109270. [Google Scholar] [CrossRef]
- Ye, J.Z.; Li, Y.T.; Wu, W.R.; Shi, D.; Fang, D.Q.; Yang, L.Y.; Bian, X.Y.; Wu, J.J.; Wang, Q.; Jiang, X.W.; et al. Dynamic alterations in the gut microbiota and metabolome during the development of methionine-choline-deficient diet-induced nonalcoholic steatohepatitis. World J. Gastroenterol. 2018, 24, 2468. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wan, Y.J. The role of gut microbiota in liver disease development and treatment. Liver Res. 2019, 3, 3–18. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; Liu, C.; Zheng, N.; Jia, W.; Zhang, W.; Li, H. Metabolic and gut microbial characterization of obesity-prone mice under a high-fat diet. J. Proteome Res. 2019, 18, 1703–1714. [Google Scholar] [CrossRef] [PubMed]
- Anhê, F.F.; Roy, D.; Pilon, G.; Dudonné, S.; Matamoros, S.; Varin, T.V.; Garofalo, C.; Moine, Q.; Desjardins, Y.; Levy, E.; et al. A polyphenol-rich cranberry extract protects from diet-induced obesity, insulin resistance and intestinal inflammation in association with increased Akkermansia spp. population in the gut microbiota of mice. Gut 2015, 64, 872–883. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Lee, Y.; Kim, Y.; Seo, Y.; Lee, H.; Ha, J.; Lee, J.; Choi, Y.; Oh, H.; Yoon, Y. Akkermansia muciniphila prevents fatty liver disease, decreases serum triglycerides, and maintains gut homeostasis. Appl. Environ. Microbiol. 2020, 86, e03004-19. [Google Scholar] [CrossRef]
- Zhang, T.; Li, Q.; Cheng, L.; Buch, H.; Zhang, F. Akkermansia muciniphila is a promising probiotic. Microb. Biotechnol. 2019, 12, 1109–1125. [Google Scholar] [CrossRef]
- Xie, G.; Wang, X.; Liu, P.; Wei, R.; Chen, W.; Rajani, C.; Hernandez, B.Y.; Alegado, R.; Dong, B.; Li, D.; et al. Distinctly altered gut microbiota in the progression of liver disease. Oncotarget 2016, 7, 19355. [Google Scholar] [CrossRef] [PubMed]
- Peters, B.A.; Shapiro, J.A.; Church, T.R.; Miller, G.; Trinh-Shevrin, C.; Yuen, E.; Friedlander, C.; Hayes, R.B. A taxonomic signature of obesity in a large study of American adults. Sci. Rep. 2018, 8, 9749. [Google Scholar] [CrossRef]
- Braun, T.; Di Segni, A.; BenShoshan, M.; Neuman, S.; Levhar, N.; Bubis, M.; Picard, O.; Sosnovski, K.; Efroni, G.; Barhom, S.F.; et al. Individualized dynamics in the gut microbiota precede Crohn’s disease flares. Off. J. Am. Coll. Gastroenterol.|ACG 2019, 114, 1142–1151. [Google Scholar] [CrossRef] [PubMed]
- Xiong, F.; Zheng, Z.; Xiao, L.; Su, C.; Chen, J.; Gu, X.; Tang, J.; Zhao, Y.; Luo, H.; Zha, L. Soyasaponin A2 Alleviates Steatohepatitis Possibly through Regulating Bile Acids and Gut Microbiota in the Methionine and Choline-Deficient (MCD) Diet-induced Nonalcoholic Steatohepatitis (NASH) Mice. Mol. Nutr. Food Res. 2021, 65, 2100067. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Lv, L.; Wu, W.; Li, Y.; Shi, D.; Fang, D.; Guo, F.; Jiang, H.; Yan, R.; Ye, W.; et al. Butyrate protects mice against methionine–choline-deficient diet-induced non-alcoholic steatohepatitis by improving gut barrier function, attenuating inflammation and reducing endotoxin levels. Front. Microbiol. 2018, 9, 1967. [Google Scholar] [CrossRef]
- Ferslew, B.C.; Xie, G.; Johnston, C.K.; Su, M.; Stewart, P.W.; Jia, W.; Brouwer, K.L.; Barritt, A.S., 4th. Altered bile acid metabolome in patients with nonalcoholic steatohepatitis. Dig. Dis. Sci. 2015, 60, 3318–3328. [Google Scholar] [CrossRef] [PubMed]
- Sharma, R.; Majer, F.; Peta, V.K.; Wang, J.; Keaveney, R.; Kelleher, D.; Long, A.; Gilmer, J.F. Bile acid toxicity structure–activity relationships: Correlations between cell viability and lipophilicity in a panel of new and known bile acids using an oesophageal cell line (HET-1A). Bioorg. Med. Chem. 2010, 18, 6886–6895. [Google Scholar] [CrossRef] [PubMed]
- Puri, P.; Daita, K.; Joyce, A.; Mirshahi, F.; Santhekadur, P.K.; Cazanave, S.; Luketic, V.A.; Siddiqui, M.S.; Boyett, S.; Min, H.K.; et al. The presence and severity of nonalcoholic steatohepatitis is associated with specific changes in circulating bile acids. Hepatology 2018, 67, 534–548. [Google Scholar] [CrossRef] [PubMed]
- Staley, C.; Weingarden, A.R.; Khoruts, A.; Sadowsky, M.J. Interaction of gut microbiota with bile acid metabolism and its influence on disease states. Appl. Microbiol. Biotechnol. 2017, 101, 47–64. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Yang, W.; Chen, Y.; Huang, F.; Lu, L.; Lin, C.; Huang, T.; Ning, Z.; Zhai, L.; Zhong, L.L.; et al. A Clostridia-rich microbiota enhances bile acid excretion in diarrhea-predominant irritable bowel syndrome. J. Clin. Investig. 2020, 130, 438–450. [Google Scholar] [CrossRef] [PubMed]
- Bustos, A.Y.; de Valdez, G.F.; Fadda, S.; Taranto, M.P. New insights into bacterial bile resistance mechanisms: The role of bile salt hydrolase and its impact on human health. Food Res. Int. 2018, 112, 250–262. [Google Scholar] [CrossRef] [PubMed]
- Jia, W.; Xie, G.; Jia, W. Bile acid–microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 111–128. [Google Scholar] [CrossRef] [PubMed]
- Huang, F.; Zheng, X.; Ma, X.; Jiang, R.; Zhou, W.; Zhou, S.; Zhang, Y.; Lei, S.; Wang, S.; Kuang, J.; et al. Theabrownin from Pu-erh tea attenuates hypercholesterolemia via modulation of gut microbiota and bile acid metabolism. Nat. Commun. 2019, 10, 4971. [Google Scholar] [CrossRef]
- Wahlström, A.; Sayin, S.I.; Marschall, H.U.; Bäckhed, F. Intestinal crosstalk between bile acids and microbiota and its impact on host metabolism. Cell Metab. 2016, 24, 41–50. [Google Scholar] [CrossRef]
- Velagapudi, V.R.; Hezaveh, R.; Reigstad, C.S.; Gopalacharyulu, P.; Yetukuri, L.; Islam, S.; Felin, J.; Perkins, R.; Borén, J.; Oresic, M.; et al. The gut microbiota modulates host energy and lipid metabolism in mice. J. Lipid Res. 2010, 51, 1101–1112. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhang, S.; Chen, L.; Xu, R.; Zhu, J. LC-HRMS-based metabolomics and lipidomics analyses of a novel probiotic Akkermansia Muciniphila in response to different nutritional stimulations. J. Microbiol. Methods 2024, 223, 106975. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Xiong, X.; Liu, M.; Liang, Q.; Zhao, Q.; Wei, G.; Shi, J.; Li, X. Bacteroides ovatus alleviates high-fat and high-cholesterol -induced nonalcoholic fatty liver disease via gut-liver axis. Biomed. Pharmacother. 2024, 178, 117156. [Google Scholar] [CrossRef]
- Cui, X.S.; Li, H.Z.; Li, L.; Liang, Q.; Zhao, Q.; Wei, G.; Shi, J.; Li, X. Rodent model of metabolic dysfunction-associated fatty liver disease: A systematic review. J. Gastroenterol. Hepatol. 2024. [Google Scholar] [CrossRef]
- Lee, Y.H.; Kim, S.H.; Kim, S.N.; Kwon, H.J.; Kim, J.D.; Oh, J.Y.; Jung, Y.S. Sex-specific metabolic interactions between liver and adipose tissue in MCD diet-induced non-alcoholic fatty liver disease. Oncotarget 2016, 7, 46959–46971. [Google Scholar] [CrossRef]
- Lee, C.; Kim, J.; Han, J.; Oh, D.; Kim, M.; Jeong, H.; Kim, T.J.; Kim, S.W.; Kim, J.N.; Seo, Y.S.; et al. Formyl peptide receptor 2 determines sex-specific differences in the progression of nonalcoholic fatty liver disease and steatohepatitis. Nat. Commun. 2022, 13, 578. [Google Scholar] [CrossRef] [PubMed]







| ALT (U/L) | AST (U/L) | MDA (nmol/mg) | TG (nmol/mg) | |
|---|---|---|---|---|
| MCS | 11.83 ± 2.25 | 24.78 ± 5.67 | 0.73 ± 0.29 | 0.19 ± 0.10 |
| MCD (vs. MCS) | 149.46 ± 60.56 (p = 0.0026) | 53.05 ± 13.44 (p = 0.0008) | 6.58 ± 2.40 (p = 0.0018) | 0.85 ± 0.23 (p = 0.00014) |
| THC (vs. MCD) | 74.26 ± 13.90 (p = 0.0278) | 35.83 ± 15.28 (p = 0.0452) | 2.96 ± 1.56 (p = 0.0007) | 0.50 ± 0.26 (p = 0.021) |
| OCA (vs. MCD) | 104.45 ± 28.29 (p = 0.0993) | 37.65 ± 11.74 (p = 0.0452) | 3.64 ± 1.91 (p = 0.041) | 0.57 ± 0.20 (p = 0.044) |
| Group | Chao1 | ACE | Shannon | Simpson |
|---|---|---|---|---|
| MCS | 213.73 ± 34.51 | 216.44 ± 34.48 | 2.88 ± 0.58 | 0.73 ± 0.12 |
| MCD | 168.32 ± 17.25 * | 173.48 ± 15.91 * | 2.56 ± 0.28 | 0.70 ± 0.09 |
| THC | 460.26 ± 100.89 # | 466.59 ± 104.83 # | 3.58 ± 0.70 # | 0.74 ± 0.10 |
| Class | MCS/ng·mL−1 | MCD/ng·mL−1 | THC/ng·mL−1 |
|---|---|---|---|
| 23-DCA | 24.85 ± 18.84 | 308.11 ± 125.62 ** | 164.36 ± 100.07 # |
| β-MCA | 821.92 ± 815.48 | 2433.77 ± 1484.48 * | 1172.55 ± 480.97 |
| ω-MCA | 1747.67 ± 1192.60 | 4581.38 ± 2654.89 * | 1952.00 ± 1331.20 |
| 7-KDCA | 894.78 ± 818.95 | 3167.95 ± 1981.42 * | 1981.42 ± 454.07 # |
| UCA | 15.79 ± 9.17 | 96.60 ± 61.64 * | 28.16 ± 17.01 # |
| CA | 1447.63 ± 1373.38 | 2086.49 ± 982.95 | 1011.29 ± 447.23 # |
| HDCA | 55.26 ± 47.95 | 50.10 ± 11.03 | 26.55 ± 15.15 ## |
| TDCA | 401.30 ± 374.15 | 285.09 ± 80.5 | 188.67 ± 42.26 # |
| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| β-actin | AACCGTGAAAAGATGACCCAGAT | CACAGCCTGGATGGCTACGTA |
| Cyp7a1 | GGGAATGCCATTTACTTGGA | GTCCGGATATTCAAGGATGC |
| Cyp27a1 | CTATGTGCTGCACTTGCCC | GGGCACTAGCCAGATTCACA |
| Mrp2 | TCCAGGACCAAGAGATTTGC | TCTGTGAGTGCAAGAGACAGGT |
| Bsep | CCAGAACATGACAAACGGAA | AAGGACAGCCACACCAACTC |
| Ntcp | AGGGGGACATGAACCTCAG | TCCGTCGTAGATTCCTTTGC |
| Oatp1b2 | ACCAAACTCAGCATCCAAGC | TAGCTGAATGAGAGGGCTGC |
| Srebp1c | CACTTCTGGAGACATCGCAAAC | TGGTAGACAACAGCCGCATC |
| Fas | GGCACCTATGGCGAGGACTT | GCCCTCCCGTACACTCACTC |
| Scd1 | TACTACAAGCCCGGCCTCC | CAGCAGTACCAGGGCACCA |
| Acc1 | GGCAGCAGTTACACCACATAC | TCATTACCTCAATCTCAGCATAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, S.; Meng, M.; Luo, P.; Liu, J.; Wang, J.; Chen, Y. Tetrahydrocurcumin Alleviates Metabolic Dysfunction-Associated Steatohepatitis in Mice by Regulating Serum Lipids, Bile Acids, and Gut Microbiota. Int. J. Mol. Sci. 2025, 26, 895. https://doi.org/10.3390/ijms26030895
Peng S, Meng M, Luo P, Liu J, Wang J, Chen Y. Tetrahydrocurcumin Alleviates Metabolic Dysfunction-Associated Steatohepatitis in Mice by Regulating Serum Lipids, Bile Acids, and Gut Microbiota. International Journal of Molecular Sciences. 2025; 26(3):895. https://doi.org/10.3390/ijms26030895
Chicago/Turabian StylePeng, Shang, Moran Meng, Ping Luo, Jiao Liu, Junjun Wang, and Yong Chen. 2025. "Tetrahydrocurcumin Alleviates Metabolic Dysfunction-Associated Steatohepatitis in Mice by Regulating Serum Lipids, Bile Acids, and Gut Microbiota" International Journal of Molecular Sciences 26, no. 3: 895. https://doi.org/10.3390/ijms26030895
APA StylePeng, S., Meng, M., Luo, P., Liu, J., Wang, J., & Chen, Y. (2025). Tetrahydrocurcumin Alleviates Metabolic Dysfunction-Associated Steatohepatitis in Mice by Regulating Serum Lipids, Bile Acids, and Gut Microbiota. International Journal of Molecular Sciences, 26(3), 895. https://doi.org/10.3390/ijms26030895
