Cellular and Molecular Evidence of the Synergistic Antitumour Effects of Hydroxytyrosol and Metformin in Prostate Cancer
Abstract
1. Introduction
2. Results
2.1. Synergic Effect of Hydroxytyrosol and Metformin in Prostate Cancer Cell Models
2.2. Hydroxytyrosol and Metformin Synergistically Reduce Aggressiveness Parameters of Prostate Cancer Cells
2.3. Combination of Hydroxytyrosol and Metformin Altered Relevant Molecular Pathways in Prostate Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Cell Cultures and Reagents
4.2. Synergy Assay Design and Analysis
4.3. Cell Proliferation, Migration, and Tumoursphere Growth Assays
4.4. Flow Cytometry (Apoptosis and Cell Cycle Assays)
4.5. Phosphorylation Array
4.6. RNA Isolation, Retrotranscription, qPCR, and AR-Activity Calculation
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| PCa | Prostate cancer |
| EVOO | Extra virgin olive oil |
| HT | Hydroxytyrosol |
| Met | Metformin |
| HT + Met | Combination of hydroxytyrosol and metformin |
| CRPC | Castration-Resistant Prostate Cancer |
Appendix A
| Drugs Dose Combination | LNCaP | 22Rv1 | DU 145 | PC-3 | |||||
|---|---|---|---|---|---|---|---|---|---|
| Hydroxytyrosol (µM) | Metformin (mM) | Adjusted p Value | Summary | Adjusted p Value | Summary | Adjusted p Value | Summary | Adjusted p Value | Summary |
| 0 | 0.5 | 0.9996 | ns | 0.8065 | ns | >0.9999 | ns | 0.0042 | ** |
| 0 | 1 | 0.9877 | ns | 0.9400 | ns | >0.9999 | ns | 0.9996 | ns |
| 0 | 2.5 | 0.9996 | ns | 0.6923 | ns | 0.8925 | ns | 0.6425 | ns |
| 0 | 5 | <0.0001 | **** | 0.9991 | ns | 0.4907 | ns | 0.9863 | ns |
| 3 | 0 | 0.7956 | ns | 0.8360 | ns | >0.9999 | ns | 0.0088 | ** |
| 3 | 0.5 | 0.8337 | ns | 0.1204 | ns | 0.9993 | ns | 0.0381 | * |
| 3 | 1 | 0.3196 | ns | 0.4763 | ns | 0.9992 | ns | 0.0025 | ** |
| 3 | 2.5 | 0.0167 | * | 0.0839 | ns | 0.9521 | ns | 0.0215 | * |
| 3 | 5 | <0.0001 | **** | 0.9996 | ns | 0.9990 | ns | <0.0001 | **** |
| 10 | 0 | 0.9274 | ns | 0.9998 | ns | 0.9871 | ns | 0.9228 | ns |
| 10 | 0.5 | 0.9998 | ns | 0.9952 | ns | 0.9997 | ns | 0.0019 | ** |
| 10 | 1 | 0.9941 | ns | 0.9944 | ns | 0.9990 | ns | 0.0001 | *** |
| 10 | 2.5 | 0.0051 | ** | 0.7021 | ns | 0.9996 | ns | 0.7973 | ns |
| 10 | 5 | <0.0001 | **** | 0.9342 | ns | 0.5193 | ns | 0.1046 | ns |
| 30 | 0 | 0.0192 | * | 0.0054 | ** | 0.9996 | ns | 0.0051 | ** |
| 30 | 0.5 | 0.1979 | ns | 0.0023 | ** | >0.9999 | ns | <0.0001 | **** |
| 30 | 1 | 0.1942 | ns | 0.0016 | ** | >0.9999 | ns | <0.0001 | **** |
| 30 | 2.5 | 0.1976 | ns | 0.9996 | ns | 0.9614 | ns | <0.0001 | **** |
| 30 | 5 | <0.0001 | **** | 0.0379 | * | 0.7128 | ns | <0.0001 | **** |
| 100 | 0 | <0.0001 | **** | <0.0001 | **** | 0.0126 | * | 0.0005 | *** |
| 100 | 0.5 | <0.0001 | **** | <0.0001 | **** | 0.5459 | ns | <0.0001 | **** |
| 100 | 1 | <0.0001 | **** | <0.0001 | **** | 0.1556 | ns | <0.0001 | **** |
| 100 | 2.5 | <0.0001 | **** | <0.0001 | **** | 0.0021 | ** | <0.0001 | **** |
| 100 | 5 | <0.0001 | **** | <0.0001 | **** | <0.0001 | **** | <0.0001 | **** |
| Gene | Ensembl Ref | Sense Primer Sequence | Antisense Primer Sequence | Product Size (bp) |
|---|---|---|---|---|
| ACTB | ENSG00000075624 | ACTCTTCCAGCCTTCCTTCC | CAGTGATCTCCTTCTGCATC | 176 |
| GAPDH | ENSG00000111640 | GCCTCAAGATCATCAGCAATG | CTTCCACGATACCAAAGTTGT | 90 |
| AR | ENSG00000169083 | GCAGGAAGCAGTATCCGAAG | GTTGTCAGAAATGGTCGAAGTG | 112 |
| ACSL3 | ENSG00000123983 | TTCCAGAACTAGGAGAGGAAGATG | CATCCGTGAGAAAGACAGACAA | 97 |
| FKBP5 | ENSG00000096060 | CGGAGAACCAAACGGAAA | TCAAACATCCTTCCACCACA | 98 |
| KLK2 | ENSG00000167751 | TGATTCTGGGGGTCCACTT | GTACACAGCAGGCTTTTCAGG | 97 |
| KLK3 | ENSG00000142515 | AGAGGAGTTCTTGACCCCAAA | CCTTCTGAGGGTGAACTTGC | 89 |
| NKX3-1 | ENSG00000167034 | TCAGGTGATCGAGTTGGAGAG | TCCGTGAGCTTGAGGTTCTT | 93 |
| PLPP1 | ENSG00000067113 | CCTCACTTCTTGGATGTTTGTG | GACAACCTGCCTTCCTTAACTCT | 116 |
| RAB3B | ENSG00000169213 | TCCTCTTCCGCTATGCTGAT | AGTTTCACCCGCTTCTCGT | 106 |
| STEAP1 | ENSG00000164647 | TGGCAATACTGGCTCTGTTG | GGGAAACAATTCCTAGCTTGC | 105 |
References
- Bray, F.; Laversanne, M.; Sung, H.; Ferlay, J.; Siegel, R.L.; Soerjomataram, I.; Jemal, A. Global Cancer Statistics 2022: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2024, 74, 229–263. [Google Scholar] [CrossRef] [PubMed]
- Mukherji, D.; Omlin, A.; Pezaro, C.; Shamseddine, A.; de Bono, J. Metastatic Castration-Resistant Prostate Cancer (CRPC): Preclinical and Clinical Evidence for the Sequential Use of Novel Therapeutics. Cancer Metastasis Rev. 2014, 33, 555–566. [Google Scholar] [CrossRef] [PubMed]
- Tyson, M.D.; Penson, D.F.; Resnick, M.J. The Comparative Oncologic Effectiveness of Available Management Strategies for Clinically Localized Prostate Cancer. Urol. Oncol. 2017, 35, 51–58. [Google Scholar] [CrossRef]
- Pushpakom, S.; Iorio, F.; Eyers, P.A.; Escott, K.J.; Hopper, S.; Wells, A.; Doig, A.; Guilliams, T.; Latimer, J.; McNamee, C.; et al. Drug Repurposing: Progress, Challenges and Recommendations. Nat. Rev. Drug Discov. 2019, 18, 41–58. [Google Scholar] [CrossRef]
- Polesel, J.; Gini, A.; Dal Maso, L.; Stocco, C.; Birri, S.; Taborelli, M.; Serraino, D.; Zucchetto, A. The Impact of Diabetes and Other Metabolic Disorders on Prostate Cancer Prognosis. J. Diabetes Complicat. 2016, 30, 591–596. [Google Scholar] [CrossRef] [PubMed]
- Maj-Hes, A.B.; Mathieu, R.; Özsoy, M.; Soria, F.; Moschini, M.; Abufaraj, M.; Briganti, A.; Roupret, M.; Karakiewicz, P.I.; Klatte, T.; et al. Obesity Is Associated with Biochemical Recurrence after Radical Prostatectomy: A Multi-Institutional Extended Validation Study. Urol. Oncol. Semin. Orig. Investig. 2017, 35, e1–e460. [Google Scholar] [CrossRef]
- Jamnagerwalla, J.; Howard, L.E.; Allott, E.H.; Vidal, A.C.; Moreira, D.M.; Castro-Santamaria, R.; Andriole, G.L.; Freeman, M.R.; Freedland, S.J. Serum Cholesterol and Risk of High-Grade Prostate Cancer: Results from the REDUCE Study. Prostate Cancer Prostatic Dis. 2018, 21, 252–259. [Google Scholar] [CrossRef] [PubMed]
- Fuentes-Fayos, A.C.; G-García, M.E.; Pérez-Gómez, J.M.; Montero-Hidalgo, A.J.; Martín-Colom, J.; Doval-Rosa, C.; Blanco-Acevedo, C.; Torres, E.; Toledano-Delgado, Á.; Sánchez-Sánchez, R.; et al. Metformin and Simvastatin Exert Additive Antitumour Effects in Glioblastoma via Senescence-State: Clinical and Translational Evidence. EBioMedicine 2023, 90, 104484. [Google Scholar] [CrossRef]
- Vázquez-Borrego, M.C.; Fuentes-Fayos, A.C.; Herrera-Martínez, A.D.; Venegas-Moreno, E.; L-López, F.; Fanciulli, A.; Moreno-Moreno, P.; Alhambra-Expósito, M.R.; Barrera-Martín, A.; Dios, E.; et al. Statins Directly Regulate Pituitary Cell Function and Exert Antitumor Effects in Pituitary Tumors. Neuroendocrinology 2020, 110, 1028–1041. [Google Scholar] [CrossRef] [PubMed]
- Vázquez-Borrego, M.C.; Fuentes-Fayos, A.C.; Herrera-Martínez, A.D.; L-López, F.; Ibáñez-Costa, A.; Moreno-Moreno, P.; Alhambra-Expósito, M.R.; Barrera-Martín, A.; Blanco-Acevedo, C.; Dios, E.; et al. Biguanides Exert Antitumoral Actions in Pituitary Tumor Cells Through AMPK-Dependent and -Independent Mechanisms. J. Clin. Endocrinol. Metab. 2019, 104, 3501–3513. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Vacas, J.M.; Herrero-Aguayo, V.; Montero-Hidalgo, A.J.; Sáez-Martínez, P.; Gómez-Gómez, E.; León-González, A.J.; Fuentes-Fayos, A.C.; Yubero-Serrano, E.M.; Requena-Tapia, M.J.; López, M.; et al. Clinical, Cellular, and Molecular Evidence of the Additive Antitumor Effects of Biguanides and Statins in Prostate Cancer. J. Clin. Endocrinol. Metab. 2021, 106, E696–E710. [Google Scholar] [CrossRef] [PubMed]
- Herrera-Martínez, A.D.; Pedraza-Arevalo, S.; L-López, F.; Gahete, M.D.; Gálvez-Moreno, M.A.; Castaño, J.P.; Luque, R.M. Type 2 Diabetes in Neuroendocrine Tumors: Are Biguanides and Statins Part of the Solution? J. Clin. Endocrinol. Metab. 2019, 104, 57–73. [Google Scholar] [CrossRef]
- León-González, A.J.; Jiménez-Vacas, J.M.; Fuentes-Fayos, A.C.; Sarmento-Cabral, A.; Herrera-Martínez, A.D.; Gahete, M.D.; Luque, R.M. Role of Metformin and Other Metabolic Drugs in the Prevention and Therapy of Endocrine-Related Cancers. Curr. Opin. Pharmacol. 2021, 60, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Spratt, D.E.; Zhang, C.; Zumsteg, Z.S.; Pei, X.; Zhang, Z.; Zelefsky, M.J. Metformin and Prostate Cancer: Reduced Development of Castration-Resistant Disease and Prostate Cancer Mortality. Eur. Urol. 2013, 63, 709–716. [Google Scholar] [CrossRef] [PubMed]
- Hua, Y.; Zheng, Y.; Yao, Y.; Jia, R.; Ge, S.; Zhuang, A. Metformin and Cancer Hallmarks: Shedding New Lights on Therapeutic Repurposing. J. Transl. Med. 2023, 21, 403. [Google Scholar] [CrossRef] [PubMed]
- Sarmento-Cabral, A.; L-López, F.; Gahete, M.D.; Castaño, J.P.; Luque, R.M. Metformin Reduces Prostate Tumor Growth, in a Diet-Dependent Manner, by Modulating Multiple Signaling Pathways. Mol. Cancer Res. 2017, 15, 862–874. [Google Scholar] [CrossRef]
- Aboelnaga, E.M.; Aboelnaga, M.M.; Elkalla, H.M. Metformin Addition to Androgen Deprivation Therapy Effect on Cancer Prostate Patients with Type 2 Diabetes. Diabetes Metab. Syndr. 2021, 15, 102251. [Google Scholar] [CrossRef]
- Mahalingam, D.; Hanni, S.; Serritella, A.V.; Fountzilas, C.; Michalek, J.; Hernandez, B.; Sarantopoulos, J.; Datta, P.; Romero, O.; Pillai, S.M.A.; et al. Utilizing Metformin to Prevent Metabolic Syndrome Due to Androgen Deprivation Therapy (ADT): A Randomized Phase II Study of Metformin in Non-Diabetic Men Initiating ADT for Advanced Prostate Cancer. Oncotarget 2023, 14, 622–636. [Google Scholar] [CrossRef] [PubMed]
- GBD 2015 Obesity Collaborators. Health Effects of Overweight and Obesity in 195 Countries over 25 Years. N. Engl. J. Med. 2017, 377, 13–27. [Google Scholar] [CrossRef]
- López-Guarnido, O.; Urquiza-Salvat, N.; Saiz, M.; Lozano-Paniagua, D.; Rodrigo, L.; Pascual-Geler, M.; Lorente, J.A.; Alvarez-Cubero, M.J.; Rivas, A. Bioactive Compounds of the Mediterranean Diet and Prostate Cancer. Aging Male 2018, 21, 251–260. [Google Scholar] [CrossRef] [PubMed]
- Celano, M.; Maggisano, V.; Lepore, S.M.; Russo, D.; Bulotta, S. Secoiridoids of Olive and Derivatives as Potential Coadjuvant Drugs in Cancer: A Critical Analysis of Experimental Studies. Pharmacol. Res. 2019, 142, 77–86. [Google Scholar] [CrossRef]
- Cruz-Lozano, M.; González-González, A.; Marchal, J.A.; Muñoz-Muela, E.; Molina, M.P.; Cara, F.E.; Brown, A.M.; García-Rivas, G.; Hernández-Brenes, C.; Lorente, J.A.; et al. Hydroxytyrosol Inhibits Cancer Stem Cells and the Metastatic Capacity of Triple-Negative Breast Cancer Cell Lines by the Simultaneous Targeting of Epithelial-to-Mesenchymal Transition, Wnt/β-Catenin and TGFβ Signaling Pathways. Eur. J. Nutr. 2019, 58, 3207–3219. [Google Scholar] [CrossRef] [PubMed]
- El-azem, N.; Pulido-Moran, M.; Ramirez-Tortosa, C.L.; Quiles, J.L.; Cara, F.E.; Sanchez-Rovira, P.; Granados-Principal, S.; Ramirez-Tortosa, M. Modulation by Hydroxytyrosol of Oxidative Stress and Antitumor Activities of Paclitaxel in Breast Cancer. Eur. J. Nutr. 2019, 58, 1203–1211. [Google Scholar] [CrossRef] [PubMed]
- Costantini, F.; Di Sano, C.; Barbieri, G. The Hydroxytyrosol Induces the Death for Apoptosis of Human Melanoma Cells. Int. J. Mol. Sci. 2020, 21, 8074. [Google Scholar] [CrossRef] [PubMed]
- Castejón, M.L.; Montoya, T.; Alarcón-de-la-lastra, C.; Sánchez-hidalgo, M. Potential Protective Role Exerted by Secoiridoids from Olea europaea L. in Cancer, Cardiovascular, Neurodegenerative, Aging-Related, and Immunoinflammatory Diseases. Antioxidants 2020, 9, 149. [Google Scholar] [CrossRef]
- Vilaplana-Pérez, C.; Auñón, D.; García-Flores, L.A.; Gil-Izquierdo, A. Hydroxytyrosol and Potential Uses in Cardiovascular Diseases, Cancer, and AIDS. Front. Nutr. 2014, 1, 18. [Google Scholar] [CrossRef]
- Sani, N.S.; Onsori, H.; Akrami, S.; Rahmati, M. A Comparison of the Anti-Cancer Effects of Free and PLGA-PAA Encapsulated Hydroxytyrosol on the HT-29 Colorectal Cancer Cell Line. Anticancer Agents Med. Chem. 2022, 22, 390–394. [Google Scholar] [CrossRef]
- León-González, A.J.; Sáez-Martínez, P.; Jiménez-Vacas, J.M.; Herrero-Aguayo, V.; Montero-Hidalgo, A.J.; Gómez-Gómez, E.; Madrona, A.; Castaño, J.P.; Espartero, J.L.; Gahete, M.D.; et al. Comparative Cytotoxic Activity of Hydroxytyrosol and Its Semisynthetic Lipophilic Derivatives in Prostate Cancer Cells. Antioxidants 2021, 10, 1348. [Google Scholar] [CrossRef]
- Ibrahim, R.S.; Ibrahim, S.S.; El-Naas, A.; Koklesová, L.; Kubatka, P.; Büsselberg, D. Could Metformin and Resveratrol Support Glioblastoma Treatment? A Mechanistic View at the Cellular Level. Cancers 2023, 15, 3368. [Google Scholar] [CrossRef]
- Ianevski, A.; Giri, A.K.; Aittokallio, T. SynergyFinder 2.0: Visual Analytics of Multi-Drug Combination Synergies. Nucleic Acids Res. 2020, 48, W488–W493. [Google Scholar] [CrossRef] [PubMed]
- Spratt, D.E.; Alshalalfa, M.; Fishbane, N.; Weiner, A.B.; Mehra, R.; Mahal, B.A.; Lehrer, J.; Liu, Y.; Zhao, S.G.; Speers, C.; et al. Transcriptomic Heterogeneity of Androgen Receptor Activity Defines a de Novo Low AR-Active Subclass in Treatment Naïve Primary Prostate Cancer. Clin. Cancer Res. 2019, 25, 6721–6730. [Google Scholar] [CrossRef] [PubMed]
- Libero, M.L.; Montero-Hidalgo, A.J.; Recinella, L.; Luque, R.M.; Generali, D.; Acquaviva, A.; Orlando, G.; Ferrante, C.; Menghini, L.; Di Simone, S.C.; et al. The Protective Effects of an Aged Black Garlic Water Extract on the Prostate. Nutrients 2024, 16, 3025. [Google Scholar] [CrossRef] [PubMed]
- Libero, M.L.; Lucarini, E.; Recinella, L.; Ciampi, C.; Veschi, S.; Piro, A.; Chiavaroli, A.; Acquaviva, A.; Nilofar, N.; Orlando, G.; et al. Anti-inflammatory and Anti-hyperalgesic Effects Induced by an Aqueous Aged Black Garlic Extract in Rodent Models of Ulcerative Colitis and Colitis-associated Visceral Pain. Phytother. Res. 2024, 38, 4177–4188. [Google Scholar] [CrossRef] [PubMed]
- Abate-Shen, C.; Nunes de Almeida, F. Establishment of the LNCaP Cell Line–The Dawn of an Era for Prostate Cancer Research. Cancer Res. 2022, 82, 1689–1691. [Google Scholar] [CrossRef]
- van Bokhoven, A.; Varella-Garcia, M.; Korch, C.; Johannes, W.U.; Smith, E.E.; Miller, H.L.; Nordeen, S.K.; Miller, G.J.; Lucia, M.S. Molecular Characterization of Human Prostate Carcinoma Cell Lines. Prostate 2003, 57, 205–225. [Google Scholar] [CrossRef]
- Wang, Y.; Li, J.; Xia, L. Plant-Derived Natural Products and Combination Therapy in Liver Cancer. Front. Oncol. 2023, 13, 1116532. [Google Scholar] [CrossRef] [PubMed]
- Martínez, N.; Herrera, M.; Frías, L.; Provencio, M.; Pérez-Carrión, R.; Díaz, V.; Morse, M.; Crespo, M.C. A Combination of Hydroxytyrosol, Omega-3 Fatty Acids and Curcumin Improves Pain and Inflammation among Early Stage Breast Cancer Patients Receiving Adjuvant Hormonal Therapy: Results of a Pilot Study. Clin. Transl. Oncol. 2019, 21, 489–498. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Cwiklinski, K.; Mahajan, S.D.; Schwartz, S.A.; Aalinkeel, R. Combination Modality Using Quercetin to Enhance the Efficacy of Docetaxel in Prostate Cancer Cells. Cancers 2023, 15, 902. [Google Scholar] [CrossRef] [PubMed]
- Haghshenas, M.; Firouzabadi, N.; Akbarizadeh, A.R.; Rashedinia, M. Combination of Metformin and Gallic Acid Induces Autophagy and Apoptosis in Human Breast Cancer Cells. Res. Pharm. Sci. 2023, 18, 663–675. [Google Scholar] [CrossRef] [PubMed]
- Das, D.; Kanchan, M.; Mitra, A.; Zaky, M.Y.; Pathak, S.; Banerjee, A. A Review on the Efficacy of Plant-Derived Bio-Active Compounds Curcumin and Aged Garlic Extract in Modulating Cancer and Age-Related Diseases. Curr. Rev. Clin. Exp. Pharmacol. 2024, 19, 146–162. [Google Scholar] [CrossRef]
- Adewale, O.O.; Wińska, P.; Piasek, A.; Cieśla, J. The Potential of Plant Polysaccharides and Chemotherapeutic Drug Combinations in the Suppression of Breast Cancer. Int. J. Mol. Sci. 2024, 25, 12202. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Yang, K.; Ren, Z.; Yin, D.; Zhou, Y. Metformin as Anticancer Agent and Adjuvant in Cancer Combination Therapy: Current Progress and Future Prospect. Transl. Oncol. 2024, 44, 101945. [Google Scholar] [CrossRef]
- Westaby, D.; Jimenez-Vacas, J.M.; Padilha, A.; Varkaris, A.; Balk, S.P.; de Bono, J.S.; Sharp, A. Targeting the Intrinsic Apoptosis Pathway: A Window of Opportunity for Prostate Cancer. Cancers 2021, 14, 51. [Google Scholar] [CrossRef] [PubMed]
- Fatehi, R.; Rashedinia, M.; Akbarizadeh, A.R.; Zamani, M.; Firouzabadi, N. Metformin Enhances Anti-Cancer Properties of Resveratrol in MCF-7 Breast Cancer Cells via Induction of Apoptosis, Autophagy and Alteration in Cell Cycle Distribution. Biochem. Biophys. Res. Commun. 2023, 644, 130–139. [Google Scholar] [CrossRef]
- Cheng, T.; Wang, C.; Lu, Q.; Cao, Y.; Yu, W.; Li, W.; Liu, B.; Gao, X.; Lü, J.; Pan, X. Metformin Inhibits the Tumor-Promoting Effect of Low-Dose Resveratrol, and Enhances the Anti-Tumor Activity of High-Dose Resveratrol by Increasing Its Reducibility in Triple Negative Breast Cancer. Free Radic. Biol. Med. 2022, 180, 108–120. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Zhang, Q.; Wang, X.; Kang, L.; Yang, Y.; Liu, Y.; Yang, L.; Li, J.; Yang, L.; Liu, J.; et al. Metformin Potentiates Anti-Tumor Effect of Resveratrol on Pancreatic Cancer by down-Regulation of VEGF-B Signaling Pathway. Oncotarget 2016, 7, 84190–84200. [Google Scholar] [CrossRef] [PubMed]
- Eslami, S.S.; Jafari, D.; Montazeri, H.; Sadeghizadeh, M.; Tarighi, P. Combination of Curcumin and Metformin Inhibits Cell Growth and Induces Apoptosis without Affecting the Cell Cycle in LNCaP Prostate Cancer Cell Line. Nutr. Cancer 2021, 73, 1026–1039. [Google Scholar] [CrossRef] [PubMed]
- El-Haibi, C.P.; Singh, R.; Sharma, P.K.; Singh, S.; Lillard, J.W. CXCL13 Mediates Prostate Cancer Cell Proliferation through JNK Signalling and Invasion through ERK Activation. Cell Prolif. 2011, 44, 311–319. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Zhang, Z.; Hu, H. Prostate Cancer Growth Inhibition by 1-(3,5-Dimethylphenyl)–6-Methyl-1H-Pyrazolo [4,3-c]Pyridin-4(5H)-One via Down-Regulation of Phosphorylation PI3K/AKT and STA3/JAK2. Dokl. Biochem. Biophys. 2020, 495, 347–353. [Google Scholar] [CrossRef] [PubMed]
- McCubrey, J.A.; Steelman, L.S.; Chappell, W.H.; Abrams, S.L.; Wong, E.W.T.; Chang, F.; Lehmann, B.; Terrian, D.M.; Milella, M.; Tafuri, A.; et al. Roles of the Raf/MEK/ERK Pathway in Cell Growth, Malignant Transformation and Drug Resistance. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2007, 1773, 1263–1284. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Lu, S.; Li, T.; Yu, L.; Zhang, Y.; Zeng, H.; Qian, X.; Bi, J.; Lin, Y. ACE2 Inhibits Breast Cancer Angiogenesis via Suppressing the VEGFa/VEGFR2/ERK Pathway. J. Exp. Clin. Cancer Res. 2019, 38, 173. [Google Scholar] [CrossRef] [PubMed]
- Zou, F.; Rao, T.; Chen, W.; Song, T.; Li, T.; Hu, W.; Li, L.; Yu, W.; Cheng, F. DUSP2 Affects Bladder Cancer Prognosis by Down-Regulating MEK/ERK and P38 MAPK Signaling Pathways through PTPN7. Cell. Signal. 2023, 112, 110893. [Google Scholar] [CrossRef] [PubMed]
- Laplante, M.; Sabatini, D.M. MTOR Signaling in Growth Control and Disease. Cell 2012, 149, 274–293. [Google Scholar] [CrossRef] [PubMed]
- Roux, P.P.; Blenis, J. ERK and P38 MAPK-Activated Protein Kinases: A Family of Protein Kinases with Diverse Biological Functions. Microbiol. Mol. Biol. Rev. 2004, 68, 320–344. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Wang, K.; Ma, Q. The Expression and Significance of P4E-BP1/4E-BP1 in Prostate Cancer. J. Clin. Lab. Anal. 2022, 36, e24332. [Google Scholar] [CrossRef]
- Ding, M.; Van der Kwast, T.H.; Vellanki, R.N.; Foltz, W.D.; McKee, T.D.; Sonenberg, N.; Pandolfi, P.P.; Koritzinsky, M.; Wouters, B.G. The MTOR Targets 4E-BP1/2 Restrain Tumor Growth and Promote Hypoxia Tolerance in PTEN-Driven Prostate Cancer. Mol. Cancer Res. 2018, 16, 682–695. [Google Scholar] [CrossRef]
- Tenesa, A.; Theodoratou, E.; Din, F.V.N.; Farrington, S.M.; Cetnarskyj, R.; Barnetson, R.A.; Porteous, M.E.; Campbell, H.; Dunlop, M.G. Ten Common Genetic Variants Associated with Colorectal Cancer Risk Are Not Associated with Survival after Diagnosis. Clin. Cancer Res. 2010, 16, 3754–3759. [Google Scholar] [CrossRef]
- Edwards, J.; Krishna, N.S.; Mukherjee, R.; Bartlett, J.M.S. The Role of C-Jun and c-Fos Expression in Androgen-Independent Prostate Cancer. J. Pathol. 2004, 204, 153–158. [Google Scholar] [CrossRef]
- Thakur, N.; Hamidi, A.; Song, J.; Itoh, S.; Bergh, A.; Heldin, C.H.; Landström, M. Smad7 Enhances TGF-β-Induced Transcription of c-Jun and HDAC6 Promoting Invasion of Prostate Cancer Cells. iScience 2020, 23, 101470. [Google Scholar] [CrossRef] [PubMed]
- Thakur, N.; Gudey, S.K.; Marcusson, A.; Fu, J.Y.; Bergh, A.; Heldin, C.-H.; Landström, M. TGFβ-Induced Invasion of Prostate Cancer Cells Is Promoted by c-Jun-Dependent Transcriptional Activation of Snail1. Cell Cycle 2014, 13, 2400–2414. [Google Scholar] [CrossRef]
- Ma, J.; Chang, K.; Peng, J.; Shi, Q.; Gan, H.; Gao, K.; Feng, K.; Xu, F.; Zhang, H.; Dai, B.; et al. SPOP Promotes ATF2 Ubiquitination and Degradation to Suppress Prostate Cancer Progression. J. Exp. Clin. Cancer Res. 2018, 37, 145. [Google Scholar] [CrossRef] [PubMed]
- Pencik, J.; Philippe, C.; Schlederer, M.; Atas, E.; Pecoraro, M.; Grund-Gröschke, S.; Li, W.; Tracz, A.; Heidegger, I.; Lagger, S.; et al. STAT3/LKB1 Controls Metastatic Prostate Cancer by Regulating MTORC1/CREB Pathway. Mol. Cancer 2023, 22, 133. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, G.; Tong, D.; Parmar, H.; Hasenmayer, D.; Yuan, W.; Zhang, D.; Jiang, J. Metformin Represses Androgen-dependent and Androgen-independent Prostate Cancers by Targeting Androgen Receptor. Prostate 2015, 75, 1187–1196. [Google Scholar] [CrossRef] [PubMed]
- Herrero-Aguayo, V.; Jiménez-Vacas, J.M.; Sáez-Martínez, P.; Gómez-Gómez, E.; López-Cánovas, J.L.; Garrido-Sánchez, L.; Herrera-Martínez, A.D.; García-Bermejo, L.; MacÍas-González, M.; López-Miranda, J.; et al. Influence of Obesity in the MiRNome: MiR-4454, a Key Regulator of Insulin Response Via Splicing Modulation in Prostate. J. Clin. Endocrinol. Metab. 2021, 106, E469–E484. [Google Scholar] [CrossRef]
- Goldoni, M.; Johansson, C. A Mathematical Approach to Study Combined Effects of Toxicants in Vitro: Evaluation of the Bliss Independence Criterion and the Loewe Additivity Model. Toxicol. Vitr. 2007, 21, 759–769. [Google Scholar] [CrossRef]
- Montero-Hidalgo, A.J.; Jiménez-Vacas, J.M.; Gómez-Gómez, E.; Porcel-Pastrana, F.; Sáez-Martínez, P.; Pérez-Gómez, J.M.; Fuentes-Fayos, A.C.; Blázquez-Encinas, R.; Sánchez-Sánchez, R.; González-Serrano, T.; et al. SRSF6 Modulates Histone-Chaperone HIRA Splicing to Orchestrate AR and E2F Activity in Prostate Cancer. Sci. Adv. 2024, 10, eado8231. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Vacas, J.M.; Montero-Hidalgo, A.J.; Gómez-Gómez, E.; Sáez-Martínez, P.; Fuentes-Fayos, A.C.; Closa, A.; González-Serrano, T.; Martínez-López, A.; Sánchez-Sánchez, R.; López-Casas, P.P.; et al. Tumor Suppressor Role of RBM22 in Prostate Cancer Acting as a Dual-Factor Regulating Alternative Splicing and Transcription of Key Oncogenic Genes. Transl. Res. 2023, 253, 68–79. [Google Scholar] [CrossRef]
- Rueden, C.T.; Schindelin, J.; Hiner, M.C.; Dezonia, B.E.; Walter, A.E.; Arena, E.T.; Eliceiri, K.W. ImageJ2: ImageJ for the next Generation of Scientific Image Data. BMC Bioinform. 2017, 18, 529. [Google Scholar] [CrossRef]
- Watson, J.V.; Chambers, S.H.; Smith, P.J. A Pragmatic Approach to the Analysis of DNA Histograms with a Definable G1 Peak. Cytometry 1987, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed]



| SynergyFinder 2.0 Design | |||||
|---|---|---|---|---|---|
| Drug | Dose 1 | Dose 2 | Dose 3 | Dose 4 | Dose 5 |
| Metformin (mM) | 0 | 0.5 | 1 | 2.5 | 5 |
| Hydroxytyrosol (μM) | 0 | 3 | 10 | 30 | 100 |
| Individual Treatment IC50 | ||||
|---|---|---|---|---|
| Drug | LNCaP | 22Rv1 | DU-145 | PC-3 |
| Metformin (mM) | 2.313 | 4.394 | 5 | - |
| Hydroxytyrosol (μM) | 43.66 | 74.84 | 86.30 | - |
| Combinatory Synergy Index | 52.08 | 31.16 | 6.08 | 1.379 |
| Combination effect | Synergy | Synergy | Additive | Additive |
| LNCaP | 22Rv1 | DU 145 | PC-3 | |||||
|---|---|---|---|---|---|---|---|---|
| Source of Variation | Adjusted p Value | Summary | Adjusted p Value | Summary | Adjusted p Value | Summary | Adjusted p Value | Summary |
| Interaction | <0.0001 | **** | 0.0284 | * | 0.9085 | ns | 0.0016 | ** |
| Hydroxytyrosol | <0.0001 | **** | <0.0001 | **** | <0.0001 | **** | <0.0001 | **** |
| Metformin | <0.0001 | **** | <0.0001 | **** | <0.0001 | **** | 0.0386 | * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Porcel-Pastrana, F.; Montero-Hidalgo, A.J.; G-García, M.E.; Gil-Duque, I.; Prats-Escribano, A.; Gahete, M.D.; Sarmento-Cabral, A.; Luque, R.M.; León-González, A.J. Cellular and Molecular Evidence of the Synergistic Antitumour Effects of Hydroxytyrosol and Metformin in Prostate Cancer. Int. J. Mol. Sci. 2025, 26, 1341. https://doi.org/10.3390/ijms26031341
Porcel-Pastrana F, Montero-Hidalgo AJ, G-García ME, Gil-Duque I, Prats-Escribano A, Gahete MD, Sarmento-Cabral A, Luque RM, León-González AJ. Cellular and Molecular Evidence of the Synergistic Antitumour Effects of Hydroxytyrosol and Metformin in Prostate Cancer. International Journal of Molecular Sciences. 2025; 26(3):1341. https://doi.org/10.3390/ijms26031341
Chicago/Turabian StylePorcel-Pastrana, Francisco, Antonio J. Montero-Hidalgo, Miguel E. G-García, Ignacio Gil-Duque, Antonio Prats-Escribano, Manuel D. Gahete, André Sarmento-Cabral, Raúl M. Luque, and Antonio J. León-González. 2025. "Cellular and Molecular Evidence of the Synergistic Antitumour Effects of Hydroxytyrosol and Metformin in Prostate Cancer" International Journal of Molecular Sciences 26, no. 3: 1341. https://doi.org/10.3390/ijms26031341
APA StylePorcel-Pastrana, F., Montero-Hidalgo, A. J., G-García, M. E., Gil-Duque, I., Prats-Escribano, A., Gahete, M. D., Sarmento-Cabral, A., Luque, R. M., & León-González, A. J. (2025). Cellular and Molecular Evidence of the Synergistic Antitumour Effects of Hydroxytyrosol and Metformin in Prostate Cancer. International Journal of Molecular Sciences, 26(3), 1341. https://doi.org/10.3390/ijms26031341

