Roles of GacSA and DJ41_1407 in Acinetobacter baumannii ATCC 19606
Abstract
1. Introduction
2. Results
2.1. GacSA Is a TCS in A. baumannii ATCC 19606
2.2. GacSA Transcription Analysis
2.3. GacA and DJ41_1407 Are Expressed in the Same Transcript
2.4. GacA and DJ41_1407 Constitute a TCS
2.5. Transcriptome Analysis of GacA-Regulated Genes
2.6. GacA Regulates Genes Involved in Alcohol, IAA, and Phenylacetic Acid Metabolism
2.7. Possible Binding Region of GacA
2.8. GacA Regulates Bacterial Growth
2.9. GacSA Regulates Virulence
2.10. GacA Regulates Antibiotic Resistance
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Plasmids, Culture Media, and Markerless Mutation
4.2. Transcriptome Sequencing and Analysis
4.3. RNA Extraction and Reverse Transcription (RT)
4.4. Phos-Tagtm Acrylamide Gel Electrophoresis
4.5. G. mellonella Larvae Infection Assay
4.6. MIC Test
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lastoria, L.C.; Caldeira, S.M.; Moreira, R.G.; Akazawa, R.T.; Maion, J.C.; Fortaleza, C.M.C.B. Ecological competition and the incidence of Acinetobacter baumannii bloodstream infections in a teaching hospital in Southeastern Brazil. Rev. Soc. Bras. Med. Trop. 2014, 47, 583–588. [Google Scholar] [CrossRef][Green Version]
- Bergogne-Berezin, E.; Towner, K.J. Acinetobacter spp. as nosocomial pathogens: Microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev. 1996, 9, 148–165. [Google Scholar] [CrossRef] [PubMed]
- McConnell, M.J.; Actis, L.; Pachon, J. Acinetobacter baumannii: Human infections, factors contributing to pathogenesis and animal models. FEMS Microbiol. Rev. 2013, 37, 130–155. [Google Scholar] [CrossRef] [PubMed]
- Roca, I.; Espinal, P.; Vila-Farres, X.; Vila, J. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace. Front. Microbiol. 2012, 3, 148. [Google Scholar] [CrossRef] [PubMed]
- Dijkshoorn, L.; Nemec, A.; Seifert, H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat. Rev. Microbiol. 2007, 5, 939–951. [Google Scholar] [CrossRef]
- Boucher, H.W.; Talbot, G.H.; Bradley, J.S.; Edwards, J.E.; Gilbert, D.; Rice, L.B.; Scheld, M.; Spellberg, B.; Bartlett, J. Bad bugs, no drugs: No ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2009, 48, 1–12. [Google Scholar] [CrossRef]
- Espinal, P.; Marti, S.; Vila, J. Effect of biofilm formation on the survival of Acinetobacter baumannii on dry surfaces. J. Hosp. Infect. 2012, 80, 56–60. [Google Scholar] [CrossRef]
- Toh, H.Y.; Lin, G.H. Roles of DJ41_1407 and DJ41_1408 in Acinetobacter baumannii ATCC 19606 Virulence and Antibiotic Response. Int. J. Mol. Sci. 2024, 25, 3862. [Google Scholar] [CrossRef]
- Roy, S.; Chowdhury, G.; Mukhopadhyay, A.K.; Dutta, S.; Basu, S. Convergence of Biofilm Formation and Antibiotic Resistance in Acinetobacter baumannii Infection. Front. Med. 2022, 9, 793615. [Google Scholar] [CrossRef]
- Shan, W.; Kan, J.; Cai, X.; Yin, M. Insights into mucoid Acinetobacter baumannii: A review of microbiological characteristics, virulence, and pathogenic mechanisms in a threatening nosocomial pathogen. Microbiol. Res. 2022, 261, 127057. [Google Scholar] [CrossRef]
- Shu, H.Y.; Huang, Y.W.; Tsai, P.Y.; Hsieh, K.S.; Lin, G.H. Role of EmaSR in Ethanol Metabolism by Acinetobacter baumannii. Int. J. Mol. Sci. 2022, 23, 12606. [Google Scholar] [CrossRef]
- Huang, Y.W.; Shu, H.Y.; Lin, G.H. Gene Expression of Ethanol and Acetate Metabolic Pathways in the Acinetobacter baumannii EmaSR Regulon. Microorganisms 2024, 12, 331. [Google Scholar] [CrossRef]
- Dupont, C.A.; Bourigault, Y.; Biziere-Maco, H.; Boukerb, A.M.; Latour, X.; Barbey, C.; Verdon, J.; Merieau, A. The GacS/GacA two-component system strongly regulates antimicrobial competition mechanisms of Pseudomonas fluorescens MFE01 strain. J. Bacteriol. 2025, 207, e0038824. [Google Scholar] [CrossRef]
- Al-Khodor, S.; Kalachikov, S.; Morozova, I.; Price, C.T.; Abu Kwaik, Y. The PmrA/PmrB two-component system of Legionella pneumophila is a global regulator required for intracellular replication within macrophages and protozoa. Infect. Immun. 2009, 77, 374–386. [Google Scholar] [CrossRef] [PubMed]
- Lamy, M.C.; Zouine, M.; Fert, J.; Vergassola, M.; Couve, E.; Pellegrini, E.; Glaser, P.; Kunst, F.; Msadek, T.; Trieu-Cuot, P.; et al. CovS/CovR of group B streptococcus: A two-component global regulatory system involved in virulence. Mol. Microbiol. 2004, 54, 1250–1268. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Lin, K.; Liu, Y.; Zhang, H.; Lei, L. Two-component signaling pathways modulate drug resistance of Staphylococcus aureus (Review). Biomed. Rep. 2020, 13, 5. [Google Scholar]
- Kitten, T.; Kinscherf, T.G.; McEvoy, J.L.; Willis, D.K. A newly identified regulator is required for virulence and toxin production in Pseudomonas syringae. Mol. Microbiol. 1998, 28, 917–929. [Google Scholar] [CrossRef]
- Pessi, G.; Williams, F.; Hindle, Z.; Heurlier, K.; Holden, M.T.; Camara, M.; Haas, D.; Williams, P. The global posttranscriptional regulator RsmA modulates production of virulence determinants and N-acylhomoserine lactones in Pseudomonas aeruginosa. J. Bacteriol. 2001, 183, 6676–6683. [Google Scholar] [CrossRef]
- Coleman, F.T.; Mueschenborn, S.; Meluleni, G.; Ray, C.; Carey, V.J.; Vargas, S.O.; Cannon, C.L.; Ausubel, F.M.; Pier, G.B. Hypersusceptibility of cystic fibrosis mice to chronic Pseudomonas aeruginosa oropharyngeal colonization and lung infection. Proc. Natl. Acad. Sci. USA 2003, 100, 1949–1954. [Google Scholar] [CrossRef]
- Goodman, A.L.; Kulasekara, B.; Rietsch, A.; Boyd, D.; Smith, R.S.; Lory, S. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev. Cell 2004, 7, 745–754. [Google Scholar] [CrossRef]
- Ventre, I.; Goodman, A.L.; Vallet-Gely, I.; Vasseur, P.; Soscia, C.; Molin, S.; Bleves, S.; Lazdunski, A.; Lory, S.; Filloux, A. Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulatory RNA and virulence genes. Proc. Natl. Acad. Sci. USA 2006, 103, 171–176. [Google Scholar] [CrossRef]
- Goodman, A.L.; Merighi, M.; Hyodo, M.; Ventre, I.; Filloux, A.; Lory, S. Direct interaction between sensor kinase proteins mediates acute and chronic disease phenotypes in a bacterial pathogen. Genes Dev. 2009, 23, 249–259. [Google Scholar] [CrossRef]
- Brencic, A.; Lory, S. Determination of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA. Mol. Microbiol. 2009, 72, 612–632. [Google Scholar] [CrossRef]
- Wolfgang, M.C.; Lee, V.T.; Gilmore, M.E.; Lory, S. Coordinate regulation of bacterial virulence genes by a novel adenylate cyclase-dependent signaling pathway. Dev. Cell 2003, 4, 253–263. [Google Scholar] [CrossRef]
- Heeb, S.; Haas, D. Regulatory roles of the GacS/GacA two-component system in plant-associated and other gram-negative bacteria. Mol. Plant Microbe. Interact. 2001, 14, 1351–1363. [Google Scholar] [CrossRef]
- Dorman, M.J.; Feltwell, T.; Goulding, D.A.; Parkhill, J.; Short, F.L. The Capsule Regulatory Network of Klebsiella pneumoniae Defined by density-TraDISort. mBio 2018, 9, e01863-18. [Google Scholar] [CrossRef]
- Bao, J.; Xie, L.; Ma, Y.; An, R.; Gu, B.; Wang, C. Proteomic and Transcriptomic Analyses Indicate Reduced Biofilm-Forming Abilities in Cefiderocol-Resistant Klebsiella pneumoniae. Front. Microbiol. 2021, 12, 778190. [Google Scholar] [CrossRef] [PubMed]
- Bhuiyan, M.S.; Ellett, F.; Murray, G.L.; Kostoulias, X.; Cerqueira, G.M.; Schulze, K.E.; Maifiah, M.H.M.; Li, J.; Creek, D.J.; Lieschke, G.J.; et al. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis. Proc. Natl. Acad. Sci. USA 2016, 113, 9599–9604. [Google Scholar] [CrossRef] [PubMed]
- Cerqueira, G.M.; Kostoulias, X.; Khoo, C.; Aibinu, I.; Qu, Y.; Traven, A.; Peleg, A.Y. A global virulence regulator in Acinetobacter baumannii and its control of the phenylacetic acid catabolic pathway. J. Infect. Dis. 2014, 210, 46–55. [Google Scholar] [CrossRef]
- De Silva, P.M.; Kumar, A. Effect of Sodium Chloride on Surface-Associated Motility of Acinetobacter baumannii and the Role of AdeRS Two-Component System. J. Membr. Biol. 2018, 251, 5–13. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.F.; Lin, Y.Y.; Yeh, H.W.; Lan, C.Y. Role of the BaeSR two-component system in the regulation of Acinetobacter baumannii adeAB genes and its correlation with tigecycline susceptibility. BMC Microbiol. 2014, 14, 119. [Google Scholar] [CrossRef] [PubMed]
- Adams, M.D.; Nickel, G.C.; Bajaksouzian, S.; Lavender, H.; Murthy, A.R.; Jacob, M.R.; Bonomo, R.A. Resistance to colistin in Acinetobacter baumannii associated with mutations in the PmrAB two-component system. Antimicrob. Agents Chemother. 2009, 53, 3628–3634. [Google Scholar] [CrossRef] [PubMed]
- Liou, M.L.; Soo, P.C.; Ling, S.R.; Kuo, H.Y.; Tang, C.Y.; Chang, K.C. The sensor kinase BfmS mediates virulence in Acinetobacter baumannii. J. Microbiol. Immunol. Infect. 2014, 47, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Lin, G.H.; Hsieh, M.C.; Shu, H.Y. Role of Iron-Containing Alcohol Dehydrogenases in Acinetobacter baumannii ATCC 19606 Stress Resistance and Virulence. Int. J. Mol. Sci. 2021, 22, 9921. [Google Scholar] [CrossRef]
- Lin, H.R.; Shu, H.Y.; Lin, G.H. Biological roles of indole-3-acetic acid in Acinetobacter baumannii. Microbiol. Res. 2018, 216, 30–39. [Google Scholar] [CrossRef]
- Wei, C.F.; Tsai, Y.H.; Tsai, S.H.; Lin, C.S.; Chang, C.J.; Lu, C.C.; Huang, H.-C.; Lai, H.-C. Cross-talk between bacterial two-component systems drives stepwise regulation of flagellar biosynthesis in swarming development. Biochem. Biophys. Res. Commun. 2017, 489, 70–75. [Google Scholar] [CrossRef]
- Urano, H.; Umezawa, Y.; Yamamoto, K.; Ishihama, A.; Ogasawara, H. Cooperative regulation of the common target genes between H2O2-sensing YedVW and Cu2+-sensing CusSR in Escherichia coli. Microbiology 2015, 161, 729–738. [Google Scholar] [CrossRef]
- Urano, H.; Yoshida, M.; Ogawa, A.; Yamamoto, K.; Ishihama, A.; Ogasawara, H. Cross-regulation between two common ancestral response regulators, HprR and CusR, in Escherichia coli. Microbiology 2017, 163, 243–252. [Google Scholar] [CrossRef]
- Linares, J.F.; Gustafsson, I.; Baquero, F.; Martinez, J.L. Antibiotics as intermicrobial signaling agents instead of weapons. Proc. Natl. Acad. Sci. USA 2006, 103, 19484–19489. [Google Scholar] [CrossRef]
- Petrova, O.E.; Sauer, K. A novel signaling network essential for regulating Pseudomonas aeruginosa biofilm development. PLoS Pathog. 2009, 5, e1000668. [Google Scholar] [CrossRef]
- Bertani, G. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 1951, 62, 293–300. [Google Scholar] [CrossRef]
- Schäfer, A.; Tauch, A.; Jäger, W.; Kalinowski, J.; Thierbach, G.; Pühler, A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: Selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 1994, 145, 69–73. [Google Scholar] [CrossRef]
- Lin, G.H.; Chen, H.P.; Huang, J.H.; Liu, T.T.; Lin, T.K.; Wang, S.J.; Tseng, C.-H.; Shu, H.-Y. Identification and characterization of an indigo-producing oxygenase involved in indole 3-acetic acid utilization by Acinetobacter baumannii. Antonie Van Leeuwenhoek 2012, 101, 881–890. [Google Scholar] [CrossRef]
- Li, R.; Yu, C.; Li, Y.; Lam, T.W.; Yiu, S.M.; Kristiansen, K.; Wang, J. SOAP2: An improved ultrafast tool for short read alignment. Bioinformatics 2009, 25, 1966–1967. [Google Scholar] [CrossRef] [PubMed]
- Marioni, J.C.; Mason, C.E.; Mane, S.M.; Stephens, M.; Gilad, Y. RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays. Genome Res 2008, 18, 1509–1517. [Google Scholar] [CrossRef] [PubMed]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Drai, D.; Elmer, G.; Kafkafi, N.; Golani, I. Controlling the false discovery rate in behavior genetics research. Behav. Brain Res. 2001, 125, 279–284. [Google Scholar] [CrossRef]
- Barbieri, C.M.; Stock, A.M. Universally applicable methods for monitoring response regulator aspartate phosphorylation both in vitro and in vivo using Phos-tag-based reagents. Anal. Biochem. 2008, 376, 73–82. [Google Scholar] [CrossRef]
- Tsai, C.J.; Loh, J.M.; Proft, T. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence 2016, 7, 214–229. [Google Scholar] [CrossRef]
- Kadeřábková, N.; Mahmood, A.J.S.; Mavridou, D.A.I. Antibiotic susceptibility testing using minimum inhibitory concentration (MIC) assays. NPJ Antimicrob. Resist. 2024, 2, 37. [Google Scholar] [CrossRef]
- Chen, S.J.; Shu, H.Y.; Lin, G.H. Regulation of tert-Butyl Hydroperoxide Resistance by Chromosomal OhrR in A. baumannii ATCC 19606. Microorganisms 2021, 9, 629. [Google Scholar] [CrossRef]








| STRAIN | APR | GEN | KAN | CHL | PMB | CST |
|---|---|---|---|---|---|---|
| Wild-type | 50 | 25 | 6.25 | 30 | 3.125 | 2.5 |
| ∆gacS | 50 | 25 | 6.25 | 30 | 3.125 | 2.5 |
| ∆gacA | 25 | 6.25 | 3.125 | 15 | 1.78 | 2.5 |
| ∆gacSA | 25 | 6.25 | 3.125 | 15 | 3.125 | 2.5 |
| ∆DJ41_1407 | 50 | 25 | 6.25 | 30 | 3.125 | 2.5 |
| ∆ gacS DJ41_1407 | 50 | 25 | 6.25 | 30 | 3.125 | 2.5 |
| ∆ gacA DJ41_1407 | 12.5 | 6.25 | 3.125 | 15 | 3.125 | 2.5 |
| Bacteria | Description | References or Sources |
|---|---|---|
| E. coli | ||
| DH5α | F-, supE44, hsdR17, recA1, gyrA96, endA1, thi-1, relA1, deoR, λ | ATCC53868 |
| DH5α/pK18_∆gacA | Kan r, DH5α containing pK18_∆gacA | This study |
| DH5α/pK18_∆gacS | Kan r, DH5α containing pK18_∆gacS | This study |
| DH5α/pK18_∆gacSA | Kan r, DH5α containing pK18_∆gacSA | This study |
| DH5α/pK18_∆DJ41-1407 | Kan r, DH5α containing pK18_∆DJ41-1407 | [8] |
| DH5α/pK18_∆gacADJ41-1407 | Kan r, DH5α containing pK18_∆gacADJ41-1407 | This study |
| S17-1λπ | thi-1, thr, leu, tonA, lacY, supE, recA, RP4-2 (Km::Tn7,Tc::Mu-1), Smr, lpir | [8] |
| S17-1λπ/pK18_∆DJ41_1407 | Kan r, S17-1λπ containing pK18_∆DJ41-1407 | [8] |
| S17-1λπ/pK18_∆gacA | Kan r, S17-1λπ containing pK18_∆gacA | This study |
| S17-1λπ/pK18_∆gacS | Kan r, S17-1λπ containing pK18_∆gacS | This study |
| S17-1λπ/pK18_∆gacSA | Kan r, S17-1λπ containing pK18_∆gacSA | This study |
| S17-1λπ/pK18_∆gacSDJ41_1407 | Kan r, S17-1λπ containing pK18_∆gacSDJ41-1407 | This study |
| S17-1λπ/pK18_∆gacADJ41_1407 | Kan r, S17-1λπ containing pK18_∆gacADJ41-1407 | This study |
| A. baumannii | ||
| ATCC 19606 | Amp r, clinical isolate, wild type | [43] |
| ∆DJ41_1407 | Amp r, deletion of DJ41_1407 | [8] |
| ∆gacS | Amp r, deletion of gacS | This study |
| ∆gacA | Amp r, deletion of gacA | This study |
| ∆gacSA | Amp r, deletion of gacSA | This study |
| ∆gacSDJ41_1407 | Amp r, deletion of gacSDJ41_1407 | This study |
| ∆gacADJ41_1407 | Amp r, deletion of gacADJ41_1407 | This study |
| Plasmids | Description | References or Source |
|---|---|---|
| pK18mobsacB | Kan r, mobilisable suicide vector, sacB, oriT | [35] |
| pK18_∆DJ41_1407 | Kan r, pK18mobsacB containing DJ41_1407 upstream and downstream 1 kb fragments | [8] |
| pK18_∆gacS | Kan r, pK18mobsacB containing gacS upstream and downstream 1 kb fragments | This study |
| pK18_∆gacA | Kan r, pK18mobsacB containing gacA upstream and downstream 1 kb fragments | This study |
| Primers | Sequence (5′-3′) | Application | References or Source |
|---|---|---|---|
| pK18-gacSUP_F | ATTCGAGCTCGGTACCCGGGCCATACTGCGACCTGAAAGC | Construct and confirm the gacS mutant | This study |
| pK18-gacSDO_R | TAAAACGACGGCCAGTGCCATTCTGCAATTTTTACTGAAG | Construct and confirm the gacS mutant | This study |
| gacSUP-gasSDO_F | GCCTATTTAACAACTATTATAGCTACATCAGATTGATCTC | Construct a gacS mutant | This study |
| gacSDO-gacSUP_R | GAGATCAATCTGATGTAGCTATAATAGTTGTTAAATAGGC | Construct a gacS mutant | This study |
| pk18-gacAUP_F | ACGACGGCCAGTGCCAGTGGTTGAGAACTGACGAAT | Construct and confirm the gacA mutant | This study |
| pk18-gacADO_R | GAGCTCGGTACCCGGGAGCGAGAGGGTTGCGGATCT | Construct and confirm the gacA mutant | This study |
| gacAUP-gacADO_F | GAAATTGCATGTAAGTTTGGGAAGACCTCCTTTCTTTCAA | Construct a gacA mutant | This study |
| gacADO-gacAUP_R | TTGAAAGAAAGGAGGTCTTCCCAAACTTACATGCAATTTC | Construct a gacA mutant | This study |
| pK18-A1S_0235_up_F | GAGCTCGGTACCCGGGACGGGTTATTGACGAGTTCT | Construct and confirm the DJ41_1407 mutant | This study |
| A1S_0235_up_A1S_0235_do_R | GGTTGCTGTTCTGCCATTTCACGAAAAATCGTATGGGACA | Construct DJ41_1407 mutant | This study |
| A1S_0235_up_A1S_0235_do_F | TGTCCCATACGATTTTTCGTGAAATGGCAGAACAGCAACC | Construct DJ41_1407 mutant | This study |
| pK18-A1S_0235_do_R | ACGACGGCCAGTGCCAACTCCATACAAATTTTCTGA | Construct and confirm the DJ41_1407 mutant | This study |
| gacA/07-IGR-qF | GCGATTCGTTACGGTTTGAT | Amplify intergenic region | This study |
| gacA/07-IGR-qR | AGGAATATAAGGCAGGTTGCTG | Amplify intergenic region | This study |
| paa_qF-2 | AAGCAACAGGTGGCCGTGAT | qRT-PCR for paa | This study |
| paa_qR-2 | ACCGACTTCACCTTCAACATACGC | qRT-PCR for paa | This study |
| Adh4-qF | TGCAAGATGAAGGGCTATTT | qRT-PCR for Adh4 | [34] |
| Adh4-qR | CACCGCCTAACGACACAATA | qRT-PCR for Adh4 | [34] |
| IPDC-F | ATATTGCTCAACCGCTTTGG | qRT-PCR for ipdC | This study |
| IPDC-R | GCAGCGTTTTCACCCATAAT | qRT-PCR for ipdC | This study |
| iaaHQ-F | GGTGGCTCTTCAAGTGGTTC | qRT-PCR for iaaH | This study |
| iaaHQ-R | AATTTGCAAAAGGACCAACG | qRT-PCR for iaaH | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Toh, Y.-H.; Wen, M.-Y.; Lin, G.-H. Roles of GacSA and DJ41_1407 in Acinetobacter baumannii ATCC 19606. Int. J. Mol. Sci. 2025, 26, 10620. https://doi.org/10.3390/ijms262110620
Toh Y-H, Wen M-Y, Lin G-H. Roles of GacSA and DJ41_1407 in Acinetobacter baumannii ATCC 19606. International Journal of Molecular Sciences. 2025; 26(21):10620. https://doi.org/10.3390/ijms262110620
Chicago/Turabian StyleToh, Yee-Huan, Meng-Yun Wen, and Guang-Huey Lin. 2025. "Roles of GacSA and DJ41_1407 in Acinetobacter baumannii ATCC 19606" International Journal of Molecular Sciences 26, no. 21: 10620. https://doi.org/10.3390/ijms262110620
APA StyleToh, Y.-H., Wen, M.-Y., & Lin, G.-H. (2025). Roles of GacSA and DJ41_1407 in Acinetobacter baumannii ATCC 19606. International Journal of Molecular Sciences, 26(21), 10620. https://doi.org/10.3390/ijms262110620

