CaP Nanoparticles Improve the Effect of dsRNA on Gene Expression, Growth, and Mycotoxin Production of Toxigenic Fusarium graminearum
Abstract
1. Introduction
2. Results
2.1. Silencing Effects of Different dsRNAs and Selecting an Optimal Concentration
2.2. Characterization of CaP Nanoparticles and CaPs:dsRNA Nanocomplexes
2.3. Evaluation of the Effect of Naked dsRNA and CaPs:dsRNA Nanocomplexes on F. graminearum Gene Expression at Different Time Points
2.4. Effect of dsRNA Treatment on DON Biosynthesis by F. graminearum
2.5. Spraying Detached Leaves with Naked dsRNA and CaPs:dsRNA Nanocomplexes and Evaluation of Their Effect on F. graminearum Growth
2.6. Effect of Spraying Detached Leaves with Naked dsRNA and CaPs:dsRNA Nanocomplexes on F. graminearum Gene Expression
3. Discussion
4. Materials and Methods
4.1. Fungal and Plant Material, Growth Conditions
4.2. Nucleic Acids Extraction
4.3. Primer Design
4.4. In Vitro Transcription
4.5. CaPs Preparation and CaPs:dsRNA Nanocomplexes Formation
4.6. dsRNA Treatment of Liquid Culture Media
4.7. Detached Leaf Assay
4.8. qPCR Experiments
4.9. DON Content Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The Global Burden of Pathogens and Pests on Major Food Crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [Scilit]
- Powell, A.J.; Vujanovic, V. Evolution of Fusarium Head Blight Management in Wheat: Scientific Perspectives on Biological Control Agents and Crop Genotypes Protocooperation. Appl. Sci. 2021, 11, 8960. [Google Scholar] [CrossRef] [Scilit]
- Alisaac, E.; Mahlein, A.-K. Fusarium Head Blight on Wheat: Biology, Modern Detection and Diagnosis and Integrated Disease Management. Toxins 2023, 15, 192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woloshuk, C.P.; Shim, W.-B. Aflatoxins, Fumonisins and Trichothecenes: A Convergence of Knowledge. FEMS Microbiol. Rev. 2013, 37, 94–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cendoya, E.; Chiotta, M.L.; Zachetti, V.; Chulze, S.N.; Ramirez, M.L. Fumonisins and Fumonisin-Producing Fusarium Occurrence in Wheat and Wheat by Products: A Review. J. Cereal Sci. 2018, 80, 158–166. [Google Scholar] [CrossRef] [Scilit]
- Ekwomadu, T.I.; Akinola, S.A.; Mwanza, M. Fusarium Mycotoxins, Their Metabolites (Free, Emerging, Masked), Food Safety Concerns, and Health Impacts. Int. J. Environ. Res. Public Health 2021, 18, 11741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, Z.; Ren, X.; Du, Z.; Hou, J.; Li, Y.; Yao, Y.; An, Y. Fusarium Mycotoxins: The Major Food Contaminants. mLife 2024, 3, 176–206. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Nicholson, P. Community Ecology of Fungal Pathogens Causing Wheat Head Blight. Annu. Rev. Phytopathol. 2009, 47, 83–103. [Google Scholar] [CrossRef] [Scilit]
- Haile, J.K.; N’Diaye, A.; Walkowiak, S.; Nilsen, K.T.; Clarke, J.M.; Kutcher, H.R.; Steiner, B.; Buerstmayr, H.; Pozniak, C.J. Fusarium Head Blight in Durum Wheat: Recent Status, Breeding Directions, and Future Research Prospects. Phytopathology 2019, 109, 1664–1675. [Google Scholar] [CrossRef] [Scilit]
- Bai, G.H.; Desjardins, A.E.; Plattner, R.D. Deoxynivalenol-Tonproducing Fusarium graminearum Causes Initial Infection, but Does not Cause Disease Spread in Wheat Spikes. Mycopathologia 2002, 153, 91–98. [Google Scholar] [CrossRef] [Scilit]
- Langevin, F.; Eudes, F.; Comeau, A. Effect of Trichothecenes Produced by Fusarium graminearum During Fusarium Head Blight development in six cereal species. Eur. J. Plant Pathol. 2004, 110, 735–746. [Google Scholar] [CrossRef] [Scilit]
- Rocha, O.; Ansari, K.; Doohan, F.M. Effects of Trichothecene Mycotoxins on Eukaryotic Cells: A Review. Food Addit. Contam. 2005, 22, 369–378. [Google Scholar] [CrossRef] [Scilit]
- Bin-Umer, M.A.; McLaughlin, J.; Basu, D.; McCormick, S.; Tumer, N.E. Trichothecene Mycotoxins Inhibit Mitochondrial Translation—Implication for the Mechanism of Toxicity. Toxins 2011, 3, 1484–1501. [Google Scholar] [CrossRef] [Scilit]
- Mishra, S.; Srivastava, S.; Dewangan, J.; Divakar, A.; Rath, S.K. Global Occurrence of Deoxynivalenol in Food Commodities and Exposure Risk Assessment in Humans in the Last Decade: A Survey. Crit. Rev. Food Sci. Nutr. 2019, 60, 1346–1374. [Google Scholar] [CrossRef] [Scilit]
- Yan, P.; Liu, Z.; Liu, S.; Yao, L.; Liu, Y.; Wu, Y.; Gong, Z. Natural Occurrence of Deoxynivalenol ant Its Acetylated Derivatives in Chinese Maize and Wheat Collected in 2017. Toxins 2020, 12, 200. [Google Scholar] [CrossRef] [Scilit]
- de Chaves, M.A.; Reginatto, P.; da Costa, B.S.; de Paschoal, R.I.; Teixeira, M.L.; Feuntefria, A.A. Fungicide Resistance in Fusarium graminearum Species Complex. Curr. Microbiol. 2022, 79, 62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayawardana, M.A.; Fernando, W.G.D. The Mechanisms of Developing Fungicide Resistance in Fusarium graminearum Causing Fusarium Head Blight and Fungicide Resistance Management. Pathogens 2024, 13, 1012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lini, R.S.; Scanferla, D.T.P.; de Oliveira, N.G.; Aguera, R.G.; da Silva Santos, T.; Teixeira, J.J.V.; de Souza Kaneshima, A.M.; Mossini, S.A.G. Fungicides as a Risk Factor for the Development of Neurological Diseases in Humans: A Systematic Review. Crit. Rev. Toxicol. 2024, 54, 35–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and Specific Genetic Interference by Double-Stranded RNA in Caenorhabditis elegans. Nature 1998, 391, 806–811. [Google Scholar] [CrossRef] [Scilit]
- Saurabh, S.; Vidyarthi, A.S.; Prasad, D. RNA Interference: Concept to Reality in Crop Improvement. Planta 2014, 239, 543–564. [Google Scholar] [CrossRef] [Scilit]
- Rosa, C.; Kuo, Y.-W.; Wuriyanghan, H.; Falk, B.W. RNA Interference Mechanisms and Applications in Plant Pathology. Annu. Rev. Phytopathol. 2018, 56, 581–610. [Google Scholar] [CrossRef] [Scilit]
- Rajput, M.; Choudhary, K.; Kumar, M.; Vivekanand, V.; Chawade, A.; Ortiz, R.; Pareek, N. RNA Interference and CRISPR/Cas Gene Editing for Crop Improvement: Paradigm Shift towards Sustainable Agriculture. Plants 2021, 10, 1914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bharathi, J.K.; Anandan, R.; Benjamin, L.K.; Muneer, S.; Prakash, M.A.S. Recent Trends and Advances of RNA Interference (RNAi) to Improve Agricultural Crops and Enhance Their Resilience to Biotic and Abiotic Stresses. Plant Physiol. Biochem. 2023, 194, 600–618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koeppe, S.; Kawchuk, L.; Kalischuk, M. RNA Interference Past and Future Applications in Plants. Int. J. Mol. Sci. 2023, 24, 9755. [Google Scholar] [CrossRef] [Scilit]
- Beernink, B.M.; Amanat, N.; Li, V.H.; Manchur, C.L.; Whyard, S.; Belmonte, M.F. SIGS vs. HIGS: Opportunities and Challenges of RNAi Pest and Pathogen Control Strategies. Can. J. Plant Pathol. 2024, 46, 675–689. [Google Scholar] [CrossRef] [Scilit]
- Koch, A.; Biedenkopf, D.; Furch, A.; Weber, L.; Rossbach, O.; Abdellatef, E.; Linicus, L.; Johannsmeier, J.; Jelonek, L.; Goesmann, A.; et al. An RNAi-Based Control of Fusarium graminearum Infections Through Spraying of Long dsRNAs Involves a Plant Passage and Is Controlled by the Fungal Silencing Machinery. PLoS Pathog. 2016, 12, e1005901. [Google Scholar] [CrossRef] [Scilit]
- Stakheev, A.A.; Taliansky, M.; Kalinina, N.O.; Zavriev, S.K. RNAi-Based Approaches to Control Mycotoxin Producers: Challenges and Perspectives. J. Fungi 2024, 10, 682. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.S.; Ahmed, M.R.; Noman, M.; Zhang, Z.; Wang, J.; Lu, Z.; Cai, Y.; Ahmed, T.; Li, B.; Wang, Y.; et al. Integrating RNA Interference and Nanotechnology: A Transformative Approach in Plant Protection. Plants 2025, 14, 977. [Google Scholar] [CrossRef] [Scilit]
- Bachman, P.; Fischer, J.; Song, Z.; Urbanczyk-Wochniak, E.; Watson, G. Environmental Fate and Dissipation of Applied dsRNA in Soil, Aquatic Systems, and Plants. Front. Plant Sci. 2020, 11, 21. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Patra, S.; Ray, S. A Combinational Nanobased Spray-Induced Gene Silencing Technique for Crop Protection and Improvement. ACS Omega 2023, 8, 22345–22351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pal, G.; Ingole, K.D.; Yavvari, P.S.; Verma, P.; Kumari, A.; Chauhan, C.; Chaudhary, D.; Srivastava, A.; Bajaj, A.; Vemanna, R.S. Exogenous Application of Nanocarrier-Mediated Double-Stranded RNA Manipulates Physiological Traits and Defense Response Against Bacterial Diseases. Mol. Plant Pathol. 2024, 25, e13417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mosa, M.A.; Yuossef, K. Topical Delivery of Host Induced RNAi Silencing by Layered Hydroxide Nanosheets: An Efficient Tool to Decipher Pathogenicity Gene Function of Fusarium Crown and Root Rot in Tomato. Physiol. Mol. Plant Pathol. 2021, 115, 101684. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Yan, Q.; Lan, C.; Tang, T.; Wang, K.; Shen, J.; Niu, D. Nanoparticle carriers enhance RNA stability and uptake efficiency and prolong the protection against Rhizoctonia solani. Phytopathol. Res. 2023, 5, 2. [Google Scholar] [CrossRef] [Scilit]
- Spada, M.; Pugliesi, C.; Fambrini, M.; Palpacelli, D.; Caneo, A.; Pecchia, S. Spray-Induced Gene Silencing (SIGS): Nanocarrier-Mediated dsRNA Delivery Improves RNAi Efficiency in the Management of Lettuce Gray Mold Caused by Botrytis cinerea. Agronomy 2025, 15, 194. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.; He, B.; Mi, P. Calcium Phosphate Nanocarriers for Drug Delivery to Tumors: Imaging, Therapy and Theranostics. Biomater. Sci. 2019, 7, 3842–3960. [Google Scholar] [CrossRef] [Scilit]
- Qiu, C.; Wu, Y.; Guo, Q.; Shi, Q.; Zhang, J.; Meng, Y.; Xia, F.; Wang, J. Preperation and Application of Calcium Phosphate Nanocarriers in Drug Delivery. Mater. Today Bio 2022, 17, 100501. [Google Scholar] [CrossRef] [Scilit]
- Popova, E.V.; Tikhomirova, V.E.; Beznos, O.V.; Chesnokova, N.B.; Grigoriev, Y.V.; Klyachko, N.L.; Kost, O.A. Chitosan-Covered Calcium Phosphate Particles as a Drug Vehicle for Delivery to the Eye. Nanomedicine 2022, 40, 102493. [Google Scholar] [CrossRef] [Scilit]
- Popova, E.; Tikhomirova, V.; Beznos, O.; Chesnokova, N.; Grigoriev, Y.; Taliansky, M.; Kost, O. A Direct Comparison of Peptide Drug Delivery Systems Based on the Use of Hybrid Calcium Phosphate Phosphate/Chitosan Nanoparticles versus Unmixed Calcium Phosphate or Chitosan Nanoparticles In Vitro and In Vivo. Int. J. Mol. Sci. 2023, 24, 15532. [Google Scholar] [CrossRef] [Scilit]
- Chao, Y.-W.; Lee, Y.-L.; Tseng, C.-S.; Wang, L.U.-H.; Hsia, K.-C.; Chen, H.; Fustin, J.-M.; Azeem, S.; Chang, T.-T.; Chen, C.-Y.; et al. Improved CaP Nanoparticles for Nucleic Acid and Protein Delivery to Neural Primary Cultures and Stem Cells. ACS Nano 2024, 18, 4822–4839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fellet, G.; Pillotto, L.; Marchiol, L.; Braidot, E. Tools for Nano-Enabled Agriculture: Fertilizers Based on Calcium Phosphate, Silicon, and Chitosan Nanostructures. Agronomy 2021, 11, 1239. [Google Scholar] [CrossRef] [Scilit]
- El-Ghany, M.F.A.; El-Kherbawy, M.I.; Abdel-Aal, Y.A.; El-Dek, S.I.; Abd El-Baky, T. Comparative Study between Traditional and Nano Calcium Phosphate Fertilizers on Growth and Production of Snap Bean (Phaeseolus vulgaris L.) Plants. Nanomaterials 2021, 11, 2913. [Google Scholar] [CrossRef] [Scilit]
- Mishra, D.; Chitara, M.K.; Upadhayay, V.K.; Singh, J.P.; Chaturvedi, P. Plant Growth Promoting Potential of Urea Doped Calcium Phosphate Nanoparticles in Finger Millet (Eleusine coracana (L.) Gaertn.) Under Drought Stress. Front. Plant Sci. 2023, 14, 1137002. [Google Scholar] [CrossRef] [Scilit]
- Torres-Díaz, L.L.; Pérez-Álvarez, E.P.; Parra-Torrejón, B.; Marín-San Román, S.; de Sáenz de Urturi, I.; Ramírez-Rodríguez, G.B.; Murillo-Peña, R.; González-Lázaro, M.; Delgado-López, J.M.; Garde-Cerdán, T. Effects of Foliar Application of Methyl Jasmonate and/or Urea, Conventional or via Nanoparticles, on Grape Volatile Composition. J. Sci. Food Agric. 2024, 104, 8248–8262. [Google Scholar] [CrossRef] [Scilit]
- Hao, G.; McCormick, S.; Vaughan, M.M. Effects of Double-Stranded RNAs Targeting Fusarium graminearum Tri6 on Fusarium Head Blight and Mycotoxins. Phytopathology 2021, 111, 2080–2087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tretiakova, P.; Voegele, R.T.; Soloviev, A.; Link, T.I. Successful Silencing of the Mycotoxin Synthesis Gene Tri5 in Fusarium culmorum and Observation of Reduced Virulence in VIGS and SIGS Experiments. Genes 2022, 13, 395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, X.-S.; Gu, K.-X.; Duan, X.-X.; Xiao, X.-M.; Hou, Y.-P.; Duan, Y.-B.; Wang, J.-X.; Zhou, M.-G. A myosin5 dsRNA that Reduces the Fungicide Resistance and Pathogenicity of Fusarium asiaticum. Pestic. Biochem. Physiol. 2018, 150, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Werner, B.T.; Gaffar, F.Y.; Schuemann, J.; Biedenkopf, D.; Koch, A.M. RNA-Spray-Mediated Silencing of Fusarium graminearum AGO and DCL Genes Improve Barley Disease Resistance. Front. Plant Sci. 2020, 11, 476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, P.; Yi, S.-Y.; Nian, J.-N.; Yuan, Q.-S.; He, W.-J.; Zhang, J.-B.; Liao, Y.-C. Application of Double-Strand RNAs Targeting Chitin Synthase, Glucan Synthase, and Protein Kinase Reduces Fusarium graminearum Spreading in Wheat. Front. Microbiol. 2021, 12, 660976. [Google Scholar] [CrossRef] [Scilit]
- Bayram, O.; Krappmann, S.; Ni, M.; Bok, J.W.; Helmstaedt, K.; Valerius, O.; Braus-Stromeyer, S.; Kwon, N.-J.; Keller, N.P.; Yu, J.-H.; et al. VelB/VeA/LaeA Complex Coordinates Light Signal with Fungal Development and Secondary Metabolism. Science 2008, 320, 1504–1506. [Google Scholar] [CrossRef] [Scilit]
- Calvo, A.M.; Bok, J.; Brooks, W.; Keller, N.P. VeA is Required for Toxin and Sclerotial Production in Aspergillus parasiticus. Appl. Environ. Microbiol. 2004, 70, 4733–4739. [Google Scholar] [CrossRef] [Scilit]
- Duran, R.M.; Cary, J.W.; Calvo, A.M. Production of Cyclopiazonic Acid, Aflatrem, and Aflatoxin by Aspergillus flavus Is Regulated by veA, a Gene Necessary for Sclerotial Formation. Appl. Microbiol. Biotechnol. 2007, 73, 1158–1168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Myung, K.; Li, S.; Butchko, R.A.E.; Busman, M.; Proctor, R.H.; Abbas, H.K.; Calvo, A.M. FvVE1 Regulates Biosynthesis of the Mycotoxins Fumonisins and Fusarins in Fusarium verticillioides. J. Agric. Food Chem. 2009, 57, 5089–5094. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Liu, X.; Yin, Y.; Ma, Z. Involvement of a Velvet Protein FgVeA in the Regulation of Asexual Development, lipid and Secondary Metabolisms and Virulence in Fusarium graminearum. PLoS ONE 2011, 6, e28291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merhej, J.; Urban, M.; Dufresne, M.; Hammond-Kosack, K.E.; Richard-Forget, F.; Barreau, C. The Velvet Gene, FgVe1, Affects Fungal Development and Positively Regulates Trichothecene Biosynthesis and Pathogenicity in Fusarium graminearum. Mol. Plant Pathol. 2012, 13, 363–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gardiner, D.M.; Rusu, A.; Benfield, A.H.; Kazan, K. Map-Based Cloning Identifies Velvet A as a Critical Component of Virulence in Fusarium pseudograminearum During Infection of Wheat Heads. Fungal Biol. 2021, 125, 191–200. [Google Scholar] [CrossRef] [Scilit]
- López-Berges, M.S.; Hera, C.; Sulyok, M.; Schäfer, K.; Capilla, J.; Guarro, J.; Di Pietro, A. The Velvet Complex Governs Mycotoxin Production and Virulence of Fusarium oxysporum on Plant and Mammalian Hosts. Mol. Microbiol. 2013, 87, 49–65. [Google Scholar] [CrossRef] [Scilit]
- Kuo, Y.-W.; Falk, B.W. RNA Interference Approaches for Plant Disease Control. Biotechniques 2020, 69, 469–477. [Google Scholar] [CrossRef] [Scilit]
- Akbar, S.; Wei, Y.; Zhang, M.-Q. RNA Interference: Promising Approach to Combat Plant Viruses. Int. J. Mol. Sci. 2022, 23, 5312. [Google Scholar] [CrossRef] [Scilit]
- Opdensteinen, P.; Charudattan, R.; Hong, J.C.; Rosskopf, E.N.; Steinmetz, N.F. Biochemical and Nanotechnological Approaches to Combat Phytoparasitic Nematodes. Plant Biotechnol. J. 2024, 22, 2444–2460. [Google Scholar] [CrossRef] [Scilit]
- Sang, H.; Kim, J.I. Advanced Strategies to Control Plant Pathogenic Fungi by Host-Induced Gene Silencing (HIGS) and Spray-Induced Gene Silencing (SIGS). Plant Biotechnol. Rep. 2020, 14, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Koch, A.; Kumar, N.; Weber, L.; Keller, H.; Imani, J.; Kogel, K.-H. Host-Induced Gene Silencing of Cytochrome P450 Lanosterol C14α-Demethylase-Encoding Genes Confers Strong Resistance to Fusarium Species. Proc. Natl. Acad. Sci. USA 2013, 110, 19324–19329. [Google Scholar] [CrossRef] [Scilit]
- Ghag, S.B.; Shekhawat, U.K.S.; Ganapathi, T.R. Host-Induced Post-Transcriptional Hairpin Mediated Gene Silencing of Vital Fungal Genes Confers Efficient Resistance Against Fusarium Wilt in Banana. Plant Biotechnol. J. 2014, 12, 541–553. [Google Scholar] [CrossRef] [Scilit]
- Prasad, K.; Yogendra, K.; Sanivarapu, H.; Rajasekaran, K.; Cary, J.W.; Sharma, K.K.; Bhatnagar-Mathur, P. Multiplexed Host-Induced Gene Silencing of Aspergillus flavus Genes Confers Aflatoxin Resistance in Groundnut. Toxins 2023, 15, 319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, X.-S.; Gu, K.-X.; Duan, X.-X.; Xiao, X.-M.; Hou, Y.-P.; Duan, Y.-B.; Wang, J.-X.; Yu, N.; Zhou, M.-G. Secondary Amplification of siRNA Machinery Limits the Application of Spray-Induced Gene Silencing. Mol. Plant Pathol. 2018, 19, 2543–2560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, K.-X.; Song, X.-S.; Xiao, X.-M.; Duan, X.-X.; Wang, J.-X.; Duan, Y.-B.; Hou, Y.-P.; Zhou, M.-G. A β2-tubulin dsRNA Derived from Fusarium asiaticum Confers Plant Resistance to Multiple Phytopathogens and Reduces Fungicide Resistance. Pestic. Biochem. Physiol. 2019, 153, 36–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Höfle, L.; Biedenkopf, D.; Werner, B.T.; Shrestha, A.; Jelonek, L.; Koch, A. Study on the Efficiency of dsRNAs with Increasing Length in RNA-Based Silencing of the Fusarium CYP51 Genes. RNA Biol. 2020, 17, 463–473. [Google Scholar] [CrossRef] [Scilit]
- Baldwin, T.; Islamovic, E.; Klos, K.; Schwartz, P.; Gillespie, J.; Hunter, S.; Bregitzer, P. Silencing Efficiency of dsRNA Fragments Targeting Fusarium graminearum Tri6 and Patterns of Small Interfering RNA Associated with Reduced Virulence and Mycotoxin Production. PLoS ONE 2018, 13, e0202798. [Google Scholar] [CrossRef] [Scilit]
- Ho, T.; Pilcher, R.L.R.; Edwards, M.-L.; Cooper, I.; Dalmay, T.; Wang, H. Evidence for GC Preference by Monocot Dicer-Like Proteins. Biochem. Biophys. Res. Commun. 2008, 368, 433–437. [Google Scholar] [CrossRef] [Scilit]
- Naqvi, S.; Maitra, A.N.; Abdin, M.Z.; Akmal, M.; Arora, I.; Samim, M. Calcium Phosphate Nanoparticle Mediated Genetic Transformation in Plants. J. Mater. Chem. 2012, 22, 3500. [Google Scholar] [CrossRef] [Scilit]
- Parra-Torrejón, B.; Salvachúa-de la Fuente, M.; Giménez-Bañón, M.J.; Moreno-Olivares, J.D.; Paladines-Quezada, D.F.; Bleda-Sánchez, J.A.; Gil-Muñoz, R.; Ramírez-Rodríguez, G.B.; Delgado-López, J.M. Amorphous vs. Nanocrystalline Calcium Phosphate as Efficient Nanocarriers of Elicitors in Vineyards. CrystEngComm 2023, 25, 2372. [Google Scholar] [CrossRef] [Scilit]
- Alamri, S.; Nafady, N.A.; El-Sagheer, A.M.; El-Aal, M.A.; Mostafa, Y.S.; Hashem, M.; Hassan, E.A. Current Utility of Arbuscular Mycorrhizal Fungi and Hydroxyapatite Nanoparticles in Suppression of Tomato Root-Knot Nematode. Agronomy 2022, 12, 671. [Google Scholar] [CrossRef] [Scilit]
- Santiago-Aliste, A.; Sánchez-Hernández, E.; Buzón-Durán, L.; Marcos-Robles, J.L.; Martín-Gil, J.; Martín-Ramos, P. Uncaria tomentosa-Loaded Chitosan Oligomers–Hydroxyapatite–Carbon Nitride Nanocarriers for Postharvest Fruit Protection. Agronomy 2023, 13, 2189. [Google Scholar] [CrossRef] [Scilit]
- Frede, A.; Neuhaus, B.; Knuschke, T.; Wadwa, M.; Kollenda, S.; Klopfleisch, R.; Hansen, W.; Buer, J.; Bruder, D.; Epple, M.; et al. Local Delivery of siRNA-Loaded Calcium Phosphate Nanoparticles Abates Pulmonary Inflammation. Nanomed. Nanotechnol. Biol. Med. 2017, 13, 2395–2403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Yang, Y.; Huang, L. Calcium Phosphate Nanoparticles with an Asymmetric Lipid Bilayer Coating for siRNA Delivery to the Tumor. J. Control. Release 2012, 158, 108–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, R.-Q.; Liu, D.-Z.; Cui, H.; Cheng, Y.; Liu, M.; Zhang, B.-L.; Mei, Q.-B.; Zhou, S.-Y. Charge Reversible Calcium Phosphate Lipid Hybrid Nanoparticle for siRNA Delivery. Oncotarget 2017, 8, 42772–42788. [Google Scholar] [CrossRef] [Scilit]
- Popova, E.; Tikhomirova, V.; Akhmetova, A.; Ilina, I.; Kalinina, N.; Taliansky, M.; Kost, O. Calcium Phosphate Nanoparticles as Carriers of Low and High Molecular Weight Compounds. Int. J. Mol. Sci. 2024, 25, 12887. [Google Scholar] [CrossRef] [Scilit]
- Stakheev, A.A.; Erokhin, D.V.; Meleshchuk, E.A.; Mikityuk, O.D.; Statsyuk, N.V. Effect of Compactin on the Mycotoxin Production and Expression of Related Biosynthetic and Regulatory Genes in Toxigenic Fusarium culmorum. Microorganisms 2022, 10, 1347. [Google Scholar] [CrossRef] [Scilit]
- Akhmetova, A.I.; Yaminsky, I.V. High Resolution Imaging of Viruses: Scanning Probe Microscopy and Related Techniques. Methods 2022, 197, 30–38. [Google Scholar] [CrossRef] [Scilit]
- Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.S. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Ryazantsev, D.Y.; Abramova, S.L.; Evstratova, S.V.; Gagkaeva, T.Y.; Zavriev, S.K. FLASH-PCR Diagnostics of Toxigenic Fungi of the Genus Fusarium. Russ. J. Bioorg. Chem. 2008, 34, 716–724. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Target Gene | Primer Names | Sequence, 5′-3′ | dsRNA Length, bp |
|---|---|---|---|
| FgVe1 | FgVe1_150F | TAATACGACTCACTATAGGGATGGCGACACCTTCAGCAA | 148 |
| FgVe1_150R | TAATACGACTCACTATAGGGTCATACCAGAACCGCATGCTC | ||
| FgVe1 | FgVe1_370F | TAATACGACTCACTATAGGGAGCGTCGCGAGGAAGATTTC | 370 |
| FgVe1_370R | TAATACGACTCACTATAGGGGGACTGTAACCACGGTGAGACC | ||
| FgVe1 | FgVe1_540F | TAATACGACTCACTATAGGGGCTAACAGCGACCGCCGA | 540 |
| FgVe1_540R | TAATACGACTCACTATAGGGGGTGTCGCGCTTCCTCATG | ||
| ChS | CHS_315F | TAATACGACTCACTATAGGGATGCACTTAACTGAGGAGATCCT | 315 |
| CHS_315R | TAATACGACTCACTATAGGGTGGCGACTCTGAGGACCGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stakheev, A.A.; Bagdasarova, P.; Rogozhin, E.A.; Tikhomirova, V.; Popova, E.; Akhmetova, A.; Kost, O.; Kalinina, N.O.; Taliansky, M.; Zavriev, S.K. CaP Nanoparticles Improve the Effect of dsRNA on Gene Expression, Growth, and Mycotoxin Production of Toxigenic Fusarium graminearum. Int. J. Mol. Sci. 2025, 26, 10021. https://doi.org/10.3390/ijms262010021
Stakheev AA, Bagdasarova P, Rogozhin EA, Tikhomirova V, Popova E, Akhmetova A, Kost O, Kalinina NO, Taliansky M, Zavriev SK. CaP Nanoparticles Improve the Effect of dsRNA on Gene Expression, Growth, and Mycotoxin Production of Toxigenic Fusarium graminearum. International Journal of Molecular Sciences. 2025; 26(20):10021. https://doi.org/10.3390/ijms262010021
Chicago/Turabian StyleStakheev, Alexander A., Polina Bagdasarova, Eugene A. Rogozhin, Victoria Tikhomirova, Ekaterina Popova, Assel Akhmetova, Olga Kost, Natalia O. Kalinina, Michael Taliansky, and Sergey K. Zavriev. 2025. "CaP Nanoparticles Improve the Effect of dsRNA on Gene Expression, Growth, and Mycotoxin Production of Toxigenic Fusarium graminearum" International Journal of Molecular Sciences 26, no. 20: 10021. https://doi.org/10.3390/ijms262010021
APA StyleStakheev, A. A., Bagdasarova, P., Rogozhin, E. A., Tikhomirova, V., Popova, E., Akhmetova, A., Kost, O., Kalinina, N. O., Taliansky, M., & Zavriev, S. K. (2025). CaP Nanoparticles Improve the Effect of dsRNA on Gene Expression, Growth, and Mycotoxin Production of Toxigenic Fusarium graminearum. International Journal of Molecular Sciences, 26(20), 10021. https://doi.org/10.3390/ijms262010021

