The Protective Effect of Nimodipine in Schwann Cells Is Related to the Upregulation of LMO4 and SERCA3 Accompanied by the Fine-Tuning of Intracellular Calcium Levels
Abstract
1. Introduction
2. Results
2.1. Nimodipine Pre-Treatment Protects the Cells at the Point of Stress Induction
2.2. Nimodipine Prevents Calcium Overload During Osmotic and Oxidative Stress
2.3. Analysis of Apoptosis- or Calcium-Signaling-Related Differentially Regulated Genes
2.4. Nimodipine-Dependent Calcium Signaling Involved Differentially Regulated Genes and Proteins
2.5. Under Nimodipine, No Further Reduction in Intracellular Adenosine Triphosphate (ATP) Content Occurs, Already Triggered by Osmotic and Oxidative Stress
2.6. Nimodipine Pre-Treatment Led to an Inhibition of the Activity of GSK3β
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. Nimodipine Treatment and Stress Induction
4.3. Real-Time Cell Death Assay
4.4. RNA Isolation and Real-Time Quantitative RT-PCR
4.5. Western Blot Analysis
4.6. Intracellular Calcium Measurement
4.7. ATP Measurement
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tang, L.; Gamal El-Din, T.M.; Swanson, T.M.; Pryde, D.C.; Scheuer, T.; Zheng, N.; Catterall, W.A. Structural basis for inhibition of a voltage-gated Ca2+ channel by Ca2+ antagonist drugs. Nature 2016, 537, 117–121. [Google Scholar] [CrossRef]
- Sanguinetti, M.C.; Kass, R.S. Voltage-dependent block of calcium channel current in the calf cardiac Purkinje fiber by dihydropyridine calcium channel antagonists. Circ. Res. 1984, 55, 336–348. [Google Scholar] [CrossRef]
- Schampel, A.; Kuerten, S. Danger: High Voltage-The Role of Voltage-Gated Calcium Channels in Central Nervous System Pathology. Cells 2017, 6, 43. [Google Scholar] [CrossRef]
- Scriabine, A.; van den Kerckhoff, W. Pharmacology of nimodipine. A review. Ann. N. Y. Acad. Sci. 1988, 522, 698–706. [Google Scholar] [CrossRef] [PubMed]
- Gaspard, N. How do I manage cerebral vasospasm and delayed cerebral ischemia? Minerva Anestesiol. 2020, 86, 1331–1339. [Google Scholar] [CrossRef] [PubMed]
- Al-Mufti, F.; Merkler, A.E.; Boehme, A.K.; Dancour, E.; May, T.; Schmidt, J.M.; Park, S.; Connolly, E.S.; Lavine, S.D.; Meyers, P.M.; et al. Functional Outcomes and Delayed Cerebral Ischemia Following Nonperimesencephalic Angiogram-Negative Subarachnoid Hemorrhage Similar to Aneurysmal Subarachnoid Hemorrhage. Neurosurgery 2018, 82, 359–364. [Google Scholar] [CrossRef]
- Connolly, E.S., Jr.; Rabinstein, A.A.; Carhuapoma, J.R.; Derdeyn, C.P.; Dion, J.; Higashida, R.T.; Hoh, B.L.; Kirkness, C.J.; Naidech, A.M.; Ogilvy, C.S.; et al. Guidelines for the management of aneurysmal subarachnoid hemorrhage: A guideline for healthcare professionals from the American Heart Association/American Stroke Association. Stroke 2012, 43, 1711–1737. [Google Scholar] [CrossRef]
- Barker, F.G.; Ogilvy, C.S. Efficacy of prophylactic nimodipine for delayed ischemic deficit after subarachnoid hemorrhage: A metaanalysis. J. Neurosurg. 1996, 84, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Scheller, K.; Scheller, C. Nimodipine promotes regeneration of peripheral facial nerve function after traumatic injury following maxillofacial surgery: An off label pilot-study. J. Craniomaxillofac. Surg. 2012, 40, 427–434. [Google Scholar] [CrossRef] [PubMed]
- Scheller, C.; Wienke, A.; Wurm, F.; Simmermacher, S.; Rampp, S.; Prell, J.; Rachinger, J.; Scheller, K.; Koman, G.; Strauss, C.; et al. Neuroprotective efficacy of prophylactic enteral and parenteral nimodipine treatment in vestibular schwannoma surgery: A comparative study. J. Neurol. Surg. A Cent. Eur. Neurosurg. 2014, 75, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Scheller, C.; Wienke, A.; Tatagiba, M.; Gharabaghi, A.; Ramina, K.F.; Ganslandt, O.; Bischoff, B.; Zenk, J.; Engelhorn, T.; Matthies, C.; et al. Prophylactic nimodipine treatment for cochlear and facial nerve preservation after vestibular schwannoma surgery: A randomized multicenter Phase III trial. J. Neurosurg. 2016, 124, 657–664. [Google Scholar] [CrossRef]
- Scheller, C.; Wienke, A.; Tatagiba, M.; Gharabaghi, A.; Ramina, K.F.; Ganslandt, O.; Bischoff, B.; Zenk, J.; Engelhorn, T.; Matthies, C.; et al. Prophylactic nimodipine treatment and improvement in hearing outcome after vestibular schwannoma surgery: A combined analysis of a randomized, multicenter, Phase III trial and its pilot study. J. Neurosurg. 2017, 127, 1376–1383. [Google Scholar] [CrossRef] [PubMed]
- Scheller, C.; Strauss, C.; Leisz, S.; Hänel, P.; Klemm, A.; Kowoll, S.; Böselt, I.; Rahne, T.; Wienke, A. Prophylactic nimodipine treatment for hearing preservation after vestibular schwannoma surgery: Study protocol of a randomized multi-center phase III trial-AkniPro 2. Trials 2021, 22, 475. [Google Scholar] [CrossRef] [PubMed]
- Scheller, C.; Rampp, S.; Leisz, S.; Tatagiba, M.; Gharabaghi, A.; Ramina, K.F.; Ganslandt, O.; Matthies, C.; Westermaier, T.; Antoniadis, G.; et al. Prophylactic nimodipine treatment improves hearing outcome after vestibular schwannoma surgery in men: A subgroup analysis of a randomized multicenter phase III trial. Neurosurg. Rev. 2021, 44, 1729–1735. [Google Scholar] [CrossRef]
- Herzfeld, E.; Strauss, C.; Simmermacher, S.; Bork, K.; Horstkorte, R.; Dehghani, F.; Scheller, C. Investigation of the neuroprotective impact of nimodipine on Neuro2a cells by means of a surgery-like stress model. Int. J. Mol. Sci. 2014, 15, 18453–18465. [Google Scholar] [CrossRef] [PubMed]
- Leisz, S.; Simmermacher, S.; Prell, J.; Strauss, C.; Scheller, C. Nimodipine-Dependent Protection of Schwann Cells, Astrocytes and Neuronal Cells from Osmotic, Oxidative and Heat Stress Is Associated with the Activation of AKT and CREB. Int. J. Mol. Sci. 2019, 20, 4578. [Google Scholar] [CrossRef] [PubMed]
- Koskimäki, J.; Matsui, N.; Umemori, J.; Rantamäki, T.; Castrén, E. Nimodipine activates TrkB neurotrophin receptors and induces neuroplastic and neuroprotective signaling events in the mouse hippocampus and prefrontal cortex. Cell. Mol. Neurobiol. 2015, 35, 189–196. [Google Scholar] [CrossRef] [PubMed]
- Bootman, M.D.; Collins, T.J.; Peppiatt, C.M.; Prothero, L.S.; MacKenzie, L.; De Smet, P.; Travers, M.; Tovey, S.C.; Seo, J.T.; Berridge, M.J.; et al. Calcium signalling—An overview. Semin. Cell Dev. Biol. 2001, 12, 3–10. [Google Scholar] [CrossRef]
- Berridge, M.J.; Bootman, M.D.; Lipp, P. Calcium—A life and death signal. Nature 1998, 395, 645–648. [Google Scholar] [CrossRef]
- Carlson, A.P.; Hänggi, D.; Macdonald, R.L.; Shuttleworth, C.W. Nimodipine Reappraised: An Old Drug With a Future. Curr. Neuropharmacol. 2020, 18, 65–82. [Google Scholar] [CrossRef] [PubMed]
- Rubinfeld, H.; Seger, R. The ERK cascade: A prototype of MAPK signaling. Mol. Biotechnol. 2005, 31, 151–174. [Google Scholar] [CrossRef] [PubMed]
- Maurer, U.; Preiss, F.; Brauns-Schubert, P.; Schlicher, L.; Charvet, C. GSK-3—At the crossroads of cell death and survival. J. Cell Sci. 2014, 127, 1369–1378. [Google Scholar] [CrossRef] [PubMed]
- Das, J.M.; Zito, P.M. Nimodipine. In StatPearls; StatPearls Publishing LLC.: Treasure Island, FL, USA, 2023. [Google Scholar]
- Berridge, M.J. Inositol trisphosphate and calcium signalling. Nature 1993, 361, 315–325. [Google Scholar] [CrossRef]
- Clapham, D.E. Calcium signaling. Cell 1995, 80, 259–268. [Google Scholar] [CrossRef]
- Chemaly, E.R.; Troncone, L.; Lebeche, D. SERCA control of cell death and survival. Cell Calcium 2018, 69, 46–61. [Google Scholar] [CrossRef] [PubMed]
- Ivanova, H.; Vervliet, T.; Missiaen, L.; Parys, J.B.; De Smedt, H.; Bultynck, G. Inositol 1,4,5-trisphosphate receptor-isoform diversity in cell death and survival. Biochim. Biophys. Acta 2014, 1843, 2164–2183. [Google Scholar] [CrossRef]
- Enders, M.; Heider, T.; Ludwig, A.; Kuerten, S. Strategies for Neuroprotection in Multiple Sclerosis and the Role of Calcium. Int. J. Mol. Sci. 2020, 21, 1663. [Google Scholar] [CrossRef] [PubMed]
- Eisenberg-Lerner, A.; Bialik, S.; Simon, H.U.; Kimchi, A. Life and death partners: Apoptosis, autophagy and the cross-talk between them. Cell Death Differ. 2009, 16, 966–975. [Google Scholar] [CrossRef]
- Zech, J.; Leisz, S.; Göttel, B.; Syrowatka, F.; Greiner, A.; Strauss, C.; Knolle, W.; Scheller, C.; Mäder, K. Electrospun Nimodipine-loaded fibers for nerve regeneration: Development and in vitro performance. Eur. J. Pharm. Biopharm. 2020, 151, 116–126. [Google Scholar] [CrossRef] [PubMed]
- Herzfeld, E.; Speh, L.; Strauss, C.; Scheller, C. Nimodipine but Not Nifedipine Promotes Expression of Fatty Acid 2-Hydroxylase in a Surgical Stress Model Based on Neuro2a Cells. Int. J. Mol. Sci. 2017, 18, 964. [Google Scholar] [CrossRef] [PubMed]
- Hohmann, U.; Ghadban, C.; Hohmann, T.; Kleine, J.; Schmidt, M.; Scheller, C.; Strauss, C.; Dehghani, F. Nimodipine Exerts Time-Dependent Neuroprotective Effect after Excitotoxical Damage in Organotypic Slice Cultures. Int. J. Mol. Sci. 2022, 23, 3331. [Google Scholar] [CrossRef] [PubMed]
- Groenendyk, J.; Michalak, M. Endoplasmic reticulum quality control and apoptosis. Acta Biochim. Pol. 2005, 52, 381–395. [Google Scholar] [CrossRef]
- Coe, H.; Michalak, M. Calcium binding chaperones of the endoplasmic reticulum. Gen. Physiol. Biophys. 2009, 28, F96–F103. [Google Scholar]
- Dolmetsch, R.E.; Xu, K.; Lewis, R.S. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 1998, 392, 933–936. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Valencia, I.; Zhong, F.; McColl, K.S.; Roderick, H.L.; Bootman, M.D.; Berridge, M.J.; Conway, S.J.; Holmes, A.B.; Mignery, G.A.; et al. Bcl-2 functionally interacts with inositol 1,4,5-trisphosphate receptors to regulate calcium release from the ER in response to inositol 1,4,5-trisphosphate. J. Cell Biol. 2004, 166, 193–203. [Google Scholar] [CrossRef] [PubMed]
- Filadi, R.; Theurey, P.; Pizzo, P. The endoplasmic reticulum-mitochondria coupling in health and disease: Molecules, functions and significance. Cell Calcium 2017, 62, 1–15. [Google Scholar] [CrossRef]
- Rodriguez, D.; Rojas-Rivera, D.; Hetz, C. Integrating stress signals at the endoplasmic reticulum: The BCL-2 protein family rheostat. Biochim. Biophys. Acta 2011, 1813, 564–574. [Google Scholar] [CrossRef] [PubMed]
- Szegezdi, E.; Macdonald, D.C.; Ní Chonghaile, T.; Gupta, S.; Samali, A. Bcl-2 family on guard at the ER. Am. J. Physiol. Cell Physiol. 2009, 296, C941–C953. [Google Scholar] [CrossRef]
- Lam, M.; Dubyak, G.; Chen, L.; Nuñez, G.; Miesfeld, R.L.; Distelhorst, C.W. Evidence that BCL-2 represses apoptosis by regulating endoplasmic reticulum-associated Ca2+ fluxes. Proc. Natl. Acad. Sci. USA 1994, 91, 6569–6573. [Google Scholar] [CrossRef] [PubMed]
- Kuo, T.H.; Kim, H.R.; Zhu, L.; Yu, Y.; Lin, H.M.; Tsang, W. Modulation of endoplasmic reticulum calcium pump by Bcl-2. Oncogene 1998, 17, 1903–1910. [Google Scholar] [CrossRef] [PubMed]
- Hanson, C.J.; Bootman, M.D.; Distelhorst, C.W.; Wojcikiewicz, R.J.; Roderick, H.L. Bcl-2 suppresses Ca2+ release through inositol 1,4,5-trisphosphate receptors and inhibits Ca2+ uptake by mitochondria without affecting ER calcium store content. Cell Calcium 2008, 44, 324–338. [Google Scholar] [CrossRef]
- Prole, D.L.; Taylor, C.W. Inositol 1,4,5-trisphosphate receptors and their protein partners as signalling hubs. J. Physiol. 2016, 594, 2849–2866. [Google Scholar] [CrossRef] [PubMed]
- Bittremieux, M.; Parys, J.B.; Pinton, P.; Bultynck, G. ER functions of oncogenes and tumor suppressors: Modulators of intracellular Ca2+ signaling. Biochim. Biophys. Acta 2016, 1863, 1364–1378. [Google Scholar] [CrossRef] [PubMed]
- Hafezi, S.; Rahmani, M. Targeting BCL-2 in Cancer: Advances, Challenges, and Perspectives. Cancers 2021, 13, 1292. [Google Scholar] [CrossRef] [PubMed]
- Masters, S.C.; Yang, H.; Datta, S.R.; Greenberg, M.E.; Fu, H. 14-3-3 inhibits Bad-induced cell death through interaction with serine-136. Mol. Pharmacol. 2001, 60, 1325–1331. [Google Scholar] [CrossRef]
- Wei, M.C.; Zong, W.X.; Cheng, E.H.; Lindsten, T.; Panoutsakopoulou, V.; Ross, A.J.; Roth, K.A.; MacGregor, G.R.; Thompson, C.B.; Korsmeyer, S.J. Proapoptotic BAX and BAK: A requisite gateway to mitochondrial dysfunction and death. Science 2001, 292, 727–730. [Google Scholar] [CrossRef] [PubMed]
- Zong, W.X.; Li, C.; Hatzivassiliou, G.; Lindsten, T.; Yu, Q.C.; Yuan, J.; Thompson, C.B. Bax and Bak can localize to the endoplasmic reticulum to initiate apoptosis. J. Cell Biol. 2003, 162, 59–69. [Google Scholar] [CrossRef] [PubMed]
- Scorrano, L.; Oakes, S.A.; Opferman, J.T.; Cheng, E.H.; Sorcinelli, M.D.; Pozzan, T.; Korsmeyer, S.J. BAX and BAK regulation of endoplasmic reticulum Ca2+: A control point for apoptosis. Science 2003, 300, 135–139. [Google Scholar] [CrossRef] [PubMed]
- Iino, M. Effects of adenine nucleotides on inositol 1,4,5-trisphosphate-induced calcium release in vascular smooth muscle cells. J. Gen. Physiol. 1991, 98, 681–698. [Google Scholar] [CrossRef] [PubMed]
- Bezprozvanny, I.; Ehrlich, B.E. ATP modulates the function of inositol 1,4,5-trisphosphate-gated channels at two sites. Neuron 1993, 10, 1175–1184. [Google Scholar] [CrossRef]
- Betzenhauser, M.J.; Yule, D.I. Regulation of inositol 1,4,5-trisphosphate receptors by phosphorylation and adenine nucleotides. Curr. Top. Membr. 2010, 66, 273–298. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Betzenhauser, M.J.; Won, J.H.; Chen, J.; Yule, D.I. The type 2 inositol (1,4,5)-trisphosphate (InsP3) receptor determines the sensitivity of InsP3-induced Ca2+ release to ATP in pancreatic acinar cells. J. Biol. Chem. 2008, 283, 26081–26088. [Google Scholar] [CrossRef] [PubMed]
- Anyatonwu, G.; Khan, M.T.; Schug, Z.T.; da Fonseca, P.C.; Morris, E.P.; Joseph, S.K. Calcium-dependent conformational changes in inositol trisphosphate receptors. J. Biol. Chem. 2010, 285, 25085–25093. [Google Scholar] [CrossRef]
- Khan, M.T.; Wagner, L., 2nd; Yule, D.I.; Bhanumathy, C.; Joseph, S.K. Akt kinase phosphorylation of inositol 1,4,5-trisphosphate receptors. J. Biol. Chem. 2006, 281, 3731–3737. [Google Scholar] [CrossRef]
- Szado, T.; Vanderheyden, V.; Parys, J.B.; De Smedt, H.; Rietdorf, K.; Kotelevets, L.; Chastre, E.; Khan, F.; Landegren, U.; Söderberg, O.; et al. Phosphorylation of inositol 1,4,5-trisphosphate receptors by protein kinase B/Akt inhibits Ca2+ release and apoptosis. Proc. Natl. Acad. Sci. USA 2008, 105, 2427–2432. [Google Scholar] [CrossRef] [PubMed]
- Rönkkö, J.; Rodriguez, Y.; Rasila, T.; Torregrosa-Muñumer, R.; Pennonen, J.; Kvist, J.; Kuuluvainen, E.; Bosch, L.V.D.; Hietakangas, V.; Bultynck, G.; et al. Human IP3 receptor triple knockout stem cells remain pluripotent despite altered mitochondrial metabolism. Cell Calcium 2023, 114, 102782. [Google Scholar] [CrossRef]
- Fritzsche, S.; Strauss, C.; Scheller, C.; Leisz, S. Nimodipine Treatment Protects Auditory Hair Cells from Cisplatin-Induced Cell Death Accompanied by Upregulation of LMO4. Int. J. Mol. Sci. 2022, 23, 5780. [Google Scholar] [CrossRef] [PubMed]
- Bobe, R.; Bredoux, R.; Corvazier, E.; Lacabaratz-Porret, C.; Martin, V.; Kovács, T.; Enouf, J. How many Ca2+ATPase isoforms are expressed in a cell type? A growing family of membrane proteins illustrated by studies in platelets. Platelets 2005, 16, 133–150. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.A.; Kim, B.; Dhanasekaran, D.N.; Tsang, B.K.; Song, Y.S. Curcumin induces apoptosis by inhibiting sarco/endoplasmic reticulum Ca2+ ATPase activity in ovarian cancer cells. Cancer Lett. 2016, 371, 30–37. [Google Scholar] [CrossRef] [PubMed]
- De Ford, C.; Heidersdorf, B.; Haun, F.; Murillo, R.; Friedrich, T.; Borner, C.; Merfort, I. The clerodane diterpene casearin J induces apoptosis of T-ALL cells through SERCA inhibition, oxidative stress, and interference with Notch1 signaling. Cell Death Dis. 2016, 7, e2070. [Google Scholar] [CrossRef] [PubMed]
- Iwasaki, A.; Ohno, O.; Katsuyama, S.; Morita, M.; Sasazawa, Y.; Dan, S.; Simizu, S.; Yamori, T.; Suenaga, K. Identification of a molecular target of kurahyne, an apoptosis-inducing lipopeptide from marine cyanobacterial assemblages. Bioorg. Med. Chem. Lett. 2015, 25, 5295–5298. [Google Scholar] [CrossRef] [PubMed]
- Sehgal, P.; Szalai, P.; Olesen, C.; Praetorius, H.A.; Nissen, P.; Christensen, S.B.; Engedal, N.; Møller, J.V. Inhibition of the sarco/endoplasmic reticulum (ER) Ca2+-ATPase by thapsigargin analogs induces cell death via ER Ca2+ depletion and the unfolded protein response. J. Biol. Chem. 2017, 292, 19656–19673. [Google Scholar] [CrossRef]
- Liu, Z.; Xia, Y.; Li, B.; Xu, H.; Wang, C.; Liu, Y.; Li, Y.; Li, C.; Gao, N.; Li, L. Induction of ER stress-mediated apoptosis by ceramide via disruption of ER Ca2+ homeostasis in human adenoid cystic carcinoma cells. Cell Biosci. 2014, 4, 71. [Google Scholar] [CrossRef] [PubMed]
- Krizanova, O.; Markova, J.; Pacak, K.; Skultety, L.; Soltysova, A.; Hudecova, S. Triptolide induces apoptosis through the SERCA 3 upregulation in PC12 cells. Gen. Physiol. Biophys. 2014, 33, 137–144. [Google Scholar] [CrossRef] [PubMed]
- Nishitoh, H. CHOP is a multifunctional transcription factor in the ER stress response. J. Biochem. 2012, 151, 217–219. [Google Scholar] [CrossRef]
- Wortel, I.M.N.; van der Meer, L.T.; Kilberg, M.S.; van Leeuwen, F.N. Surviving Stress: Modulation of ATF4-Mediated Stress Responses in Normal and Malignant Cells. Trends Endocrinol. Metab. 2017, 28, 794–806. [Google Scholar] [CrossRef]
- Zinszner, H.; Kuroda, M.; Wang, X.; Batchvarova, N.; Lightfoot, R.T.; Remotti, H.; Stevens, J.L.; Ron, D. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 1998, 12, 982–995. [Google Scholar] [CrossRef]
- Marciniak, S.J.; Yun, C.Y.; Oyadomari, S.; Novoa, I.; Zhang, Y.; Jungreis, R.; Nagata, K.; Harding, H.P.; Ron, D. CHOP induces death by promoting protein synthesis and oxidation in the stressed endoplasmic reticulum. Genes. Dev. 2004, 18, 3066–3077. [Google Scholar] [CrossRef] [PubMed]
- Oyadomari, S.; Araki, E.; Mori, M. Endoplasmic reticulum stress-mediated apoptosis in pancreatic beta-cells. Apoptosis 2002, 7, 335–345. [Google Scholar] [CrossRef] [PubMed]
- D’Antonio, M.; Feltri, M.L.; Wrabetz, L. Myelin under stress. J. Neurosci. Res. 2009, 87, 3241–3249. [Google Scholar] [CrossRef] [PubMed]
- Rutkowski, D.T.; Arnold, S.M.; Miller, C.N.; Wu, J.; Li, J.; Gunnison, K.M.; Mori, K.; Sadighi Akha, A.A.; Raden, D.; Kaufman, R.J. Adaptation to ER stress is mediated by differential stabilities of pro-survival and pro-apoptotic mRNAs and proteins. PLoS Biol. 2006, 4, e374. [Google Scholar] [CrossRef] [PubMed]
- Rathinam, R.; Ghosh, S.; Neumann, W.L.; Jamesdaniel, S. Cisplatin-induced apoptosis in auditory, renal, and neuronal cells is associated with nitration and downregulation of LMO4. Cell Death Discov. 2015, 1, 15052. [Google Scholar] [CrossRef]
- Pandey, N.R.; Zhou, X.; Zaman, T.; Cruz, S.A.; Qin, Z.; Lu, M.; Keyhanian, K.; Brunel, J.M.; Stewart, A.F.; Chen, H.H. LMO4 is required to maintain hypothalamic insulin signaling. Biochem. Biophys. Res. Commun. 2014, 450, 666–672. [Google Scholar] [CrossRef] [PubMed]
- Tan, Z.; Chen, Y.; Xie, W.; Liu, X.; Zhu, Y. Nimodipine attenuates tau phosphorylation at Ser396 via miR-132/GSK-3β pathway in chronic cerebral hypoperfusion rats. Eur. J. Pharmacol. 2018, 819, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Schampel, A.; Volovitch, O.; Koeniger, T.; Scholz, C.J.; Jörg, S.; Linker, R.A.; Wischmeyer, E.; Wunsch, M.; Hell, J.W.; Ergün, S.; et al. Nimodipine fosters remyelination in a mouse model of multiple sclerosis and induces microglia-specific apoptosis. Proc. Natl. Acad. Sci. USA 2017, 114, E3295–E3304. [Google Scholar] [CrossRef]
- Boltz, F.; Enders, M.; Feigenspan, A.; Kirchner, P.; Ekici, A.; Kuerten, S. Nimodipine Exerts Beneficial Effects on the Rat Oligodendrocyte Cell Line OLN-93. Brain Sci. 2022, 12, 476. [Google Scholar] [CrossRef] [PubMed]
- Enders, M.; Weier, A.; Chunder, R.; An, Y.; Bremm, F.; Feigenspan, A.; Buettner, C.; Ekici, A.B.; Mingardo, E.; Odermatt, B.; et al. Impact of the Voltage-Gated Calcium Channel Antagonist Nimodipine on the Development of Oligodendrocyte Precursor Cells. Int. J. Mol. Sci. 2023, 24, 3716. [Google Scholar] [CrossRef] [PubMed]
- Lowin, T.; Tingting, R.; Zurmahr, J.; Classen, T.; Schneider, M.; Pongratz, G. Cannabidiol (CBD): A killer for inflammatory rheumatoid arthritis synovial fibroblasts. Cell Death Dis. 2020, 11, 714. [Google Scholar] [CrossRef] [PubMed]






| Functional Clustering | Gene Name (Protein) | Osmotic Stress | Oxidative Stress | Nimodipine Treatment | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Without Stress | Osmotic Stress | Oxidative Stress | |||||||||
| fc | p | fc | p | fc | p | fc | p | fc | p | ||
| Transcriptional regulator | Lmo4 | −1.7 | 0.02 * | 1.2 | 0.21 | 1.4 | 0.03 * | 1.7 | 0.004 * | 1.8 | 0.04 * |
| Neurotrophic factors | Bndf | 1.9 | 0.01 * | 2.2 | 0.003 * | 1.4 | 0.25 | 1.2 | 0.33 | 1.2 | 0.16 |
| Ntf4 (NT4) | 1.2 | 0.68 | 2.3 | 0.06 | 1.2 | 0.20 | −1.2 | 0.36 | 1.0 | 0.91 | |
| Ngf | 1.4 | 0.15 | 2.1 | 0.07 | 1.1 | 0.42 | 1.4 | 0.21 | 1.1 | 0.78 | |
| Calcium regulation | Iptr1 (IP3R1) | −1.1 | 0.65 | 2.0 | 0.02 * | 1.1 | 0.78 | 1.0 | 0.88 | −1.3 | 0.32 |
| Iptr2 (IP3R2) | 4.0 | 0.04 * | 3.6 | 0.002 * | 1.9 | 0.15 | 1.6 | 0.04 * | 1.3 | 0.20 | |
| Iptr3 (IP3R3) | −1.2 | 0.16 | 1.8 | 0.15 | 1.3 | 0.03 * | −1.1 | 0.52 | −1.1 | 0.69 | |
| Atp2a1 (SERCA1) | 1.3 | 0.60 | 1.8 | 0.37 | −1.3 | 0.42 | 1.0 | 0.95 | −1.1 | 0.85 | |
| Atp2a2 (SERCA2) | −1.1 | 0.25 | 1.9 | 0.03 * | 1.1 | 0.08 | 1.3 | 0.15 | 1.1 | 0.69 | |
| Atp2a3 (SERCA3) | 1.3 | 0.18 | 3.0 | 0.007 * | 1.6 | 0.005 * | 1.6 | 0.04 * | 1.8 | 0.07 | |
| Cacna1c (Cav1.2) | 3.8 | 1.7 × 10−6 * | 3.1 | 0.002 * | 1.0 | 0.90 | −1.5 | 0.03 * | −1.5 | 0.12 | |
| ER stress | Ddit3 (CHOP) | 1.1 | 0.56 | 3.3 | 0.03 * | 1.6 | 0.007 * | 1.6 | 0.10 | 1.2 | 0.58 |
| Eif2ak3 (PERK) | 1.1 | 0.34 | 1.8 | 0.01 * | 1.3 | 0.11 | −1.1 | 0.63 | −1.1 | 0.74 | |
| Atf4 | −1.7 | 0.03 * | 1.7 | 0.008 * | 1.5 | 0.02 * | 1.7 | 0.005 * | 1.0 | 0.96 | |
| Mitochondrial apoptosis | Bad | 1.3 | 0.14 | 2.5 | 0.03 * | 1.1 | 0.07 | 1.4 | 0.19 | 1.1 | 0.78 |
| Bax | −1.5 | 0.05 * | 1.8 | 0.002 * | 1.5 | 0.003 * | 1.4 | 0.01 * | 1.3 | 0.07 | |
| Bcl2 | −2.5 | 0.001 * | 2.5 | 0.02 * | 1.2 | 0.01 * | 0.9 | 0.76 | 1.1 | 0.86 | |
| Gene Name (Protein) | Oligo Sequence 5′ to 3′ (Forward, Reverse) | Reference Sequence |
|---|---|---|
| Lmo4 | GCACGTCCTGTTACACCAAG, | NM_010723.3 |
| AGGGCTGTGGGTCTATCATG | ||
| Ngf | CATCCACCCACCCAGTCTTC, | NM_013609.3 |
| GTGTGAGTCGTGGTGCAGTA | ||
| Bdnf | TACCTGGATGCCGCAAACAT, | NM_007540.4 |
| AGTTGGCCTTTGGATACCGG | ||
| Ntf4 (NT4) | GTCCCCTGCGTCAGTACTTC, | NM_198190.1 |
| CCTGGGAGTCTGCAGTCAAC | ||
| Bax | CCAAGAAGCTGAGCGAGTGT, | NM_007527.3 |
| TTGGATCCAGACAAGCAGCC | ||
| Bad | ACATTCATCAGCAGGGACGG, | NM_007522.3 |
| ACTCATCGCTCATCCTTCGG | ||
| Bcl2 | GGGGTCATGTGTGTGGAGAG, | NM_009741.5 |
| TCAAACAGAGGTCGCATGCT | ||
| Atp2a1 (SERCA1) | AGTTTGACGATCTGCCCCTG, | NM_007504.2 |
| CCACAGCAGTACCAGATCCC | ||
| Atp2a2 (SERCA2) | GCGGTCCAAGAGTCTCCTTC, | NM_009722.3 |
| GGGCATCCTCAGCAAAGACT | ||
| Atp2a3 (SERCA3) | TTTTGAGTCACGCTTCCCCA, | NM_001163336.1 |
| AGACATCTGAAGCACCACCC | ||
| Iptr1 (IP3R1) | TGCTGCAAGGGTGATCTACG, | NM_010585.5 |
| TAACTCTCAGGCCCGGTGTA | ||
| Iptr2 (IP3R2) | GTGAAGGTGAAGGACCCGAC, | NM_019923.4 |
| TGATCCAAGAAAGCCCAGCC | ||
| Iptr3 (IP3R3) | ATCGACACCTTTGCCGATCT, | NM_080553.3 |
| GGCCGGTGTAGTCTGTCTTG | ||
| Cacna1c (Cav1.2) | TTTCCAGATGAGACCCGCAG, | NM_009781.4 |
| AGAGGCAGAGCGAAGGAAAC | ||
| Cacna1d (Cav1.3) | CGTTGCAGGCCTAGATTCCA, | NM_028981.3 |
| AGGAGCTTCGGTGTAGGGAT | ||
| Ddit3 (CHOP) | AGGAGAACGAGCGGAAAGTG, | NM_007837.4 |
| TCCGGAGAGACAGACAGGAG | ||
| Eif2ak3 (PERK) | AGCTGTGCAGGAAGGAGAAC, | NM_010121.3 |
| GCTTGGTCCCTACTTGTCCC | ||
| Atf4 | GCCTGACTCTGCTGCTTACA, | NM_009716.3 |
| GGTCATAAGGTTTGGGCCGA | ||
| Gapdh | GCACAGTCAAGGCCGAGAAT | NM_001289726.1 |
| GCCTTCTCCATGGTGGTGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leisz, S.; Fritzsche, S.; Strauss, C.; Scheller, C. The Protective Effect of Nimodipine in Schwann Cells Is Related to the Upregulation of LMO4 and SERCA3 Accompanied by the Fine-Tuning of Intracellular Calcium Levels. Int. J. Mol. Sci. 2025, 26, 864. https://doi.org/10.3390/ijms26020864
Leisz S, Fritzsche S, Strauss C, Scheller C. The Protective Effect of Nimodipine in Schwann Cells Is Related to the Upregulation of LMO4 and SERCA3 Accompanied by the Fine-Tuning of Intracellular Calcium Levels. International Journal of Molecular Sciences. 2025; 26(2):864. https://doi.org/10.3390/ijms26020864
Chicago/Turabian StyleLeisz, Sandra, Saskia Fritzsche, Christian Strauss, and Christian Scheller. 2025. "The Protective Effect of Nimodipine in Schwann Cells Is Related to the Upregulation of LMO4 and SERCA3 Accompanied by the Fine-Tuning of Intracellular Calcium Levels" International Journal of Molecular Sciences 26, no. 2: 864. https://doi.org/10.3390/ijms26020864
APA StyleLeisz, S., Fritzsche, S., Strauss, C., & Scheller, C. (2025). The Protective Effect of Nimodipine in Schwann Cells Is Related to the Upregulation of LMO4 and SERCA3 Accompanied by the Fine-Tuning of Intracellular Calcium Levels. International Journal of Molecular Sciences, 26(2), 864. https://doi.org/10.3390/ijms26020864

