Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments
Abstract
1. Introduction
2. Results
2.1. Identification of GmPIF Genes in Soybean
2.2. Phylogenetic Tree Construction, Motif, and Gene Structure Analysis
2.3. Predicting the Protein Secondary and Tertiary Structure of the GmPIF Gene
2.4. Collinearity Relation of GmPIF
2.5. Interaction Network Analysis of GmPIF Proteins
2.6. Expression Analysis of GmPIF Family Genes in Different Temperature Environments
2.7. Cis-Acting Element Analysis of the GmPIF Promoter
2.8. Identification of GmPIF3g Promoter-Interacting Protein
2.9. Y1H
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. Physicochemical Property Analysis and Subcellular Localization Prediction of GmPIF
4.3. Phylogenetic Tree Construction, Motif, and Gene Structure
4.4. GmPIF Protein Secondary and Tertiary Structure Prediction
4.5. Collinearity Relation of GmPIF
4.6. GmPIF Protein Interaction Network Analysis
4.7. Quantitative Real-Time PCR Analysis
4.8. Analysis of Cis-Acting Elements of the GmPIF Promoter
4.9. Promoter Probe Preparation of GmPIF3g
4.10. Extraction of Total Soybean Protein
4.11. Fishing Proteins to Interact with GmPIF3
4.12. Mass Spectrometry Identification
4.13. Y1H
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Leivar, P.; Monte, E. PIFs: Systems integrators in plant development. Plant Cell 2014, 26, 56–78. [Google Scholar] [CrossRef] [PubMed]
- Huai, J.; Zhang, X.; Li, J.; Ma, T.; Zha, P.; Jing, Y.; Lin, R. SEUSS and PIF4 coordinately regulate light and temperature signaling pathways to control plant growth. Mol. Plant 2018, 11, 928–942. [Google Scholar] [CrossRef]
- Leivar, P.; Quail, P.H. PIFs: Pivotal components in a cellular signaling hub. Trends Plant Sci. 2011, 16, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Leivar, P.; Monte, E.; Al-Sady, B.; Carle, C.; Storer, A.; Alonso, J.M.; Ecker, J.R.; Quail, P.H. The Arabidopsis phytochrome–interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels. Plant Cell 2008, 20, 337–352. [Google Scholar] [CrossRef] [PubMed]
- Leivar, P.; Tepperman, J.M.; Monte, E.; Calderon, R.H.; Liu, T.L.; Quail, P.H. Definition of early transcriptional circuitry involved in light–induced reversal of PIF–imposed repression of photomorphogenesis in young Arabidopsis seedlings. Plant Cell 2009, 21, 3535–3553. [Google Scholar] [CrossRef] [PubMed]
- Lyu, X.; Cheng, Q.; Qin, C.; Li, Y.; Liu, B. GmCRY1s modulate gibberellin metabolism to regulate Soybean shade avoidance in response to reduced blue light. Mol. Plant 2020, 14, 298–314. [Google Scholar] [CrossRef] [PubMed]
- Huq, E.; Al-Sady, B.; Hudson, M.; Kim, C.; Apel, K.; Quail, P.H. Phytochrome–interacting factor 1 is a critical bHLH regulator of chlorophyll biosynthesis. Science 2004, 305, 1937–1941. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, W.; Zhao, D.; Song, Y.; Lin, X.; Shen, M.; Chi, C.; Xu, B.; Zhao, J.; Deng, X.W.; et al. Light-induced remodeling of phytochrome B enables signal transduction by phytochrome-interacting factor. Cell 2024, 187, 6235–6250.E19. [Google Scholar] [CrossRef]
- Legris, M.; Nieto, C.; Sellaro, R.; Prat, S.; Casal, J.J. Perception and signalling of light and temperature cues in plants. Plant J. 2017, 90, 683–697. [Google Scholar] [CrossRef]
- Oh, E.; Zhu, J.Y.; Wang, Z.Y. Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses. Nat. Cell Biol. 2012, 14, 802–809. [Google Scholar] [CrossRef]
- Feng, S.; Martinez, C.; Gusmaroli, G.; Wang, Y.U.; Zhou, J.; Wang, F.; Chen, L.; Yu, L.; Iglesias-Pedraz, J.M.; Kircher, S.; et al. Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 2008, 451, 475–479. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.V.; Lucyshyn, D.; Jaeger, K.E.; Alós, E.; Alvey, E.; Harberd, N.P.; Wigge, P.A. Transcription factor PIF4 controls the thermosensory activation of flowering. Nature 2012, 484, 242–245. [Google Scholar] [CrossRef]
- Galvão, V.C.; Collani, S.; Horrer, D.; Schmid, M. Gibberellic acid signaling is required for ambient temperature-mediated induction of flowering in Arabidopsis thaliana. Plant J. 2015, 84, 949–962. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.; Jeong, J.; Kim, J.; Lee, N.; Kim, M.E.; Lee, S.; Kim, S.C.; Choi, G. PIF1 regulates plastid development by repressing photosynthetic genes in the endodermis. Mol. Plant 2016, 9, 1415–1427. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Han, H.; Deng, L.; Sun, C.; Xu, Y.; Lin, L.; Ren, P.R.; Zhao, J.H.; Zhai, Q.Z.; Li, C. Mediator subunit MED25 physically interacts with PHYTOCHROME INTERACTING FACTOR4 to regulate shade–induced hypocotyl elongation in tomato. Plant Physiol. 2020, 184, 1549–1562. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Yu, R.; Fan, L.M.; Wei, N.; Chen, H.; Deng, X.W. DELLA–mediated PIF degradation contributes to coordination of light and gibberellin signalling in Arabidopsis. Nat. Commun. 2016, 7, 11868. [Google Scholar] [CrossRef] [PubMed]
- De Lucas, M.; Daviere, J.M.; Rodríguez-Falcón, M.; Pontin, M.; Iglesias-Pedraz, J.M.; Lorrain, S.; Fankhauser, C.; Blázquez, N.A.; Titarenko, E.; Prat, S. A molecular framework for light and gibberellin control of cell elongation. Nature 2008, 451, 480–484. [Google Scholar] [CrossRef] [PubMed]
- Rizza, A.; Walia, A.; Lanquar, V.; Frommer, W.B.; Jones, A.M. In vivo gibberellin gradients visualized in rapidly elongating tissues. Nat. Plants 2017, 3, 803–813. [Google Scholar] [CrossRef]
- Liang, S.; Gao, X.; Wang, Y.; Zhang, H.; Yin, K.; Chen, S.; Zhang, M.; Zhao, R. Phytochrome–interacting factors regulate seedling growth through ABA signaling. Biochem. Biophys. Res. Commun. 2020, 526, 1100–1105. [Google Scholar] [CrossRef] [PubMed]
- Michaud, O.; Krahmer, J.; Galbier, F.; Lagier, M.; Galvão, V.C.; Ince, Y.Ç.; Trevisan, M.; Knerova, J.; Dickinson, P.; Hibberd, J.M.; et al. Abscisic acid modulates neighbor proximity–induced leaf hyponasty in Arabidopsis. Plant Physiol. 2023, 191, 542–557. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Sun, N.; Zheng, L.; Zhang, F.; Xiang, M.; Chen, H.; Deng, X.W.; Wei, N. Brassinosteroids promote etiolated apical structures in darkness by amplifying the ethylene response via the EBF–EIN3/PIF3 circuit. Plant Cell 2023, 35, 390–408. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Deng, C.; Feng, G.; Liu, D. Genome-wide analysis of phytochrome-interacting factor (PIF) families and their potential roles in light and gibberellin signaling in Chinese pine. BMC Genom. 2024, 25, 1017. [Google Scholar] [CrossRef]
- Yang, D.L.; Yao, J.; Mei, C.S.; Tong, X.H.; Zeng, L.J.; Li, Q.; Xiao, L.T.; Sun, T.; Li, J.; Deng, X. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc. Natl. Acad. Sci. USA 2012, 109, E1192–E1200. [Google Scholar] [CrossRef] [PubMed]
- Casal, J.J. Plant growth: Sentinel leaf tip communicates the shade threat to its base. Curr. Biol. 2023, 33, R25–R27. [Google Scholar] [CrossRef] [PubMed]
- Ljung, K.; Nemhauser, J.L.; Perata, P. New mechanistic links between sugar and hormone signalling networks. Curr. Opin. Plant Biol. 2015, 25, 130–137. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.; Choi, G. Phytochrome–interacting factors have both shared and distinct biological roles. Mol. Cells 2013, 35, 371–380. [Google Scholar] [CrossRef] [PubMed]
- Hauvermale, A.L.; Ariizumi, T.; Steber, C.M. Gibberellin signaling: A theme and variations on DELLA repression. Plant Physiol. 2012, 160, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Whitehouse, A.S.; Tisdale, M.J. Increased expression of the ubiquitin–proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB. Br. J. Cancer 2003, 89, 1116–1122. [Google Scholar] [CrossRef] [PubMed]
- Arana, M.V.; Marín-de la Rosa, N.; Maloof, J.N.; Blázquez, M.A.; Alabadí, D. Circadian oscillation of gibberellin signaling in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 9292–9297. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein–protein networks, and functional characterization of user–uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhu, J.Y.; Roh, J.; Marchive, C.; Kim, S.K.; Meyer, C.; Sun, Y.; Wang, W.F.; Wang, Z.Y. TOR signaling promotes accumulation of BZR1 to balance growth with carbon availability in Arabidopsis. Curr. Biol. 2016, 26, 1854–1860. [Google Scholar] [CrossRef]
- Jia, D.; Chen, L.G.; Yin, G.; Yang, X.; Gao, Z.; Guo, Y.; Sun, Y.; Tang, W. Brassinosteroids regulate outer ovule integument growth in part via the control of INNER NO OUTER by BRASSINOZOLE-RESISTANT family transcription factors. J. Integr. Plant Biol. 2020, 62, 1093–1111. [Google Scholar] [CrossRef]
- Bernardo-García, S.; de Lucas, M.; Martínez, C.; Espinosa-Ruiz, A.; Daviere, J.M.; Prat, S. BR–dependent phosphorylation modulates PIF4 transcriptional activity and shapes diurnal hypocotyl growth. Genes Dev. 2014, 28, 1681–1694. [Google Scholar] [CrossRef] [PubMed]
- Hao, Y.; Zong, X.; Ren, P.; Qian, Y.; Fu, A. Basic Helix–Loop–Helix (bHLH) transcription factors regulate a wide range of functions in Arabidopsis. Int. J. Mol. Sci. 2021, 22, 7152. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.Y.; Oh, E.; Wang, T.; Wang, Z.Y. TOC1–PIF4 interaction mediates the circadian gating of thermoresponsive growth in Arabidopsis. Nat. Commun. 2016, 7, 13692. [Google Scholar] [CrossRef] [PubMed]
- Tatematsu, K.; Kumagai, S.; Muto, H.; Sato, A.; Watahiki, M.K.; Harper, R.M.; Liscum, E.; Yamamoto, K.T. MASSUGU2 encodes Aux/IAA19, an auxin-regulated protein that functions together with the transcriptional activator NPH4/ARF7 to regulate differential growth responses of hypocotyl and formation of lateral roots in Arabidopsis thaliana. Plant Cell 2004, 16, 379–393. [Google Scholar] [CrossRef] [PubMed]
- Saud, S.; Shi, Z.; Xiong, L.; Danish, S.; Datta, R.; Ahmad, I.; Fahad, F.; Banout, J. Recognizing the basics of phytochrome-interacting factors in plants for abiotic stress tolerance. Plant Stress 2022, 3, 100050. [Google Scholar] [CrossRef]
- Jiang, Z.F.; Liu, D.D.; Wang, T.Q.; Liang, X.L.; Cui, Y.H.; Liu, Z.H.; Li, W.B. Concentration difference of Auxin involved in stem development in Soybean. J. Integr. Agric. 2020, 19, 953–964. [Google Scholar] [CrossRef]
- Xu, G.; Guo, C.; Shan, H.; Kong, H. Divergence of duplicate genes in exon–intron structure. Proc. Natl. Acad. Sci. USA 2012, 109, 1187–1192. [Google Scholar] [CrossRef]
- Nie, N.; Huo, J.; Sun, S.; Zuo, Z.; Chen, Y.; Liu, Q.; He, S.Z.; Gao, S.P.; Zhang, H.; Zhao, N.; et al. Genome–Wide Characterization of the PIFs Family in Sweet Potato and Functional Identification of IbPIF3.1 under Drought and Fusarium Wilt Stresses. Int. J. Mol. Sci. 2023, 24, 4092. [Google Scholar] [CrossRef] [PubMed]
- Rach, E.A.; Winter, D.R.; Benjamin, A.M.; Corcoran, D.L.; Ni, T.; Zhu, J.; Ohler, U. Transcription initiation patterns indicate divergent strategies for gene regulation at the chromatin level. PLoS Genet. 2011, 7, e1001274. [Google Scholar] [CrossRef] [PubMed]
- Wolters, H.; Jürgens, G. Survival of the flexible: Hormonal growth control and adaptation in plant development. Nat. Rev. Genet. 2009, 10, 305–317. [Google Scholar] [CrossRef]
- Xu, Y.; Zhu, Z. PIF4 and PIF4–interacting proteins: At the nexus of plant light, temperature and hormone signal integrations. Int. J. Mol. Sci. 2021, 22, 10304. [Google Scholar] [CrossRef]
- Yang, Q.; Lin, G.; Lv, H.; Wang, C.; Yang, Y.; Liao, H. Environmental and genetic regulation of plant height in soybean. BMC Plant Biol. 2021, 21, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; He, G.; Li, Y.; Yang, Z.; Liu, T.; Xie, X.; Kong, X.Y.; Sun, J. PIL transcription factors directly interact with SPLs and repress tillering/branching in plants. New Phytol. 2022, 233, 1414–1425. [Google Scholar] [CrossRef] [PubMed]
- Arya, H.; Singh, M.B.; Bhalla, P.L. Genomic and molecular analysis of conserved and unique features of soybean PIF4. Sci. Rep. 2018, 8, 12569. [Google Scholar] [CrossRef] [PubMed]
- Arya, H.; Singh, M.B.; Bhalla, P.L. Overexpression of PIF4 affects plant morphology and accelerates reproductive phase transitions in soybean. Food Energy Secur. 2021, 10, e291. [Google Scholar] [CrossRef]
- Shor, E.; Paik, I.; Kangisser, S.; Green, R.; Huq, E. PHYTOCHROME INTERACTING FACTORS mediate metabolic control of the circadian system in Arabidopsis. New Phytol. 2017, 215, 217–228. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Wang, Y.; Yu, L.; Zheng, T.; Wang, S.; Yue, Z.; Jiang, J.; Kumari, S.; Zheng, C.F.; Tang, H.B.; et al. Genome sequence and evolution of Betula platyphylla. Hortic. Res. 2021, 8. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Portis, A.R., Jr. A novel nucleus–encoded chloroplast protein, PIFI, is involved in NAD (P) H dehydrogenase complex–mediated chlororespiratory electron transport in Arabidopsis. Plant Physiol. 2007, 144, 1742–1752. [Google Scholar] [CrossRef]
- Yang, C.; Zhu, T.; Zhou, N.; Huang, S.; Zeng, Y.; Jiang, W.; Xie, Y.; Shen, W.H.; Li, L. PIF7-mediated epigenetic reprogramming promotes the transcriptional response to shade in Arabidopsis. EMBO J. 2023, 42, e111472. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Verhoeff, N.I.; Chen, Z.; Chen, S.; Wang, M.; Zhu, Z.; Ouwerkerk, P.B.F. Functions of OsDof25 in regulation of OsC4PPDK. Plant Mol. Biol. 2015, 89, 229–242. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Bo, C.; Zhang, Y.; Wang, L. PHYTOCHROME INTERACTING FACTORS PIF4 and PIF5 promote heat stress induced leaf senescence in Arabidopsis. J. Exp. Bot. 2021, 72, 4577–4589. [Google Scholar] [CrossRef] [PubMed]
- Zhou, D.; Wang, X.; Wang, X.; Mao, T. PHYTOCHROME INTERACTING FACTOR 4 regulates microtubule organization to mediate high temperature–induced hypocotyl elongation in Arabidopsis. Plant Cell 2023, 35, 2044–2061. [Google Scholar] [CrossRef] [PubMed]
- Bernula, P.; Pettkó-Szandtner, A.; Hajdu, A.; Kozma-Bognár, L.; Josse, E.M.; Ádám, É.; Nagy, F.; Viczián, A. SUMOylation of PHYTOCHROME INTERACTING FACTOR 3 promotes photomorphogenesis in Arabidopsis thaliana. New Phytol. 2021, 229, 2050–2061. [Google Scholar] [CrossRef]
- Moon, J.; Zhu, L.; Shen, H.; Huq, E. PIF1 directly and indirectly regulates chlorophyll biosynthesis to optimize the greening process in Arabidopsis. Proc. Natl. Acad. Sci. USA 2008, 105, 9433–9438. [Google Scholar] [CrossRef] [PubMed]
- Chen, A.; Huang, P.; Guo, S.; Liu, S.; Hu, X.; Liu, X. Comprehensive Analysis of Betula platyphylla Suk. PIF Gene Family and Their Potential Functions in Growth and Development. Int. J. Mol. Sci. 2022, 23, 15326. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, Y.; Huai, D.; Chen, Y.; Jiang, Y.; Ding, Y.; Kang, Y.P.; Wang, Z.H.; Yan, L.Y.; Jiang, H.F.; et al. Genome–wide identification of peanut PIF family genes and their potential roles in early pod development. Gene 2021, 781, 145539. [Google Scholar] [CrossRef] [PubMed]
- Castillon, A.; Shen, H.; Huq, E. Phytochrome interacting factors: Central players in phytochrome–mediated light signaling networks. Trends Plant Sci. 2007, 12, 514–521. [Google Scholar] [CrossRef]
- Sun, T. Gibberellin–GID1–DELLA: A pivotal regulatory module for plant growth and development. Plant Physiol. 2010, 154, 567–570. [Google Scholar] [CrossRef]
- Sun, T. The molecular mechanism and evolution of the GA–GID1–DELLA signaling module in plants. Curr. Biol. 2011, 21, R338–R345. [Google Scholar] [CrossRef] [PubMed]
- Oh, E.; Yamaguchi, S.; Hu, J.; Yusuke, J.; Jung, B.; Paik, I.; Lee, H.S.; Sun, T.P.; Kamiya, Y.J.; Choi, G. PIL5, a phytochrome–interacting bHLH protein, regulates gibberellin responsiveness by binding directly to the GAI and RGA promoters in Arabidopsis seeds. Plant Cell 2007, 19, 1192–1208. [Google Scholar] [CrossRef]
- Sun, F.; Cheng, H.; Song, Z.; Yan, H.; Liu, H.; Xiao, X.; Zhang, Z.C.; Luo, M.T.; Wu, F.; Lu, J.; et al. Phytochrome-interacting factors play shared and distinct roles in regulating shade avoidance responses in Populus trees. Plant Cell Environ. 2024, 47, 2058–2073. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Li, M.; Kim RJ, A.; Moore, C.M.; Chen, M. Daytime temperature is sensed by phytochrome B in Arabidopsis through a transcriptional activator HEMERA. Nat. Commun. 2019, 10, 140. [Google Scholar] [CrossRef]
- Jutras, B.L.; Verma, A.; Stevenson, B. Identification of novel DNA-binding proteins using DNA-affinity chromatography/pull down. Curr. Protoc. Microbiol. 2012, 24, 1F.1.1–1F.1.13. [Google Scholar] [CrossRef] [PubMed]
- Ni, M.; Tepperman, J.M.; Quail, P.H. PIF3, a phytochrome–interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix–loop–helix protein. Cell 1998, 95, 657–667. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Ni, W.; Yu, R.; Deng, X.W.; Chen, H.; Wei, N. Light–dependent degradation of PIF3 by SCFEBF1/2 promotes a photomorphogenic response in Arabidopsis. Curr. Biol. 2017, 27, 2420–2430. [Google Scholar] [CrossRef]
- Iberkleid, I.; Sela, N.; Brown Miyara, S. Meloidogyne javanica fatty acid-and retinol-binding protein (Mj-FAR-1) regulates expression of lipid-, cell wall-, stress-and phenylpropanoid-related genes during nematode infection of tomato. BMC Genom. 2015, 16, 1–26. [Google Scholar] [CrossRef]
- Tsai, R.Y.; Reed, R.R. Identification of DNA recognition sequences and protein interaction domains of the multiple-Zn-finger protein Roaz. Mol. Cell Biol. 1998, 18, 6447–6456. [Google Scholar] [CrossRef]
- Gamsjaeger, R.; Liew, C.K.; Loughlin, F.E.; Crossley, M.; Mackay, J.P. Sticky fingers: Zinc-fingers as protein-recognition motifs. Trends Biochem. Sci. 2007, 32, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.M.; Xu, J.; Clarkson, B.K.; Martinez-Yamout, M.A.; Dyson, H.J.; Case, D.A.; Gottesfeld, J.M.; Wright, P.E. Induced fit and “lock and key” recognition of 5S RNA by zinc fingers of transcription factor IIIA. J. Mol. Biol. 2006, 357, 275–291. [Google Scholar] [CrossRef]
- Czarnocka, W.; Van Der Kelen, K.; Willems, P.; Szechyńska-Hebda, M.; Shahnejat-Bushehri, S.; Balazadeh, S.; Balazadeh, S.; Rusaczonek, A.; Mueller-Roeber, B.; Breusegem, F.V.; et al. The dual role of LESION SIMULATING DISEASE 1 as a condition-dependent scaffold protein and transcription regulator. Plant Cell Environ. 2017, 40, 2644–2662. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Liu, X.; Huan, L.; Sun, M.; Liu, L.; Chen, X.; Gao, D.S.; Li, L. Genome-wide analysis of Dof family genes and their expression during bud dormancy in peach (Prunus persica). Sci. Hortic. 2017, 214, 18–26. [Google Scholar] [CrossRef]
- Ramachandran, V.; Tobimatsu, Y.; Masaomi, Y.; Sano, R.; Umezawa, T.; Demura, T.; Ohtani, M. Plant-specific Dof transcription factors VASCULAR-RELATED DOF1 and VASCULAR-RELATED DOF2 regulate vascular cell differentiation and lignin biosynthesis in Arabidopsis. Plant Mol. Biol. 2020, 104, 263–281. [Google Scholar] [CrossRef] [PubMed]
- Kurai, T.; Wakayama, M.; Abiko, T.; Yanagisawa, S.; Aoki, N.; Ohsugi, R. Introduction of the ZmDof1 gene into rice enhances carbon and nitrogen assimilation under low-nitrogen conditions. Plant Biotechnol. J. 2011, 9, 826–837. [Google Scholar] [CrossRef]
- Tanaka, M.; Takahata, Y.; Nakayama, H.; Nakatani, M.; Tahara, M. Altered carbohydrate metabolism in the storage roots of sweetpotato plants overexpressing the SRF1 gene, which encodes a Dof zinc finger transcription factor. Planta 2009, 230, 737–746. [Google Scholar] [CrossRef] [PubMed]
- Wei, Z.; Zhang, H.; Fang, M.; Lin, S.; Zhu, M.; Li, Y.; Jiang, L.; Cui, T.L.; Cui, L.W.; Kui, H.; et al. The Dof transcription factor COG1 acts as a key regulator of plant biomass by promoting photosynthesis and starch accumulation. Mol. Plant 2023, 16, 1759–1772. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Wang, B.; Jiang, Q.; Li, Z.; Jia, S.; Wang, Y.; Guo, H. Genome-wide analysis of BpDof genes and the tolerance to drought stress in birch (Betula platyphylla). PeerJ 2021, 9, e11938. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Dai, H. Brassica napus Cycling Dof Factor1 (BnCDF1) is involved in flowering time and freezing tolerance. Plant Growth Regul. 2016, 80, 315–322. [Google Scholar] [CrossRef]
- Zhang, A.; Matsuoka, K.; Kareem, A.; Robert, M.; Roszak, P.; Blob, B.; Bisht, A.; Veylder, L.D.; Voiniciuc, C.; Asahina, M.; et al. Cell-wall damage activates DOF transcription factors to promote wound healing and tissue regeneration in Arabidopsis thaliana. Curr. Biol. 2022, 32, 1883–1894.e7. [Google Scholar] [CrossRef]
- Liu, W.; Lowrey, H.; Xu, A.; Leung, C.C.; Adamchek, C.; He, J.; Du, J.; Chen, M.; Gendron, J.M. A circadian clock output functions independently of phyB to sustain daytime PIF3 degradation. Proc. Natl. Acad. Sci. USA 2024, 121, e2408322121. [Google Scholar] [CrossRef]
- Artimo, P.; Jonnalagedda, M.; Arnold, K.; Baratin, D.; Csardi, G.; De Castro, E.; Duvaud, S.; Flegel, V.; Fortier, V.; Gasteiger, E.; et al. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 2012, 40, W597–W603. [Google Scholar] [CrossRef]
- Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35 (Suppl. 2), W585–W587. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Geourjon, C.; Deleage, G. SOPMA: Significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Bioinformatics 1995, 11, 681–684. [Google Scholar] [CrossRef] [PubMed]
- Bienert, S.; Waterhouse, A.; De Beer, T.A.; Tauriello, G.; Studer, G.; Bordoli, L.; Schwede, T. The SWISS-MODEL Repository-new features and functionality. Nucleic Acids Res. 2017, 45, D313–D319. [Google Scholar] [CrossRef]
- Bolser, D.; Staines, D.M.; Pritchard, E.; Kersey, P. Ensembl plants: Integrating tools for visualizing, mining, and analyzing plant genomics data. Methods Protoc. 2016, 2016, 115–140. [Google Scholar] [CrossRef]
- Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using real–time RT–PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef] [PubMed]
- Quint, M.; Delker, C.; Franklin, K.A.; Wigge, P.A.; Halliday, K.J.; Van Zanten, M. Molecular and genetic control of plant thermomorphogenesis. Nat. Plants 2016, 2, 15190. [Google Scholar] [CrossRef]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis–acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Ji, X.; Wang, L.; Zang, D.; Wang, Y. Transcription factor-centered yeast one-hybrid assay. Methods Mol. Biol. 2018, 1794, 183–194. [Google Scholar] [CrossRef] [PubMed]
- Chou, K.C.; Shen, H.B. Cell–PLoc 2.0: An improved package of web–servers for predicting subcellular localization of proteins in various organisms. Nat. Sci. 2010, 2, 1090. [Google Scholar] [CrossRef]
- Fields, S.; Song, O. A novel genetic system to detect protein–protein interactions. Nature 1989, 340, 245–246. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Chao, D.; Ming, Z.; Xia, J. A simple method to detect the inhibition of transcription factor-DNA binding due to protein–protein interactions in vivo. Genes 2019, 10, 684. [Google Scholar] [CrossRef] [PubMed]
Name | Gene ID | Number of Amino Acids (aa) | Molecular Weight (kD) | Isoelectric Point (pI) | Chromosome Number Location | Instability Index | Subcellular Localization |
---|---|---|---|---|---|---|---|
GmPIF1a | Glyma.03G170300 | 502 | 55.04 | 5.86 | Chr03 | 67.51 | Nuclear |
GmPIF1b | Glyma.10G042800 | 489 | 54.02 | 5.84 | Chr10 | 65.8 | Nuclear |
GmPIF1c | Glyma.13G130100 | 509 | 56.36 | 5.68 | Chr13 | 62.48 | Nuclear |
GmPIF1d | Glyma.07G029900 | 272 | 29.76 | 8.05 | Chr07 | 34.14 | Nuclear |
GmPIF1e | Glyma.08G213000 | 277 | 30.32 | 6.44 | Chr08 | 44.53 | Nuclear |
GmPIF3a | Glyma.01G187600 | 375 | 40.90 | 5.61 | Chr01 | 76.09 | Nuclear |
GmPIF3b | Glyma.03G225000 | 517 | 57.39 | 8.75 | Chr03 | 57.03 | Nuclear |
GmPIF3c | Glyma.11G054600 | 381 | 41.50 | 5.87 | Chr11 | 73.06 | Nuclear |
GmPIF3d | Glyma.14G084200 | 297 | 32.63 | 8.5 | Chr14 | 68.25 | Nuclear |
GmPIF3e | Glyma.17G180800 | 296 | 32.40 | 6.4 | Chr17 | 68.22 | Nuclear |
GmPIF3f | Glyma.17G241000 | 160 | 18.48 | 9.16 | Chr18 | 89.58 | Nuclear |
GmPIF3g | Glyma.10G142600 | 691 | 74.15 | 6.43 | Chr10 | 59.7 | Nuclear |
GmPIF3h | Glyma.10G138800 | 449 | 49.16 | 8.33 | Chr10 | 51.75 | Nuclear |
GmPIF3i | Glyma.19G224700 | 633 | 68.91 | 5.72 | Chr19 | 53.17 | Nuclear |
GmPIF3j | Glyma.19G222000 | 395 | 43.83 | 9.37 | Chr19 | 51.5 | Nuclear |
GmPIF3k | Glyma.20G091200 | 722 | 77.25 | 5.95 | Chr20 | 58.88 | Nuclear |
GmPIF4a | Glyma.02G282100 | 562 | 62.23 | 6.58 | Chr02 | 59.27 | Nuclear |
GmPIF4b | Glyma.08G303900 | 525 | 57.81 | 6.41 | Chr08 | 54.57 | Nuclear |
GmPIF4c | Glyma.14G102200 | 562 | 62.11 | 6.97 | Chr14 | 55.43 | Nuclear |
GmPIF4d | Glyma.18G115700 | 547 | 60.53 | 6.58 | Chr18 | 61.23 | Nuclear |
GmPIF7a | Glyma.01G076900 | 458 | 49.17 | 8.88 | Chr01 | 47.61 | Nuclear |
GmPIF7b | Glyma.03G034000 | 397 | 44.19 | 9.41 | Chr03 | 51.91 | Nuclear |
Name | α-Helix | β-Sheet | Random Coil | Extended Strand |
---|---|---|---|---|
GmPIF1a | 27.60% | 1.99% | 66.14% | 4.18% |
GmPIF1b | 29.94% | 2.24% | 62.93% | 4.89% |
GmPIF1c | 26.89% | 2.52% | 64.71% | 5.88% |
GmPIF1d | 15.07% | 8.64% | 51.84% | 24.63% |
GmPIF1e | 18.05% | 8.66% | 48.01% | 25.27% |
GmPIF3a | 24.00% | 1.33% | 65.07% | 9.60% |
GmPIF3b | 21.47% | 2.13% | 69.05% | 7.35% |
GmPIF3c | 25.20% | 2.36% | 60.10% | 12.34% |
GmPIF3d | 23.23% | 2.36% | 62.63% | 11.78% |
GmPIF3e | 32.50% | 3.12% | 52.50% | 11.88% |
GmPIF3f | 27.36% | 2.70% | 60.14% | 9.80% |
GmPIF3g | 17.80% | 2.17% | 72.65% | 7.38% |
GmPIF3h | 26.50% | 1.11% | 65.70% | 6.68% |
GmPIF3i | 21.01% | 1.90% | 69.98% | 7.11% |
GmPIF3j | 28.19% | 2.90% | 60.04% | 8.88% |
GmPIF3k | 19.67% | 2.35% | 71.88% | 6.09% |
GmPIF4a | 21.53% | 2.85% | 69.40% | 6.23% |
GmPIF4b | 23.24% | 2.10% | 68.95% | 5.71% |
GmPIF4c | 21.71% | 2.14% | 70.82% | 5.34% |
GmPIF4d | 21.94% | 1.83% | 71.12% | 5.12% |
GmPIF7a | 27.51% | 1.09% | 67.03% | 4.37% |
GmPIF7b | 33.50% | 1.51% | 59.95% | 5.04% |
DNA | Protein | Description | Subcellular Localization |
---|---|---|---|
GmPIF3g1 | A0A178UH44 | Signal recognition particle, endoplasmic reticulum targeting | Cytoplasm |
GmPIF3g1 | A0A654FBE6 | Small GTPase-mediated signal transduction | Golgi apparatus, nucleus |
GmPIF3g1 | I1LHH9 | Dof-type zinc finger DNA-binding family protein | Nucleus |
GmPIF3g1 | I1M744 | Response to auxin stimulus | Nucleus |
GmPIF3g1 | K7L9W3 | Mitochondrion | Cytoplasm |
GmPIF3g1 | K7LKV8 | Cellulose synthase (UDP-forming) | Chloroplast, Golgi apparatus |
GmPIF3g1 | K7LWI4 | Mitochondrion | Chloroplast |
GmPIF3g1 | Q0WLB4 | Floral repressor gene FLOWERING LOCUS C (FLC) | Chloroplast nucleus |
GmPIF3g2 | A0A0R0JEC6 | Steroid biosynthetic process | Chloroplast, Golgi apparatus |
GmPIF3g2 | Q9ZPT6 | FRS5; regulation of transcription, DNA-templated | Chloroplast |
GmPIF3g2 | A0A0R0JTV5 | Translation elongation factor EF–1 alpha/Tu | Cytoplasm, nucleus |
GmPIF3g2 | A0A0R0KHR2 | Carbohydrate metabolic process | Cell membrane |
GmPIF3g2 | A0A178U7H3 | Folic acid-containing compound metabolic process | Peroxisome |
GmPIF3g2 | A0A1P8ATW4 | Golgi organization | Cell membrane, nucleus |
GmPIF3g2 | A0A1P8B118 | Raumatin and (Z)–3–hexen–1–yl acetate biosynthesis | Nucleus |
GmPIF3g2 | A0A654G701 | E3 ubiquitin ligase involved in syntaxin degradation | Nucleus |
GmPIF3g2 | A0A7G2E5T9 | Negative regulation of endopeptidase activity | Vacuole |
GmPIF3g2 | A0A7G2E6Q4 | Folic acid-containing compound biosynthetic process | Chloroplast |
GmPIF3g2 | A0A7G2E7M8 | Protein acetyltransferase complex | Nucleus |
GmPIF3g2 | A0A7G2F610 | Ubiquitin activating enzyme 2 | Nucleus |
GmPIF3g2 | C6TLV3 | Mitochondrial respiratory chain complex IV assembly | Chloroplast peroxisome |
GmPIF3g2 | I1JKS8 | Secondary metabolite biosynthetic process | Endoplasmic reticulum |
GmPIF3g2 | I1LL69 | Cell wall | Cell wall |
GmPIF3g2 | I1MMT5 | Tonoplast monosaccharide transporter3 | Cell membrane |
GmPIF3g2 | K7KQ57 | Superpathway of acetyl–CoA biosynthesis | Chloroplast |
GmPIF3g2 | K7L045 | Signal transduction | Cell membrane |
GmPIF3g2 | K7L7Q1 | Indole–3–acetate activation I | Endoplasmic reticulum |
GmPIF3g2 | K7LBX5 | Signal transduction | Nucleus |
GmPIF3g2 | K7LWI4 | Chloroplast plastid thylakoid | Chloroplast |
GmPIF3g2 | Q5GFS0 | Mitochondrion | Chloroplast, mitochondrion |
Components | The Amount Every Tube (µL) |
---|---|
5x RT Master Mix RNA template | 2 µL 1 pg−1 μg |
Nuclease-free water | To 10 µL |
Temperature | Time | ||
---|---|---|---|
37 °C 15 °C | 15 min 5 min | Reverse transcription reaction | |
98 °C | 10 s | Enzyme inactivation | |
4 °C | ∞ (preserve) |
Components | The Amount Every Tube (µL) |
---|---|
GREEN Master Mix | 10 |
Primer1 (10 µM) | 0.5 |
Primer2 (10 µM) | 0.5 |
cDNA template | 1 |
ddH2O | 8 |
Program | Cycle | Temperature | Time |
---|---|---|---|
Stage 1 Pre-denaturation | Reps: 1 | 95 °C | 5 min |
Stage 2 Cyclic reaction | Reps: 40 | 95 °C | 10 s |
55 °C | 30 s | ||
Stage 3 Dissolution curve | Machine self-contained |
Primer Name | Primer Sequence |
---|---|
GmPIF3g1–DNA oligoA | 5′TTGAGTTGACCCCACCAACACAACACACACTTAAGGACTTACGACGACTAATCCCTTTTTGTTTTTTCTTTCTTTCTTTTCTTATTTTTATTCTAACTTA3′ |
GmPIF3g1–DNA oligoB | 3′AACTCAACTGGGGTGGTTGTGTTGTGTGTGCCAACCTGAATGCTGCTGATTAGGGAAAAACAAAAAAGAAAGAAAGAAAAGAATAAAAATAAGATTGAAT5′ |
GmPIF3g2–DNA oligoA | 5′CTTAAACCACGACAACTTTTGACTAAACCATGGTTAGAACTTAGAAAGTAGAAACCCCTGAATTTCTCACTCTTTTCTGTTCCTGTCTGTCTCTTTTGTG3′ |
GmPIF3g2–DNA oligoB | 3′GAATTTGGTGCTGTTGAAAACTGATTTGGTACCAATCTTGAATCTTTCATCTTTGGGGACTTAAAGAGTGAGAAAAGACAAGGACAGACAGAGAAAACAC5′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, X.; Zhao, C.; Cui, J.; Liu, Z.; Han, D.; Chen, Q.; Yang, M.; Jiang, Z. Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments. Int. J. Mol. Sci. 2025, 26, 551. https://doi.org/10.3390/ijms26020551
Liang X, Zhao C, Cui J, Liu Z, Han D, Chen Q, Yang M, Jiang Z. Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments. International Journal of Molecular Sciences. 2025; 26(2):551. https://doi.org/10.3390/ijms26020551
Chicago/Turabian StyleLiang, Xuefeng, Caitong Zhao, Jiayang Cui, Zhihua Liu, Dezhi Han, Qingshan Chen, Mingliang Yang, and Zhenfeng Jiang. 2025. "Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments" International Journal of Molecular Sciences 26, no. 2: 551. https://doi.org/10.3390/ijms26020551
APA StyleLiang, X., Zhao, C., Cui, J., Liu, Z., Han, D., Chen, Q., Yang, M., & Jiang, Z. (2025). Genome-Wide Identification of GmPIF Family and Regulatory Pathway Analysis of GmPIF3g in Different Temperature Environments. International Journal of Molecular Sciences, 26(2), 551. https://doi.org/10.3390/ijms26020551