Vanadium Compound Treatment Modulates MC3t3-E1 Osteoblast Function
Abstract
1. Introduction
2. Results
2.1. Cellular Proliferation Is Enhanced by Treatment with Vanadium (II) Sulfate (VOSO4) and Vanadyl Acetylacetonate (VAC)
2.2. Vanadium (II) Sulfate (VOSO4) and Vanadyl Acetylacetonate (VAC) Enhance Extracellular Matrix Mineralization Through Calcium Accumulation
2.3. Vanadium (II) Sulfate (VOSO4) and Vanadyl Acetylacetonate (VAC) Stimulate Calcium Accumulation in the Extracellular Matrix
2.4. Impact of Vanadium (II) Sulfate (VOSO4) and Vanadyl Acetylacetonate (VAC) on p-Akt Protein Expression
2.5. Modulation of MC3T3-E1 Cell Gene Expression by Vanadium (II) Sulfate and Vanadyl Acetylacetonate
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Proliferation Assessment
4.3. Calcium Deposition Assay
4.4. Proteoglycan Deposition Assay
4.5. Immunoblotting
4.6. Quantitative PCR
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AA | Ascorbic Acid |
| ACP5 | Acid Phosphatase 5, Tartrate Resistant |
| Akt | Protein Kinase B |
| ARS | Alizarin Red Staining |
| BGLAP | Bone Gamma-Carboxyglutamate Protein (Osteocalcin) |
| cDNA | Complementary DNA |
| Cq | Quantification Cycle (Threshold Cycle in qPCR) |
| DMC | Differentiation Medium Control |
| DMEM | Dulbecco’s Modified Eagle Medium (or MEM as used) |
| ER | Estrogen Receptor |
| ERK1/2 | Extracellular Signal-Regulated Kinase 1/2 |
| FBS | Fetal Bovine Serum |
| FOXO1 | Forkhead Box Protein O1 |
| GAPDH | Glyceraldehyde 3-phosphate Dehydrogenase |
| HBSS | Hanks’ Balanced Salt Solution |
| HD | High Dose |
| HRP | Horseradish Peroxidase |
| IL-1 | Interleukin-1 |
| IRS | Insulin Receptor Substrate |
| LD | Low Dose |
| MAPK | Mitogen-Activated Protein Kinase |
| MC3T3-E1 | Mouse Calvaria Pre-Osteoblast Cell Line |
| MD | Medium Dose |
| MEM | Minimum Essential Medium |
| MMP | Matrix Metalloproteinase |
| MPER | Mammalian Protein Extraction Reagent |
| MTT | Methylthiazolyldiphenyl-tetrazolium Bromide |
| NTC | No Template Control |
| OPN | Osteopontin |
| p-Akt | Phosphorylated Akt |
| PCR | Polymerase Chain Reaction |
| PI3K | Phosphatidylinositol 3-Kinase |
| qPCR | Quantitative PCR |
| RNA | Ribonucleic Acid |
| RT | Reverse Transcription |
| RUNX2 | Runt-related Transcription Factor 2 |
| SDS-PAGE | Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis |
| TGF-β | Transforming Growth Factor Beta |
| TNF-α | Tumor Necrosis Factor Alpha |
| TWIST2 | Twist-Related Protein 2 |
| VAC | Vanadyl Acetylacetonate |
| VEGF | Vascular Endothelial Growth Factor |
| VOSO4 | Vanadium (IV) Oxide Sulfate |
References
- Shen, Y.; Huang, X.; Wu, J.; Lin, X.; Zhou, X.; Zhu, Z.; Pan, X.; Xu, J.; Qiao, J.; Zhang, T.; et al. The Global Burden of Osteoporosis, Low Bone Mass, and Its Related Fracture in 204 Countries and Territories, 1990–2019. Front. Endocrinol. 2022, 13, 882241. [Google Scholar] [CrossRef] [PubMed]
- Diseases, G.B.D.; Injuries, C. Global incidence, prevalence, years lived with disability (YLDs), disability-adjusted life-years (DALYs), and healthy life expectancy (HALE) for 371 diseases and injuries in 204 countries and territories and 811 subnational locations, 1990-2021: A systematic analysis for the Global Burden of Disease Study 2021. Lancet 2024, 403, 2133–2161. [Google Scholar]
- Morcos, M.W.; Al-Jallad, H.; Li, J.; Farquharson, C.; Millan, J.L.; Hamdy, R.C.; Murshed, M. PHOSPHO1 is essential for normal bone fracture healing: An Animal Study. Bone Jt. Res. 2018, 7, 397–405. [Google Scholar] [CrossRef] [PubMed]
- Cottrell, J.A.; Keshav, V.; Mitchell, A.; O’Connor, J.P. Local inhibition of 5-lipoxygenase enhances bone formation in a rat model. Bone Jt. Res. 2013, 2, 41–50. [Google Scholar] [CrossRef]
- Cottrell, J.A.; O’Connor, J.P. Pharmacological inhibition of 5-lipoxygenase accelerates and enhances fracture-healing. J. Bone Jt. Surg. Am. 2009, 91, 2653–2665. [Google Scholar] [CrossRef]
- Gandhi, A.; Beam, H.A.; O’Connor, J.P.; Parsons, J.R.; Lin, S.S. The effects of local insulin delivery on diabetic fracture healing. Bone 2005, 37, 482–490. [Google Scholar] [CrossRef]
- Hoang-Kim, A.; Gelsomini, L.; Luciani, D.; Moroni, A.; Giannini, S. Fracture healing and drug therapies in osteoporosis. Clin. Cases Miner. Bone Metab. 2009, 6, 136–143. [Google Scholar]
- O’Connor, J.P.; Kanjilal, D.; Teitelbaum, M.; Lin, S.S.; Cottrell, J.A. Zinc as a Therapeutic Agent in Bone Regeneration. Materials 2020, 13, 2211. [Google Scholar] [CrossRef]
- Pountos, I.; Georgouli, T.; Calori, G.M.; Giannoudis, P.V. Do nonsteroidal anti-inflammatory drugs affect bone healing? A critical analysis. Sci. World J. 2012, 2012, 606404. [Google Scholar] [CrossRef]
- Cottrell, J.A.; Meyenhofer, M.; Medicherla, S.; Higgins, L.; O’Connor, J.P. Analgesic effects of p38 kinase inhibitor treatment on bone fracture healing. Pain 2009, 142, 116–126. [Google Scholar] [CrossRef]
- Cottrell, J.A.; Turner, J.C.; Arinzeh, T.L.; O’Connor, J.P. The Biology of Bone and Ligament Healing. Foot Ankle Clin. 2016, 21, 739–761. [Google Scholar] [CrossRef] [PubMed]
- Cottrell, J.; O’Connor, J.P. Effect of Non-Steroidal Anti-Inflammatory Drugs on Bone Healing. Pharmaceuticals 2010, 3, 1668–1693. [Google Scholar] [CrossRef]
- O’Connor, J.P.; Capo, J.T.; Tan, V.; Cottrell, J.A.; Manigrasso, M.B.; Bontempo, N.; Parsons, J.R. A comparison of the effects of ibuprofen and rofecoxib on rabbit fibula osteotomy healing. Acta Orthop. 2009, 80, 597–605. [Google Scholar] [CrossRef]
- Adams, M.; Cottrell, J. Development and characterization of an in vitro fluorescently tagged 3D bone-cartilage interface model. Front. Endocrinol. 2024, 15, 1484912. [Google Scholar] [CrossRef]
- Bialek, P.; Kern, B.; Yang, X.; Schrock, M.; Sosic, D.; Hong, N.; Wu, H.; Yu, K.; Ornitz, D.M.; Olson, E.N.; et al. A twist code determines the onset of osteoblast differentiation. Dev. Cell 2004, 6, 423–435. [Google Scholar] [CrossRef]
- Cottrell, J.A.; Burgess, D.; Michaels, S.; Rogers, M.B. Common Cell Lines Used to Study Bone Morphogenetic Proteins (BMPs). In Bone Morphogenetic Proteins: Methods and Protocols; Springer: New York, NY, USA, 2019; Volume 1891, pp. 1–8. [Google Scholar]
- Fuller, J.; Lefferts, K.S.; Shah, P.; Cottrell, J.A. Methodology and Characterization of a 3D Bone Organoid Model Derived from Murine Cells. Int. J. Mol. Sci. 2024, 25, 4225. [Google Scholar] [CrossRef] [PubMed]
- Khalid, A.B.; Krum, S.A. Estrogen receptors alpha and beta in bone. Bone 2016, 87, 130–135. [Google Scholar] [CrossRef]
- Harada, S.; Matsumoto, T.; Ogata, E. Role of ascorbic acid in the regulation of proliferation in osteoblast-like MC3T3-E1 cells. J. Bone Miner. Res. 1991, 6, 903–908. [Google Scholar] [CrossRef] [PubMed]
- Park, J.K.; Lee, E.M.; Kim, A.Y.; Lee, E.J.; Min, C.W.; Kang, K.K.; Lee, M.M.; Jeong, K.S. Vitamin C deficiency accelerates bone loss inducing an increase in PPAR-gamma expression in SMP30 knockout mice. Int. J. Exp. Pathol. 2012, 93, 332–340. [Google Scholar] [CrossRef]
- Cornish, J.; Callon, K.E.; Reid, I.R. Insulin increases histomorphometric indices of bone formation In vivo. Calcif. Tissue Int. 1996, 59, 492–495. [Google Scholar] [CrossRef]
- Paglia, D.N.; Wey, A.; Park, A.G.; Breitbart, E.A.; Mehta, S.K.; Bogden, J.D.; Kemp, F.W.; Benevenia, J.; O’Connor, J.P.; Lin, S.S. The effects of local vanadium treatment on angiogenesis and chondrogenesis during fracture healing. J. Orthop. Res. 2012, 30, 1971–1978. [Google Scholar] [CrossRef]
- Paglia, D.N.; Wey, A.; Hreha, J.; Park, A.G.; Cunningham, C.; Uko, L.; Benevenia, J.; O’Connor, J.P.; Lin, S.S. Local vanadium release from a calcium sulfate carrier accelerates fracture healing. J. Orthop. Res. 2014, 32, 727–734. [Google Scholar] [CrossRef]
- Ippolito, J.A.; Krell, E.S.; Cottrell, J.; Meyer, R.; Clark, D.; Nguyen, D.; Sudah, S.; Munoz, M.; Lim, E.; Lin, A.; et al. Effects of local vanadium delivery on diabetic fracture healing. J. Orthop. Res. 2017, 35, 2174–2180. [Google Scholar] [CrossRef]
- Mehdi, M.Z.; Pandey, S.K.; Theberge, J.F.; Srivastava, A.K. Insulin signal mimicry as a mechanism for the insulin-like effects of vanadium. Cell Biochem. Biophys. 2006, 44, 73–81. [Google Scholar] [CrossRef]
- Mehdi, M.Z.; Srivastava, A.K. Organo-vanadium compounds are potent activators of the protein kinase B signaling pathway and protein tyrosine phosphorylation: Mechanism of insulinomimesis. Arch. Biochem. Biophys. 2005, 440, 158–164. [Google Scholar] [CrossRef] [PubMed]
- Sheng, M.H.; Lau, K.H. Role of protein-tyrosine phosphatases in regulation of osteoclastic activity. Cell Mol. Life Sci. 2009, 66, 1946–1961. [Google Scholar] [PubMed][Green Version]
- Trevino, S.; Diaz, A.; Sanchez-Lara, E.; Sanchez-Gaytan, B.L.; Perez-Aguilar, J.M.; Gonzalez-Vergara, E. Vanadium in Biological Action: Chemical, Pharmacological Aspects, and Metabolic Implications in Diabetes Mellitus. Biol. Trace Elem. Res. 2019, 188, 68–98. [Google Scholar]
- Tsave, O.; Petanidis, S.; Kioseoglou, E.; Yavropoulou, M.P.; Yovos, J.G.; Anestakis, D.; Tsepa, A.; Salifoglou, A. Role of Vanadium in Cellular and Molecular Immunology: Association with Immune-Related Inflammation and Pharmacotoxicology Mechanisms. Oxid. Med. Cell Longev. 2016, 2016, 4013639. [Google Scholar] [CrossRef]
- Lau, K.H.; Tanimoto, H.; Baylink, D.J. Vanadate stimulates bone cell proliferation and bone collagen synthesis in vitro. Endocrinology 1988, 123, 2858–2867. [Google Scholar] [CrossRef]
- Barrio, D.A.; Braziunas, M.D.; Etcheverry, S.B.; Cortizo, A.M. Maltol complexes of vanadium (IV) and (V) regulate in vitro alkaline phosphatase activity and osteoblast-like cell growth. J. Trace Elem. Med. Biol. 1997, 11, 110–115. [Google Scholar] [CrossRef] [PubMed]
- Etcheverry, S.B.; Crans, D.C.; Keramidas, A.D.; Cortizo, A.M. Insulin-mimetic action of vanadium compounds on osteoblast-like cells in culture. Arch. Biochem. Biophys. 1997, 338, 7–14. [Google Scholar] [CrossRef] [PubMed]
- Johnson, R.B.; Henderson, J.S. Enhancement by sodium orthovanadate of the formation and mineralization of bone nodules by chick osteoblasts in vitro. Arch. Oral Biol. 1997, 42, 271–276. [Google Scholar] [CrossRef]
- Pandey, S.K.; Theberge, J.F.; Bernier, M.; Srivastava, A.K. Phosphatidylinositol 3-kinase requirement in activation of the ras/C-raf-1/MEK/ERK and p70(s6k) signaling cascade by the insulinomimetic agent vanadyl sulfate. Biochemistry 1999, 38, 14667–14675. [Google Scholar] [CrossRef]
- Srivastava, A.K.; Mehdi, M.Z. Insulino-mimetic and anti-diabetic effects of vanadium compounds. Diabet. Med. 2005, 22, 2–13. [Google Scholar] [CrossRef]
- Gimeno, I.; Luis, F.; Marcuello, C.; Pallares, M.C.; Lostao, A.; de Ory, M.C.; Gomez, A.; Granados, D.; Tejedor, I.; Natividad, E.; et al. Localized Nanoscale Formation of Vanadyl Porphyrin 2D MOF Nanosheets and Their Optimal Coupling to Lumped Element Superconducting Resonators. J. Phys. Chem. C Nanomater. Interfaces 2025, 129, 973–982. [Google Scholar] [CrossRef]
- Zhao, C.; Shu, C.; Yu, J.; Zhu, Y. Metal-organic frameworks functionalized biomaterials for promoting bone repair. Mater. Today Bio 2023, 21, 100717. [Google Scholar] [CrossRef]
- DeMambro, V.E.; Maile, L.; Wai, C.; Kawai, M.; Cascella, T.; Rosen, C.J.; Clemmons, D. Insulin-like growth factor-binding protein-2 is required for osteoclast differentiation. J. Bone Miner. Res. 2012, 27, 390–400, Erratum in J. Bone Miner. Res. 2012, 27, 1436. [Google Scholar] [CrossRef] [PubMed]
- Ferron, M.; Wei, J.; Yoshizawa, T.; Del Fattore, A.; DePinho, R.A.; Teti, A.; Ducy, P.; Karsenty, G. Insulin signaling in osteoblasts integrates bone remodeling and energy metabolism. Cell 2010, 142, 296–308. [Google Scholar] [CrossRef]
- Li, J.; Tong, Q.; Shi, X.; Costa, M.; Huang, C. ERKs activation and calcium signaling are both required for VEGF induction by vanadium in mouse epidermal Cl41 cells. Mol. Cell Biochem. 2005, 279, 25–33. [Google Scholar] [CrossRef]
- Hiltunen, M.O.; Ruuskanen, M.; Huuskonen, J.; Mahonen, A.J.; Ahonen, M.; Rutanen, J.; Kosma, V.M.; Mahonen, A.; Kroger, H.; Yla-Herttuala, S. Adenovirus-mediated VEGF-A gene transfer induces bone formation in vivo. FASEB J. 2003, 17, 1147–1149. [Google Scholar] [CrossRef] [PubMed]
- Paglia, D.N.; Wey, A.; Breitbart, E.A.; Faiwiszewski, J.; Mehta, S.K.; Al-Zube, L.; Vaidya, S.; Cottrell, J.A.; Graves, D.; Benevenia, J.; et al. Effects of local insulin delivery on subperiosteal angiogenesis and mineralized tissue formation during fracture healing. J. Orthop. Res. 2013, 31, 783–791. [Google Scholar] [CrossRef]
- Weiss, R.E.; Reddi, A.H. Influence of experimental diabetes and insulin on matrix-induced cartilage and bone differentiation. Am. J. Physiol. 1980, 238, E200–E207. [Google Scholar] [CrossRef]
- Hameedaldeen, A.; Liu, J.; Batres, A.; Graves, G.S.; Graves, D.T. FOXO1, TGF-beta regulation and wound healing. Int. J. Mol. Sci. 2014, 15, 16257–16269. [Google Scholar] [CrossRef]
- Sanchez-Gonzalez, C.; Moreno, L.; Lopez-Chaves, C.; Nebot, E.; Pietschmann, P.; Rodriguez-Nogales, A.; Galvez, J.; Montes-Bayon, M.; Sanz-Medel, A.; Llopis, J. Effect of vanadium on calcium homeostasis, osteopontin mRNA expression, and bone microarchitecture in diabetic rats. Metallomics 2017, 9, 258–267. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhou, Y.; Graves, D.T. FOXO transcription factors: Their clinical significance and regulation. BioMed Res. Int. 2014, 2014, 925350. [Google Scholar] [CrossRef]
- Choi, Y.H.; Kim, Y.J.; Jeong, H.M.; Jin, Y.H.; Yeo, C.Y.; Lee, K.Y. Akt enhances Runx2 protein stability by regulating Smurf2 function during osteoblast differentiation. FEBS J. 2014, 281, 3656–3666. [Google Scholar] [CrossRef]
- Fujita, T.; Azuma, Y.; Fukuyama, R.; Hattori, Y.; Yoshida, C.; Koida, M.; Ogita, K.; Komori, T. Runx2 induces osteoblast and chondrocyte differentiation and enhances their migration by coupling with PI3K-Akt signaling. J. Cell Biol. 2004, 166, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.; Restuccia, D.F.; Lan, Q.; Hynx, D.; Dirnhofer, S.; Hess, D.; Ruegg, C.; Hemmings, B.A. Akt/PKB-mediated phosphorylation of Twist1 promotes tumor metastasis via mediating cross-talk between PI3K/Akt and TGF-beta signaling axes. Cancer Discov. 2012, 2, 248–259. [Google Scholar] [CrossRef]
- Nakamura, T.; Toita, H.; Yoshimoto, A.; Nishimura, D.; Takagi, T.; Ogawa, T.; Takeya, T.; Ishida-Kitagawa, N. Potential involvement of Twist2 and Erk in the regulation of osteoblastogenesis by HB-EGF-EGFR signaling. Cell Struct. Funct. 2010, 35, 53–61. [Google Scholar] [CrossRef]
- Gao, N.; Ding, M.; Zheng, J.Z.; Zhang, Z.; Leonard, S.S.; Liu, K.J.; Shi, X.; Jiang, B.H. Vanadate-induced expression of hypoxia-inducible factor 1 alpha and vascular endothelial growth factor through phosphatidylinositol 3-kinase/Akt pathway and reactive oxygen species. J. Biol. Chem. 2002, 277, 31963–31971. [Google Scholar] [CrossRef]
- Nimmanon, T.; Ziliotto, S.; Morris, S.; Flanagan, L.; Taylor, K.M. Phosphorylation of zinc channel ZIP7 drives MAPK, PI3K and mTOR growth and proliferation signalling. Metallomics 2017, 9, 471–481. [Google Scholar] [CrossRef] [PubMed]
- Norouzi, S.; Adulcikas, J.; Sohal, S.S.; Myers, S. Zinc stimulates glucose oxidation and glycemic control by modulating the insulin signaling pathway in human and mouse skeletal muscle cell lines. PLoS ONE 2018, 13, e0191727. [Google Scholar] [CrossRef] [PubMed]
- Burgess, D.; Cottrell, J.; Iversen, T. Zinc Chloride Treatment in ATDC5 cells Induces Chondrocyte Maturation. Biol. Med. Res. Int. 2018, 1, 1–11. [Google Scholar]





| Oligo Name | Sequence |
|---|---|
| B-Actin_R | GACAGGATGCAGAAGGAGATTACTG |
| B-Actin_F | CCACCGATCCACACAGAGTACTT |
| ACP5_F | TGAGGACGTATTCTCTGACCG |
| ACP5_R | CACATTGGTCTGTGGGATCTTG |
| BGLAP_F | GGCGCTACCTGTATCAATGG |
| BGLAP_R | GTGGTCAGCCAACTCGTCA |
| TWIST2_F | CGCTACAGCAAGAAATCGAGC |
| TWIST2_R | GCTGAGCTTGTCAGAGGGG |
| RUNX2_F | GACGAGGCAAGAGTTTCACC |
| RUNX2_R | GGACCGTCCACTGTCACTTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Somera, I.K.; Sosa, B.; Cottrell, J.A. Vanadium Compound Treatment Modulates MC3t3-E1 Osteoblast Function. Int. J. Mol. Sci. 2025, 26, 8682. https://doi.org/10.3390/ijms26178682
Somera IK, Sosa B, Cottrell JA. Vanadium Compound Treatment Modulates MC3t3-E1 Osteoblast Function. International Journal of Molecular Sciences. 2025; 26(17):8682. https://doi.org/10.3390/ijms26178682
Chicago/Turabian StyleSomera, Isabella K., Bryan Sosa, and Jessica A. Cottrell. 2025. "Vanadium Compound Treatment Modulates MC3t3-E1 Osteoblast Function" International Journal of Molecular Sciences 26, no. 17: 8682. https://doi.org/10.3390/ijms26178682
APA StyleSomera, I. K., Sosa, B., & Cottrell, J. A. (2025). Vanadium Compound Treatment Modulates MC3t3-E1 Osteoblast Function. International Journal of Molecular Sciences, 26(17), 8682. https://doi.org/10.3390/ijms26178682

