Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161
Reference
- Achilla, C.; Chorti, A.; Papavramidis, T.; Angelis, L.; Chatzikyriakidou, A. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161. [Google Scholar] [CrossRef]
| Method | Primer Sequence (5′ → 3′) | PCR Conditions |
|---|---|---|
| PCR of rs3761548 | F: CTTAACCAGACAGCGTAGAAGG R: CATCATCACCACGCTCTGG | 95 °C for 5 min, 30 cycles of: 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s 72 °C for 10 min |
| PCR of rs5953283 | F: AGTCTCACTCTGTCACCTAGG R: GGTGTGATGATAGTATTGTGGGG | 95 °C for 5 min, 30 cycles of: 94 °C for 45 s, 65 °C for 45 s (decreasing 0.5 °C/cycle), 72 °C for 1 min 72° for 10 min |
| For COBRA analysis | F: TTTTTTATTTTTTGGGTTTTTG R: AATAAAAAAAACAAAAACAAACAACTAA | 94 °C for 5 min, 5 cycles of: 94 °C for 20 s, 60 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 58 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 56 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 54 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 52 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 51 °C for 20 s, 72 °C for 20 s 10 cycles of: 94 °C for 20 s, 50 °C for 20 s, 72 °C for 20 s 72 °C for 2 min |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Achilla, C.; Chorti, A.; Papavramidis, T.; Angelis, L.; Chatzikyriakidou, A. Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161. Int. J. Mol. Sci. 2025, 26, 6725. https://doi.org/10.3390/ijms26146725
Achilla C, Chorti A, Papavramidis T, Angelis L, Chatzikyriakidou A. Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161. International Journal of Molecular Sciences. 2025; 26(14):6725. https://doi.org/10.3390/ijms26146725
Chicago/Turabian StyleAchilla, Charoula, Angeliki Chorti, Theodosios Papavramidis, Lefteris Angelis, and Anthoula Chatzikyriakidou. 2025. "Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161" International Journal of Molecular Sciences 26, no. 14: 6725. https://doi.org/10.3390/ijms26146725
APA StyleAchilla, C., Chorti, A., Papavramidis, T., Angelis, L., & Chatzikyriakidou, A. (2025). Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161. International Journal of Molecular Sciences, 26(14), 6725. https://doi.org/10.3390/ijms26146725

