Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161

In the original publication, there was a mistake in Table 3 as published [1]. The presented forward primer for the COBRA analysis was not the correct one used. The correct one is “F: TTTTTTATTTTTTGGGTTTTTG”. The scientific conclusions remain unaffected by this correction. The Academic Editor approved this correction. The original publication has also been updated. The corrected

Table 3. Primer sequences and conditions used in PCR amplification of FOXP3 rs3761548 and PPP1R3F rs5953283 variants and amplification of CpG islands upstream from the promoter region of FOXP3 for COBRA analysis.

Method	Primer Sequence (5′ → 3′)	PCR Conditions
PCR of rs3761548	F: CTTAACCAGACAGCGTAGAAGG R: CATCATCACCACGCTCTGG	95 °C for 5 min, 30 cycles of: 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s 72 °C for 10 min
PCR of rs5953283	F: AGTCTCACTCTGTCACCTAGG R: GGTGTGATGATAGTATTGTGGGG	95 °C for 5 min, 30 cycles of: 94 °C for 45 s, 65 °C for 45 s (decreasing 0.5 °C/cycle), 72 °C for 1 min 72° for 10 min
For COBRA analysis	F: TTTTTTATTTTTTGGGTTTTTG R: AATAAAAAAAACAAAAACAAACAACTAA	94 °C for 5 min, 5 cycles of: 94 °C for 20 s, 60 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 58 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 56 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 54 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 52 °C for 20 s, 72 °C for 20 s 5 cycles of: 94 °C for 20 s, 51 °C for 20 s, 72 °C for 20 s 10 cycles of: 94 °C for 20 s, 50 °C for 20 s, 72 °C for 20 s 72 °C for 2 min

and legend appear below.