Next Article in Journal
Laser-Induced Dimeric Photoproducts of Chlorpromazine: LC-MS Identification and Molecular Docking Evidence of Enhanced Anticancer Potential
Previous Article in Journal
Retinoic Acid Induced 1 and Smith–Magenis Syndrome: From Genetics to Biology and Possible Therapeutic Strategies
Previous Article in Special Issue
Genome-Wide DNA Methylation and Transcription Analysis Reveal the Potential Epigenetic Mechanism of Heat–Light Stress Response in the Green Macro Algae Ulva prolifera
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 14
10.3390/ijms26146663
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Overexpression of the β-Glucosidase Gene SpBGLU25 from the Desert Pioneer Plant Stipagrostis pennata Enhances the Drought Tolerance in Arabidopsis

by
Jiahuan Niu
1,†,
Jingru Wang
1,†,
Faren Zhu
1,
Xuechi Li
1,
Jianting Feng
1,
Jiliang Fan
1,
Mingsu Chen
1,
Xiaoying Li
1,
Ming Hu
1,
Zhangqi Song
1,
Zihan Li
2,
Fei Wang
1,
Rong Li
1,* and
Hongbin Li
1,*
1
Key Laboratory of Xinjiang Phytomedicine Resource and Utilization of Ministry of Education, Key Laboratory of Oasis Town and Mountain-Basin System Ecology of Bingtuan, College of Life Sciences, Shihezi University, Shihezi 832000, China
2
Department of Civil, Environmental, and Construction Engineering, College of Engineering and Computer Science, University of Central Florida, Orlando, FL 32816, USA
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(14), 6663; https://doi.org/10.3390/ijms26146663
Submission received: 19 June 2025 / Revised: 7 July 2025 / Accepted: 8 July 2025 / Published: 11 July 2025
(This article belongs to the Special Issue Plant Responses to Biotic and Abiotic Stresses)
Browse Figures
Versions Notes

Abstract

This research centers on the sand-fixing plant known as Stipagrostis pennata, from which the β-glucosidase gene SpBGLU25 was successfully cloned using the molecular cloning method. SpBGLU25 encodes a hydrophilic and stable protein made up of 193 amino acids, located in the cell membrane. qRT-PCR analysis indicated that the expression of the SpBGLU25 is closely linked to the drought stress tolerance of S. pennata. Following this, functional validation was performed using an Arabidopsis overexpression system. The overexpression of transgenic Arabidopsis lines showed significantly improved drought tolerance under PEG and mannitol treatments. Assessments of germination, root length, and physiological indicators such as proline, malondialdehyde content, soluble sugars, and relative leaf water content (RLWC) further confirmed the enhanced performance of the overexpressing plants. Additionally, the comparative transcriptomic analysis of SpBGLU25-OE Arabidopsis compared to the wild-type (WT) showed that differentially upregulated genes were primarily enriched in categories of “cellular process,” “cell,” and “catalytic activity.” KEGG pathway enrichment analysis indicated that the genes were mainly concentrated in the pathways of phenylpropanoid biosynthesis and plant hormone signal transduction. These findings provide a crucial foundation for further investigation into the function of the SpBGLU25 and its role in regulating plant tissue development and adaptation to stress. This research is anticipated to offer new theoretical insights and genetic resources for enhancing plant stress tolerance through genetic engineering.

1. Introduction

Stipagrostis pennata is a pioneering plant species found in the deserts of Xinjiang, China, where it plays a crucial role in stabilizing sand dunes and is commonly associated with sandy environments [1,2,3]. This plant thrives under conditions characterized by persistent dryness, low rainfall, significant wind erosion, and a high degree of soil sandyization [4,5,6]. Consequently, S. pennata has developed several adaptations for survival in desert ecosystems, including drought resistance, tolerance to wind erosion, and the ability to withstand sand burial [7]. Its unique rhizosheath structure allows it to flourish in extreme conditions, such as drought and high temperatures, while also enhancing sand dune stability and promoting plant diversity, highlighting its potential for ecological restoration [3,8]. Therefore, studying the drought-resistant S. pennata in this region holds considerable scientific and practical significance. Plants respond to abiotic stress through complex physiological, biochemical reactions, and molecular regulatory mechanisms [9], with enzymatic substances playing a crucial role in these processes. β-glucosidase, an important hydrolase, is significantly involved in various physiological functions, including plant growth and development, secondary metabolite synthesis, and stress responses [10,11]. As a member of the glycoside hydrolase family I, β-glucosidase catalyzes the hydrolysis of β-glycosidic bonds, thus participating in plant metabolism to regulate growth and development [12,13]. Based on amino acid sequences and conserved domain similarities, plant β-glucosidases can be categorized into eight families: GH1, GH3, GH5, GH7, GH9, GH12, GH35, and GH116 [14,15]. In plants, β-glucosidases play roles in various physiological processes, including stress defense responses, hormone metabolism, cell wall lignification, and carbohydrate metabolism [13,16]. β-glucosidase plays a crucial role in cell wall metabolism by catalyzing the hydrolysis of polysaccharides, which impacts the structure and function of the cell wall. This, in turn, affects plant cell growth, differentiation, and overall morphological development [17,18]. Lignin, a key component of the cell wall, is maintained by β-glucosidase through the degradation of oligosaccharides and the release of lignin monomers from glycosides [19,20,21]. In response to abiotic stressors like drought, high temperatures, and salt, β-glucosidase enhances plant tolerance by regulating internal signaling pathways and participating in the synthesis and metabolism of plant hormones [22]. Recent research has shown that the β-glucosidase AtBG1 can hydrolyze ABA-GE (ABA-glucosyl ester) to produce active free ABA, which is crucial for the plant’s response to dehydration [23,24,25]. The β-glucosidase gene is involved in polysaccharide metabolism, as indicated by metabolomics studies, and plays a role in the development and stress resistance of various plant organs, including rice leaves and seeds [26]. Additionally, β-glucosidase is linked to the EMP glycolytic pathway and is vital for sugar metabolism, supporting normal physiological functions [14,17].
Despite the growing recognition of β-glucosidase’s importance in plants, research on the β-glucosidase gene in desert plants like S. pennata is limited. Conducting in-depth studies on the structure, function, and regulatory mechanisms of the β-glucosidase gene in S. pennata under abiotic stress will help uncover how this plant adapts to desert conditions. This research could also provide valuable genetic resources and theoretical insights for using genetic engineering to enhance stress resistance in other plants, which is essential for advancing desert ecological restoration, agricultural production, and plant stress resistance research. Therefore, this study focuses on cloning and analyzing the expression of the β-glucosidase gene SpBGLU25 in S. pennata, aiming to establish a foundation for a better understanding of its stress resistance mechanisms.

2. Results

2.1. Phylogenetic Analysis of the SpBGLU25 Gene Sequence in Different Closely Related Species

A BLAST comparison of the SpBGLU25 protein was conducted using the NCBI database, resulting in the selection of the top 32 homologous genes with the highest sequence similarity for further analysis. The findings revealed that these genes are predominantly found in 17 species of monocots, with one sequence from each species exhibiting the greatest homology to the BGLU gene. Phylogenetic and sequence alignment analyses were performed using MEGA and DNAman, respectively, demonstrating that these genes share certain similarities. Domain analysis indicated that all BGLUs possess a common conserved domain from the Glyco_hydro superfamily (Figure 1A,C). While SpBGLU contains three conserved motifs, all other genes have more than five motifs, underscoring the high conservation of BGLU (Figure 1A).
To further investigate the evolutionary relationships of the BGLU genes, we identified members of the BGLU gene family in rice and Arabidopsis and constructed a phylogenetic tree for BGLU family members from S. pennata, rice, and Arabidopsis, as illustrated in the figure. The phylogenetic tree categorizes BGLU gene members from the three species into five subfamilies. Among these species, the BGLU members in rice are most closely related to those in S. pennata, while the BGLU members in Arabidopsis are more distantly related to those in S. pennata (Figure 1B).

2.2. Expression Analysis of SpBGLU25

To further investigate the expression changes in the β-glucosidase gene in various tissues of S. pennata under drought stress, samples were collected from the roots, nodes, leaves, and seeds. These samples were obtained at intervals of 0 h, 3 h, 6 h, 12 h, and 24 h following drought treatment and were analyzed using RT-qPCR. The quantitative PCR results indicated a significant increase in the expression of the SpBGLU25 gene after exposure to drought stress (Figure 2A). Analysis of tissue specificity revealed that the SpBGLU25 gene was predominantly expressed in the roots, nodes, and seeds, with the highest levels found in the root tissue (Figure 2B). These findings strongly suggest that the SpBGLU25 gene responds positively to drought stress. Additionally, a 35S::SpBGLU25-GFP vector was constructed, and the recombinant plasmid was introduced into onion cells. Subcellular localization was examined using a laser confocal microscope, which demonstrated that SpBGLU25 is expressed in the cell membrane of the onion cells (Figure 2C), aligning perfectly with earlier predictions.

2.3. SpBGLU25 Involvement in Plant Response to Drought Stress

2.3.1. SpBGLU25 Enhances Seed Germination Vitality and Root Growth of Arabidopsis Under Drought Stress

To evaluate the drought stress tolerance of SpBGLU25 transgenic Arabidopsis under sterile conditions, this study involved inoculating seeds from four Arabidopsis types: wild type (WT), SpBGLU25-OE, atbglu25 knockout, and SpBGLU25-atbglu25 complementation, onto 1/2 MS medium with varying concentrations of (0 mM, 150 mM, and 300 mM) to assess seed germination rates and root growth. The results indicated no significant differences in germination rates among the four types on the 1/2 MS medium without mannitol. However, under drought stress conditions induced by mannitol, the germination rate of the SpBGLU25 transgenic types was significantly higher than that of the wild type (Figure 3A). Specifically, the germination rates for the SpBGLU25 transgenic plants approached nearly 100% by the 8th and 10th days, while the atbglu25 knockout mutant seeds only reached similar rates by the 12th and 14th days. A line graph illustrating the germination rate over time showed that the SpBGLU25 transgenic Arabidopsis had the highest germination rate among the four types (Figure 3B). As mannitol concentration increased, the root lengths for all four types were inhibited (Figure 3C). Under 150 mM and 300 mM mannitol treatments, the SpBGLU25 transgenic type exhibited less root length inhibition compared to the wild type, with root elongations of 6.4 cm and 1.87 cm, respectively, compared to 4.7 cm and 0.9 cm for the wild type (Figure 3D). The root system serves as the primary organ for water uptake in plants. Arabidopsis increases its root length to expand its water absorption capacity, a vital adaptation for plants experiencing drought conditions. These findings suggest that the SpBGLU25 gene may enhance drought stress tolerance in Arabidopsis.

2.3.2. SpBGLU25 Significantly Enhances Drought Resistance in Arabidopsis by Strengthening Antioxidant Defense and Osmotic Regulation

To investigate how plants respond to drought stress, four varieties of Arabidopsis plants (wild type WT, SpBGLU25 overexpression, mutant atbglu25, and mutant complementation SpBGLU25-atbglu25) were exposed to 20% PEG stress for 12 h, 24 h, and 7 days. It was found that all Arabidopsis plants experienced varying levels of damage due to drought stress. Prior to treatment, all four varieties appeared healthy; however, after 12 h, all except the SpBGLU25 overexpression plants exhibited slight yellowing. After 24 h, the leaves of the three non-transgenic displayed significant yellowing and wilting, with the atbglu25 knockout plants suffering the most severe damage, while the SpBGLU25 overexpression plants showed the least. After 7 days of drought treatment, the wild type, atbglu25 knockout, and SpBGLU25-atbglu25 complementation plants were nearly completely dried out and dead, whereas some SpBGLU25 overexpression plants survived (Figure 4A).
To further assess the drought tolerance of the SpBGLU25 transgenic Arabidopsis, this study evaluated various physiological indicators in the four types of plants: wild type (WT), SpBGLU25 overexpression, atbglu25 knockout, and SpBGLU25-atbglu25 complementation. Measurements were taken under normal growth conditions and 24 h after the 20% PEG, focusing on indicators such as relative water content (RLWC), malondialdehyde (MDA), peroxidase (POD), superoxide dismutase (SOD), proline (Pro), soluble sugars, soluble proteins, and chlorophyll.
Under normal conditions, there were no significant differences in physiological indicators among the four Arabidopsis types. However, after the 20% PEG drought stress treatment, notable changes were observed. The SpBGLU25 transgenic overexpression type had lower malondialdehyde levels compared to the wild type, while all other indicators were significantly elevated. Specifically, RLWC was 6.5413% higher than that of the wild type; peroxidase activity increased by 2044.8 U/g; superoxide dismutase activity rose by 29.509 U/g; soluble protein content was up by 17.198 μg/mL; proline content increased by 8.649 μg/mL; and chlorophyll content grew by 0.0443 mg/g; and soluble sugar content rose by 4.3909 mg/g (Figure 4B–I).
From these experimental results, it can be concluded that the SpBGLU25 gene significantly boosts the drought tolerance of Arabidopsis by enhancing antioxidant defense and osmotic regulation, enabling transgenic plants to maintain a healthier physiological state under drought conditions.

2.4. SpBGLU25 Enhances Drought Resistance in Arabidopsis by Activating Phenylpropanoid Metabolism and ABA Signaling Pathways

To further investigate the function of the SpBGLU25 gene, we conducted transcriptome sequencing of both SpBGLU25-overexpressing and wild-type (WT) Arabidopsis plants. This was followed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses of the upregulated differentially expressed genes (UDEGs) in the SpBGLU25_vs_WT comparison. The GO analysis revealed that the enriched terms primarily encompassed categories such as cellular processes, responses to stimuli, biological regulation, developmental processes, and metabolic activities. This suggests that SpBGLU25 may influence the growth, development, and stress responses of Arabidopsis by modulating various cellular functions and biological processes (Figure 5A). Furthermore, the KEGG annotation analysis identified numerous genes involved in metabolic, genetic information processing, and signal transduction pathways (Figure 5B). A closer examination of the enrichment results indicated that the differentially expressed genes were predominantly concentrated in pathways related to tryptophan metabolism, plant hormone signal transduction, starch and sucrose metabolism, and phenylpropanoid biosynthesis. This implies that the SpBGLU25 gene may enhance Arabidopsis’s drought resistance through various metabolic pathways. To verify the accuracy of the experimental findings from the transcriptome analysis, we focused on the phenylpropanoid metabolic pathway and conducted quantitative reverse transcription polymerase chain reaction (qRT-PCR) validation on the genes that were upregulated in the abscisic acid pathway. The results demonstrated a strong correlation with the transcriptome analysis (Figure S1).
An analysis of the metabolic pathways of the upregulated genes showed that 16 genes were significantly enriched in the phenylpropanoid metabolic pathway, which consists of two main branches: the lignin pathway and the flavonoid pathway. Lignin is a key component of the secondary cell wall in plant cells and is essential for plant growth, development, and stress resistance. Plants can fortify their cell walls by adjusting their components to withstand stressful conditions. Transcriptome analysis identified several key enzyme genes associated with lignin biosynthesis, including phenylalanine ammonia lyase (PAL), cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), peroxidase superfamily protein (POD), and UDP-glucosyl transferase (UGT72E), all of which were significantly upregulated (Figure 5C). Among these, CCR and CAD facilitate the production of coniferyl alcohol, UGT72E aids in the synthesis of coniferin, and POD promotes the formation of guaiacyl lignin. This indicates that the SpBGLU25 transgene can enhance lignin production, leading to the lignification of Arabidopsis cell walls, which helps reduce water loss and mitigate drought stress. Additionally, in the plant hormone signaling pathway, the primary pathway involved is the abscisic acid (ABA) pathway, with upregulated genes including ABA receptors (PYR/PYL), protein phosphatases (PP2C), sucrose non-fermenting protein kinase (SnPK2), and ABA-responsive element binding factors (ABF) (Figure 5D). Carotenoids serve as antioxidants that help minimize oxidative damage to plants under various stress conditions. The abscisic acid generated during carotenoid metabolism is a crucial hormonal substance in plants, playing a significant role in growth, development, and stress resistance. Transcriptomic analysis revealed significant upregulation of key ABA biosynthesis pathway genes in SpBGLU25-overexpressing Arabidopsis plants, including nine 9-cis-epoxycarotenoid dioxygenases (NCEDs), abscisic aldehyde oxidase 3 (AAO3), cytochrome P450 707A (CYP707A), and β-glucosidase 1 (BG1) (Figure 5E). These findings strongly suggest that SpBGLU25 likely enhances drought tolerance in Arabidopsis by promoting ABA biosynthesis.

2.5. Detection of Germination Rate and Root Length of Four Arabidopsis Types Seeds Under ABA Treatment

To investigate the relationship between the SpBGLU25 gene and abscisic acid (ABA), experiments were conducted by incorporating various ABA concentrations (0 μM, 0.4 μM, 0.8 μM) into 1/2 MS medium. The findings revealed that as ABA concentration increased, the germination rate of plants overexpressing SpBGLU25 was slower compared to that of the atbglu25 knockout mutant Arabidopsis seeds (Figure 6A). The germination rate for SpBGLU25 overexpressing plants reached nearly 100% by the 12th and 14th days, while the atbglu25 knockout mutant seeds achieved similar rates by the 8th and 12th days, respectively (Figure 6B). Furthermore, higher ABA concentrations inhibited root lengths across all four Arabidopsis types, with the SpBGLU25 transgenic type experiencing more significant inhibition than both the wild type and the atbglu25 knockout mutant (Figure 6C,D). This observation supports the hypothesis that β-glucosidase can convert ABA-GE into biologically active free ABA. The application of exogenous ABA leads to a saturation of intracellular ABA levels in SpBGLU25 overexpressing plants, which significantly hampers seed germination and reduces root length in Arabidopsis. ABA is a crucial hormone in plants’ responses to drought stress. To further examine the impact of the SpBGLU25 gene from S. pennata on the drought resistance of Arabidopsis thaliana, we utilized four types of Arabidopsis: wild type (WT), SpBGLU25 overexpressing type, atbglu25 knockout type, and SpBGLU25—atbglu25 complementation type. We assessed the ABA content under drought stress. The results indicated that the ABA content in the SpBGLU25 overexpressing type was slightly higher than in WT under normal conditions, and under dehydration conditions, the ABA content increased by 102.605 µg/L (Figure 6E), demonstrating drought tolerance. These results suggest that the SpBGLU25 gene likely enhances drought tolerance in Arabidopsis by promoting the release of bioactive ABA.

3. Discussion

Climate change-induced abiotic stress results in reduced crop yields and production [27]. One significant abiotic stress is soil drought, which hampers the growth, development, and yield of crops globally [28,29]. Current climate trends show increasing temperatures and declining annual rainfall, suggesting that future crops will encounter more severe soil droughts [30]. To adapt to arid conditions, plants have evolved various morphological, physiological, biochemical, and molecular strategies, all regulated by multiple genes [31,32,33]. Identifying key genes that improve drought resistance is therefore crucial.
In the intricate processes of plant growth, development, and response to abiotic stress, β-glucosidase is vital. This study focuses on the sand-fixing plant S. pennata, from which the β-glucosidase gene SpBGLU25 was successfully cloned. This not only adds to the plant’s genetic resources but also sets the stage for deeper exploration of this gene’s unique functions in desert plants. Analyzing the gene’s characteristics reveals that SpBGLU25 encodes a hydrophilic protein consisting of 193 amino acids, located in the cell membrane. This localization may be significant for substance exchange and signal transduction, thereby aiding in drought stress response. qRT-PCR analysis shows a strong correlation between its expression and the drought resistance of S. pennata, while overexpression studies in transgenic Arabidopsis demonstrate a marked increase in drought resistance. Various physiological indicators further support these findings, aligning with previous research on β-glucosidase’s role in plant stress resistance and underscoring the enzyme’s importance in drought response.
GO and KEGG analyses identified the biological processes and metabolic pathways associated with the SpBGLU25 gene. The differentially expressed genes were enriched in categories such as “cellular process,” “cell,” and “catalytic activity,” as well as in key metabolic pathways like phenylpropanoid biosynthesis, plant circadian rhythm, carotenoid biosynthesis, and glycolic and dicarboxylic acid metabolism. This indicates that the SpBGLU25 gene enhances plant drought resistance through coordinated actions across multiple pathways. Notably, the phenylpropanoid biosynthesis pathway is linked to lignin production, which may strengthen plant cell walls and improve stress resilience, while the carotenoid biosynthesis pathway is connected to ABA synthesis, potentially enhancing drought resistance through hormonal regulation.

3.1. The Transgenic Arabidopsis SpBGLU25 Adapts to Drought Stress by Increasing Phenolic Compounds and Cell Wall Strength

Phenolic compounds are essential antioxidants that accumulate in plants under abiotic stress, aiding their adaptation to challenging environments and playing a significant role in stress resistance [27,34]. The enzyme phenylalanine ammonia-lyase (PAL) is one of the first in the phenylpropanoid biosynthetic pathway and is crucial for the production of various secondary metabolites, including flavonoids, lignin, and phenolic compounds [35]. For example, in Salvia miltiorrhiza, drought stress results in a significant increase in PAL gene expression and a rise in polyphenolic compounds, which help combat oxidative stress [36]. This research indicates that the overexpression of the PAL3 gene in Arabidopsis is notably elevated, suggesting that it may facilitate the accumulation of phenolic compounds by modulating the expression of essential enzyme genes in the phenylpropanoid metabolic pathway to manage excess reactive oxygen species (ROS) and cope with drought stress.
Lignin, a key component of plant cell walls, exhibits a positive correlation with drought stress, enhancing water transport and minimizing water loss [37]. The enzyme CAD (cinnamate-4-hydroxylase) is crucial for lignin synthesis and plays a significant role in the lignin production pathway [38]. Drought conditions typically lead to increased lignin deposition, which is associated with heightened CAD activity and gene expression [39]. This study found that CAD expression levels were significantly elevated, suggesting that it may assist plants in adapting to drought stress by promoting lignin synthesis and strengthening cell walls. In Arabidopsis, members of the uridine diphosphate-dependent glycosyltransferase UGT72E family have been identified as glycosylating lignin monomers [40]. The degree of glycosylation of lignin precursors is a critical mechanism for regulating the transport of these monomers, which is essential for lignin synthesis [41]. Currently, glycosyltransferases UGT72E1-3 in Arabidopsis have been shown to catalyze reactions involving phenolic alcohol derivatives, particularly sinapyl alcohol and coniferyl alcohol [42]. The formation of glycosides aids in the transmembrane transport of lignin precursors, thus influencing lignin synthesis.
In this study, the expression of the UGT72E1 gene in SpBGLU25 transgenic Arabidopsis was significantly elevated, indicating its role in regulating lignin synthesis to enhance the plant’s ability to withstand drought stress. Peroxidases play a crucial role in preventing the accumulation of H2O2 in cells and mitigating its toxic effects [43]. For instance, the expression of PRX52 in cabbage is significantly increased, which contributes to the removal of reactive oxygen species (ROS) and enhances the plant’s response to abiotic stress [44]. The PER64 gene in arbuscular mycorrhiza is crucial for salt tolerance [45]. This study observed a notable increase in the expression levels of peroxidase genes within the phenylpropanoid metabolic pathway, suggesting a connection to ROS removal and, consequently, improved drought resistance.
Drought stress adversely affects plants by causing cell dehydration, accumulating reactive oxygen species (ROS), and damaging cellular membranes, which can ultimately lead to plant death. The atbglu25 mutant, which has a defect in lignin production, struggles to withstand this damage, resulting in higher mortality rates. In contrast, lines that overexpress SpBGLU25 exhibit reduced damage when subjected to drought stress. In conclusion, the SpBGLU25 transgenic Arabidopsis enhances the accumulation of phenolic compounds, lignin, and other substances by regulating the expression of key genes in the phenylpropanoid metabolic pathway. This process helps mitigate ROS damage and strengthens cell walls through lignin synthesis, enabling the plant to better adapt to drought stress.

3.2. Transgenic Arabidopsis SpBGLU25 Adapts to Drought Stress Through Plant Hormone Signaling

Plant hormone signaling plays a vital role in how plants respond to stress, with endogenous hormones being essential for managing both biotic and abiotic challenges [46]. Various endogenous hormones have distinct functions during stress responses. Abscisic acid (ABA) is a major regulatory component involved in numerous physiological and developmental processes [29]. It can be synthesized through a complex de novo pathway or produced via the hydrolysis of inactive ABA-glucosyl ester (ABA-GE) [18]. Research conducted by Lee et al. identified the enzyme β-glucosidase gene (BGLU18) in Arabidopsis, which responds to drought stress by hydrolyzing ABA-GE to release free ABA from the endoplasmic reticulum [22]. ABA is generated or accumulated in the guard cells surrounding the stomata, resulting in stomatal closure that reduces water loss and enhances drought resistance [47]. Additionally, the enzyme nine-cis-epoxycarotenoid dioxygenase (NCED) is crucial for producing ABA by cleaving carotenoids [48]. The study demonstrated that the expression levels of key genes BG1, NCED, and AOA3 in the carotenoid biosynthesis pathway of SpBGLU25 transgenic Arabidopsis were significantly elevated, suggesting a strong link between SpBGLU25 and ABA, which responds to drought stress by increasing ABA production.
In conclusion, SpBGLU25 transgenic Arabidopsis significantly enhances the expression of key enzymes and transcription factors involved in hormone synthesis, thereby modulating plant hormone levels to mitigate drought stress. This study suggests that SpBGLU25 likely influences the plant’s drought response by regulating ABA metabolism. It promotes the hydrolysis of ABA-GE, leading to higher free ABA levels and activation of the ABA signaling pathway. This activation leads to stomatal closure, the accumulation of osmotic adjustment substances, and improved drought resistance. Furthermore, components of the ABA signaling pathway may also affect the expression of the SpBGLU25 gene, establishing a complex feedback regulatory network.
Overall, the results of this research offer new insights and genetic resources for enhancing plant stress resistance through genetic engineering, with important theoretical and practical implications.

4. Materials and Methods

4.1. Materials

4.1.1. Plant Materials

In June, S. pennata seeds were gathered using bagging techniques in the desert close to the Mosowan Reservoir in Shihezi City, located in the Xinjiang Uygur Autonomous Region. The seeds were then dehulled and treated with gibberellin before being sown in sandy soil to grow full plants for experimental purposes.

4.1.2. Experimental Reagents

The total RNA extraction kit, cDNA first strand reverse transcription kit, 2×Taq PCR Master Mix II, DNA gel recovery kit, and plasmid extraction kit utilized in this study were acquired from TIANGEN (TIANGEN Biotech (Beijing) Co., Ltd., Beijing, China). The pMD-19 T cloning vector and real-time PCR reagents were sourced from TaKaRa Bio, along with enzymes like Kpn I and Xba I. Chemical reagents such as penicillin ampicillin, kanamycin, gentamicin, MES, acetosyringone, MgCl2, and components for culture media were all domestic analytical grade products from Shanghai Shenggong Biological Engineering Company (Shanghai Shenggong Bioengineering Company, Shanghai, China). The Agrobacterium strain GV3101 and the subcellular localization vector pCAMBIA 1300 were stored at the Key Laboratory of Agricultural Biotechnology at Shihezi University in Xinjiang, while the competent E. coli strain DH 5α was obtained from Beijing Quanshijin Bio (Beijing Quanshi Jin Biological Company, Beijing, China). The synthesis of PCR primers and DNA sequencing was carried out by Xinjiang Youkang Biotechnology Co., Ltd (Xinjiang Youkang Biotechnology Co., Ltd., Xinjiang, China). and Shanghai Shenggong Biological Engineering Co., Ltd (Shanghai Shenggong Bioengineering Company, Shanghai, China). Kits for MDA, SOD, POD, chlorophyll, soluble sugars, and Pro were purchased from Solarbio Life Sciences (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), while kits for ABA and soluble proteins were sourced from Jingmei Co., Ltd (Jiangsu Jingmei Biotechnology Co., Ltd., Jiangsu, China).

4.2. Methods

4.2.1. Planting of S. pennata Seeds

Once the gathered S. pennata seeds have been dried and the seed coat has been removed, immerse them in gibberellin for 24 h. Subsequently, plant the seeds 1 cm deep in sandy soil. After 45 days, gather samples that have been treated with a 500 mmol/L mannitol solution for durations of 0 h, 3 h, 6 h, 12 h, and 24 h for additional analysis.

4.2.2. RNA Extraction and cDNA Synthesis of S. pennata

Adhere to the guidelines provided by the TIANGEN plant total RNA extraction kit for the extraction process. Once the extraction is complete, verify the integrity of the RNA with 1.1% agarose gel electrophoresis and determine the RNA concentration. Next, use a reverse transcription kit to synthesize cDNA. Store the cDNA at –20 °C.

4.2.3. Cloning of the SpBGLU25 Gene

SpBGLU25 was identified from transcriptome data based on earlier laboratory studies, and its complete coding sequence (CDS) was acquired. Primers SpBGLU25-F and SpBGLU25-R were created, along with homologous arm primers SpBGLU25-tong-F and SpBGLU25-tong-R that included KpnI and XbaI restriction sites. Using cDNA from S. pennata as a template, PCR amplification was carried out with the following reaction mixture: 2 µL of cDNA (50 ng·µL−1), 25 µL of 2×Taq PCR Master Mix, 2 µL of primer SpBGLU25-F, 2 µL of primer SpBGLU25-R, and 19 µL of ddH2O, totaling 50 µL. The amplification protocol consisted of an initial step at 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 51 °C for 30 s, and 72 °C for 1 min, concluding with a final extension at 72 °C for 5 min, and then stored at 4 °C. A 1.2% agarose gel was utilized for electrophoresis to visualize and isolate the target band, which was subsequently sent to Xinjiang Youkang Biotechnology Co., Ltd. (Xinjiang Youkang Biotechnology Co., Ltd., Xinjiang, China) for sequencing.

4.2.4. Gene Sequence Analysis

The sequence alignment analysis was carried out using DNAMAN software (Version 9). The conserved domain analysis for the feather needle wheat SpBGLU25 was conducted with the online tool ConservedDomains available on the NCBI website. The physicochemical properties of the protein encoded by SpBGLU25 were analyzed and calculated using the PortParam online tool from the ExPASy server (https://web.expasy.org/protparam/, accessed on 10 October 2024) [49]. Hydrophobicity analysis of the protein was performed using ProtScale (http://web.expasy.org/protscale/, accessed on 10 October 2024 [49]. The prediction of the protein’s secondary structure was performed using the phyre2 online tool (http://www.sbg.bio.ic.ac.uk/phyre2/, accessed on 10 October 2024) [50], while the tertiary structure prediction was carried out using alphafold (https://alphafold.ebi.ac.uk/) [50]. The subcellular localization of the protein was analyzed using the Plant-mPLoc online tool (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/, accessed on 10 October 2024) [51]. Evolutionary analysis of the protein was performed using MEGA (Version 11) [52], motif analysis was conducted using the MEME online tool [53], and the visualization of evolution, conserved domains, and motifs was performed with TBtools [54].

4.2.5. Construction of Plant Expression Vectors

The properly aligned gel recovery products were introduced into DH 5α competent cells using a homologous recombination kit, and then plated on LB solid medium with kanamycin. After a 12 h incubation at 37 °C, positive monoclonal colonies were chosen for colony PCR verification and sent to Xinjiang Youkang Biotechnology Co., Ltd. for sequencing. The sequencing results were compared to the original sequence using SnapGene, and the correctly aligned bacterial culture was used to extract plasmids following the plasmid extraction kit’s instructions. These plasmids were then transformed into Agrobacterium GV3101 via a freeze–thaw method and plated on LB solid medium containing three antibiotics (Gen 50 μg·mL−1, Kan 50 μg·mL−1, Rif 50 μg·mL−1), followed by incubation at 28 °C for 36–48 h. Single colonies were selected for colony PCR verification, and the correctly verified Agrobacterium culture was preserved.

4.2.6. Subcellular Localization

The recombinant plasmid that was successfully created was cultured in LB liquid medium with rifampicin, gentamicin, and kanamycin at a speed of 200 r/min and a temperature of 28 °C for 24 h. Afterward, the cells were harvested by centrifugation at 5000 r/min for 10 min to obtain a cell pellet. This pellet was then resuspended in MS liquid medium containing 100 mmol·L−1 MES, 10 mmol·L−1 MgCl2, and 100 μmol·L−1 AS to achieve an OD600 of 1.
Fresh onions were peeled to remove the outer three layers of scales, and the inner scales were cut into small 1 cm2 pieces. These pieces were soaked in the prepared MS liquid suspension and shaken at 200 r/min and 28 °C for 45 min. Under sterile conditions, the onion scale pieces were then carefully placed flat on MS solid medium and incubated in the dark at room temperature for 2 days. During the observation phase, the inner epidermis of the onion was gently torn to prepare slides, which were then examined and photographed using a laser confocal microscope. Subcellular localization prediction was conducted using the online tools WOLF PSORT and Cell-PLoc (accessed on 10 October 2024), with results indicating that the protein is mainly localized in the cell membrane, suggesting that this gene operates within the cell membrane.

4.2.7. Gene Expression Characterization Analysis

S. pennata samples were gathered from the roots, nodes, leaves, and seeds, including roots that underwent drought stress treatment at intervals of 0 h, 3 h, 6 h, 12 h, and 24 h. RNA was extracted from these samples, and cDNA was produced through reverse transcription. The GAPDH gene was chosen as the reference gene. Primers for SpBGLU25 were designed using the NCBI online tool (see Table 1). qRT-PCR was conducted using the reverse-transcribed cDNA as a template, following the guidelines of the fluorescent quantitative premix reagent (SYBR Green) (TIANGEN Biotech (Beijing) Co., Ltd., Beijing, China). The reaction mixture consisted of 10 μL total: 5 μL of 2× SuperReal PreMix Plus (TIANGEN Biotech (Beijing) Co., Ltd., Beijing, China), 0.5 μL of forward primer, 0.5 μL of reverse primer, 2.5 μL of cDNA template, and 1.5 μL of RNase-free ddH2O. The amplification protocol included an initial pre-denaturation at 95 °C for 15 min, followed by 95 °C for 10 s for denaturation, 52 °C for 20 s for annealing, and 72 °C for 20 s for extension, repeated for 38 cycles, with three replicates for each sample. The relative expression level of the target gene was determined using the 2–ΔΔCt method.

4.2.8. Obtaining and Identifying SpBGLU25 Gene Overexpression in Arabidopsis

Utilize the floral dip technique with Agrobacterium tumefaciens to introduce the successfully created recombinant plasmid into Arabidopsis thaliana. Select for positive seedlings on 1/2 MS medium supplemented with 4% hygromycin, gather seeds once they are fully developed, and persist in screening on hygromycin-enriched medium until you achieve homozygous T3 generation positive seedlings that overexpress SpBGLU25.

4.2.9. The Effect of Drought Stress on the Phenotype of Arabidopsis Overexpressing the SpBGLU25 Gene

A 20% PEG solution can mimic the water potential found in moderately dry soil, leading to observable changes in plants, like yellowing leaves and wilting, as well as notable physiological reactions, including the buildup of reactive oxygen species (ROS) and the peroxidation of membrane lipids. This study aims to explore how drought stress in soil affects the phenotype of Arabidopsis plants that overexpress the SpBGLU25 gene. Choose four varieties of Arabidopsis that have the same growth condition: wild type, transgenic type, knockout type, and complemented type. Plant them in a mixture of nutrient soil, vermiculite, and perlite. After twenty days, apply a drought treatment by irrigating with 20% PEG, and then observe the phenotypes and collect samples after 12 and 24 h of treatment. Following the stress treatment, gather plant samples at 0 and 24 h to analyze the levels of RLWC, MDA, ABA, Pro, soluble sugars, soluble proteins, chlorophyll, and the activities of SOD, POD, and other relevant enzymes.

4.2.10. Determination of Germination Rate and Root Length of SpBGLU25 Gene Overexpressing Arabidopsis Seeds

To investigate the seed germination of transgenic SpBGLU25 lines under varying levels of drought stress in sterile conditions, seeds from wild-type, transgenic lines, knockout, and complementation Arabidopsis were sown in 1/2 MS medium with different concentrations of mannitol (0, 150, 300 mM). Additionally, to explore the relationship between the SpBGLU25 gene and ABA, the four types of Arabidopsis seeds were planted in 1/2 MS medium with varying ABA concentrations (0, 0.4, 0.8 μM) and grown under normal conditions, with daily monitoring of germination rates. To measure root length, seeds were planted in the medium and allowed to grow vertically for two weeks before assessing root length. Each sample included three biological replicates.

4.2.11. Transcriptome Analysis

Following the disinfection and washing of the WT and SpBGLU25 Arabidopsis seeds, they were sown on 1/2 MS solid medium. After a period of ten days, the seedlings were moved to nutrient soil and allowed to grow for an additional 18–20 days to harvest the Arabidopsis plants, ensuring three biological replicates for each variant. The samples were subsequently shipped to Wuhan Aijibai Biological Company for transcriptome sequencing using dry ice for transportation.

4.2.12. Statistical Analysis

All calculations and analyses were conducted using Excel and GraphPad Prism 9.5.0 software, following these specific steps: Each physiological and biochemical index assessed under normal and drought stress conditions was repeated three times. The data were organized and statistically analyzed in Excel, while significance testing was performed using two-way ANOVA in GraphPad Prism 9.5.0, which also facilitated the creation of graphs.

5. Conclusions

In this research, the β-glucosidase gene SpBGLU25 was isolated from the sand-stabilizing plant, S. pennata. Detailed analysis revealed that the gene product is situated in the cell membrane. Comprehensive experimental studies demonstrated that the SpBGLU25 gene can effectively respond to drought conditions, significantly improving the plant’s drought tolerance. Initial findings indicate that this gene may break down ABA-GE (abscisic acid-glucosyl ester) to generate biologically active ABA (abscisic acid) and primarily produce lignin through the phenylpropanoid metabolic pathway, thereby enhancing the plant’s resilience. Furthermore, the SpBGLU25 gene collaborates with other metabolic pathways to finely tune the plant’s response to drought stress. The results of this study offer new insights into the molecular mechanisms underlying plant drought resistance and are anticipated to provide essential genetic resources and theoretical foundations for the genetic engineering of plant stress tolerance.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26146663/s1.

Author Contributions

Conceptualization, R.L. and H.L.; methodology, J.N. and J.W.; software, J.N., F.Z., and J.F.; validation, J.N., J.W., M.H., M.C., Z.S., and X.L. (Xiaoying Li); formal analysis, J.N., Z.L., and F.Z.; investigation, J.N., X.L. (Xuechi Li), and J.F.; resources, F.W., R.L., and H.L.; data curation, J.N. and J.W.; writing—original draft preparation, J.N.; writing—review and editing, R.L. and H.L.; visualization, J.N., J.W., F.Z., and J.F.; supervision, R.L. and H.L.; project administration, R.L.; funding acquisition, R.L. and H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation (32060082), Science and Technology Projects of Bingtuan (2024DA061, 2023ZD052), Science and Technology Projects of Shihezi University (ZZZC2022033, GJHZ202302).

Data Availability Statement

All data are presented in the article and the Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sun, B.; Yang, D.; Wang, F.; Li, R.; Li, H. Cloning and Expression of the Sugar Transporter Gene SpSWEET3 from the Desert Plant Stipagrostis pennata. Chin. J. Desert Res. 2023, 43, 129–138. [Google Scholar]
  2. Yin, S.; Tang, R.; Yin, Q.; Wang, F.; Li, R.; Li, H. Cloning and Expression of the Arabinofuranosidase Gene SpARAF1 from Stipagrostis pennata (Stipagrostis pennata). Chin. J. Desert Res. 2024, 44, 48–57. [Google Scholar]
  3. Zhu, L.-J.; Wang, S.-M.; Xia, J.; Zhu, H.-W. Clonal Configuration and Ramet Population Characteristics of Stipagrostis pennata in Different Habitats. J. Arid Land 2012, 29, 770–775. [Google Scholar]
  4. Liu, Y.; Xu, H.; Yan, P. A Taxonomic Study on Polygonaceae from Pamirs of China. J. Shihezi Univ. Nat. Sci. Ed. 2009, 27, 162–168. [Google Scholar]
  5. Ren, M.; Wang, S.; Zhang, X.; Wang, Z.; Yang, M. Rhizosheath soil microbial functional diversity of two typical Gramineae plants in the southern margin of the Junggar basin. J. Ecol. 2017, 37, 5630–5639. [Google Scholar]
  6. Jiao, S.; Li, X.; Zhang, T.; Ma, L. Isolation, Identification and Phylogenetic Tree Analysis of Endophytic Bacteria from Stipagrostis pennata. N. Hortic. 2020, 77–84. [Google Scholar]
  7. Jiehua, C. Study on the cellular characteristics of different populations of Stipagrostis pennata in the Junggar Basin. Ph.D. Thesis, Shihezi University, Shihezi, China, 2013. [Google Scholar]
  8. Baohua, G. Preliminary study on the drought resistance physiological mechanisms of Stipagrostis pennata. Ph.D. Thesis, Shihezi University, Shihezi, China, 2009. [Google Scholar]
  9. Long, L.; Wang, H.; Ma, X.; Xu, H.; Wang, S. Seed Rain of Stipagrostis pennata in the Gurbantonggut Desert. Arid Zone Res. 2014, 31, 516–522. [Google Scholar]
  10. Wang, C.; Li, J. Research progress on plant β-glucosidase. Biol. Res. 2021, 43, 101–109. [Google Scholar]
  11. Ketudat, C.J.; Esen, A. beta-Glucosidases. Cell. Mol. Life Sci. 2010, 67, 3389–3405. [Google Scholar] [CrossRef]
  12. Yang, J.; Ma, L.; Jiang, W.; Yao, Y.; Tang, Y.; Pang, Y. Comprehensive identification and characterization of abiotic stress and hormone responsive glycosyl hydrolase family 1 genes in Medicago truncatula. Plant Physiol. Biochem. 2021, 158, 21–33. [Google Scholar] [CrossRef]
  13. Kong, H.; Song, J.; Ma, S.; Yang, J.; Shao, Z.; Li, Q.; Li, Z.; Xie, Z.; Yang, P.; Cao, Y. Genome-wide identification and expression analysis of the glycosyl hydrolase family 1 genes in Medicago sativa revealed their potential roles in response to multiple abiotic stresses. BMC Genom. 2024, 25, 20. [Google Scholar] [CrossRef] [PubMed]
  14. Baiya, S.; Mahong, B.; Lee, S.K.; Jeon, J.S.; Cairns, J.R.K. Demonstration of monolignol beta-glucosidase activity of rice Os4BGlu14, Os4BGlu16 and Os4BGlu18 in Arabidopsis thaliana bglu45 mutant. Plant Physiol. Biochem. 2018, 127, 223–230. [Google Scholar] [CrossRef]
  15. Xu, M.; Li, H.; Luo, H.; Liu, J.; Li, K.; Li, Q.; Yang, N.; Xu, D. Unveiling the Role of beta-Glucosidase Genes in Bletilla striata’s Secondary Metabolism: A Genome-Wide Analysis. Int. J. Mol. Sci. 2024, 25, 13191. [Google Scholar] [CrossRef] [PubMed]
  16. Fan, H.X.; Miao, L.L.; Liu, Y.; Liu, H.C.; Liu, Z.P. Gene cloning and characterization of a cold-adapted beta-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus. Enzyme Microb. Technol. 2011, 49, 94–99. [Google Scholar] [CrossRef]
  17. Wang, H.; Zhang, Y.; Feng, X.; Peng, F.; Mazoor, M.A.; Zhang, Y.; Zhao, Y.; Han, W.L.; Lu, L.; Cao, Y.; et al. Analysis of the beta-Glucosidase Family Reveals Genes Involved in the Lignification of Stone Cells in Chinese White Pear (Pyrus bretschneideri Rehd.). J. Front. Plant Sci. 2022, 13, 852001. [Google Scholar] [CrossRef]
  18. Han, Y.; Watanabe, S.; Shimada, H.; Sakamoto, A. Dynamics of the leaf endoplasmic reticulum modulate beta-glucosidase-mediated stress-activated ABA production from its glucosyl ester. J. Exp. Bot. 2020, 71, 2058–2071. [Google Scholar] [CrossRef] [PubMed]
  19. Brzobohatý, B.; Moore, I.; Kristoffersen, P.; Bako, L.; Campos, N.; Schell, J.; Palme, K. Release of active cytokinin by a beta-glucosidase localized to the maize root meristem. Science 1993, 262, 1051–1054. [Google Scholar] [CrossRef]
  20. Xu, Z.Y.; Lee, K.H.; Dong, T.; Jeong, J.C.; Jin, J.B.; Kanno, Y.; Kim, D.H.; Kim, S.Y.; Seo, M.; Bressan, R.A.; et al. A vacuolar beta-glucosidase homolog that possesses glucose-conjugated abscisic acid hydrolyzing activity plays an important role in osmotic stress responses in Arabidopsis. Plant Cell. 2012, 24, 2184–2199. [Google Scholar] [CrossRef] [PubMed]
  21. Santos, C.A.; Morais, M.A.B.; Terrett, O.M.; Lyczakowski, J.J.; Zanphorlin, L.M.; Ferreira-Filho, J.A.; Tonoli, C.C.C.; Murakami, M.T.; Dupree, P.; Souza, A.P. An engineered GH1 beta-glucosidase displays enhanced glucose tolerance and increased sugar release from lignocellulosic materials. Sci. Rep. 2019, 9, 4903. [Google Scholar] [CrossRef]
  22. Lee, K.H.; Piao, H.L.; Kim, H.Y.; Choi, S.M.; Jiang, F.; Hartung, W.; Hwang, I.; Kwak, J.M.; Lee, I.J.; Hwang, I. Activation of glucosidase via stress-induced polymerization rapidly increases active pools of abscisic acid. Cell 2006, 126, 1109–1120. [Google Scholar] [CrossRef]
  23. Wang, C.; Chen, S.; Dong, Y.; Ren, R.; Chen, D.; Chen, X. Chloroplastic Os3BGlu6 contributes significantly to cellular ABA pools and impacts drought tolerance and photosynthesis in rice. New Phytol. 2020, 226, 1042–1054. [Google Scholar] [CrossRef] [PubMed]
  24. Fu, X.; Yuan, X.; Zhao, Y.; Wang, X.; Lu, L.; Wang, H.; Li, Y.; Gao, J.; Wang, L.; Zhang, H. Identification of ARF Genes and Elucidation of the Regulatory Effects of PsARF16a on the Dormancy of Tree Peony Plantlets. Genes 2024, 15, 666. [Google Scholar] [CrossRef]
  25. Wan, Q.; Yao, R.; Zhao, Y.; Xu, Y. JA and ABA signaling pathways converge to protect plant regeneration in stress conditions. Cell. Rep. 2025, 44, 115423. [Google Scholar] [CrossRef] [PubMed]
  26. Baiya, S.; Hua, Y.; Ekkhara, W.; Cairns, J.R.K. Expression and enzymatic properties of rice (Oryza sativa L.) monolignol beta-glucosidases. Plant Sci. 2014, 227, 101–109. [Google Scholar] [CrossRef]
  27. Pereira, A. Plant Abiotic Stress Challenges from the Changing Environment. Front. Plant Sci. 2016, 7, 1123. [Google Scholar] [CrossRef] [PubMed]
  28. Zheng, Z.; Yang, J.; Wang, X.; Zhang, N.; Si, H. Potato Stu-miR398b-3p Negatively Regulates Cu/Zn-SOD Response to Drought Tolerance. Int. J. Mol. Sci. 2023, 24, 2525. [Google Scholar] [CrossRef]
  29. Zhu, J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar] [CrossRef]
  30. Wang, W.; Yi, H.; Zhang, R.; Han, Y.; Wang, Y.; Zhou, F. Physiological and Ecological Changes of Ginkgo biloba Leaves During Yellowing in Semi-arid Areas. J. Anhui Agric. Sci. 2025, 53, 118–123. [Google Scholar]
  31. Wang, K.; Nan, L.; Li, J.; Liang, P.; Chen, J.; Wei, S.; Liu, X. Effects of drought stress on endogenous hormonecontents of different root-type alfalfa. China Agric. Res. Arid. Areas 2022, 40, 30–36. [Google Scholar]
  32. Nong, Y.; Wu, H.; Weng, X.; Wei, J.; Luo, Y.; Yang, J.; Chen, X.; Chen, Q. Effects of Drought Stress on the Physiological Characteristics of Seedlings of Different Tea Varieties. China J. Anhui Agric. Sci. 2024, 52, 96–100. [Google Scholar]
  33. Chu, F.; Liu, Y.; Wang, W.; Hu, Q.; Yang, A. Effects of Drought Stress on Active Oxygen Metabolism, Osmotic Regulators, SPAD and Chlorophyll Fluorescence Characteristics of Sweet Potato. Chin. Agric. Bull. 2019, 35, 29–34. [Google Scholar]
  34. Shao, Z.; Yang, B.; Zhu, C.; Li, D.; Guo, J. Phenolic Content and Antioxidant Activity in Leaves of Cerasus humilis at Different Growth Stages. China Acta Bot. Northwestica 2022, 42, 1720–1727. [Google Scholar]
  35. Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, S.; Qi, X.; Zhu, R.; Ye, D.; Shou, M.; Peng, L.; Qiu, M.; Shi, M.; Kai, G. Transcriptome Analysis of Salvia miltiorrhiza under Drought Stress. Plants 2024, 13, 161. [Google Scholar] [CrossRef] [PubMed]
  37. Lee, D.K.; Yoon, S.; Kim, Y.S.; Kim, J.J. Rice OsERF71-mediated root modification affects shoot drought tolerance. Plant Signal. Behav. 2017, 12, e1268311. [Google Scholar] [CrossRef]
  38. Hu, L.; Zhang, Z.; Ni, H.; Yuan, F.; Zhang, S. Identification and Functional Analysis of CAD Gene Family in Pomegranate (Punica granatum). Genes 2022, 14, 26. [Google Scholar] [CrossRef]
  39. Moura, J.C.M.S.; Bonine, C.A.V.; De Oliveira Fernandes Viana, J.; Dornelas, M.C.; Mazzafera, P. Abiotic and biotic stresses and changes in the lignin content and composition in plants. J. Integr. Plant Biol. 2010, 52, 360–376. [Google Scholar] [CrossRef]
  40. Wang, Y. Transgenic Study on the Relationship between Poplar Glycosyltransferase and Lignin Synthesis. Shandong University, 2012. [Google Scholar]
  41. Lanot, A.; Hodge, D.; Lim, E.K.; Vaistij, F.E.; Bowles, D.J. Redirection of flux through the phenylpropanoid pathway by increased glucosylation of soluble intermediates. Planta 2008, 228, 609–616. [Google Scholar] [CrossRef]
  42. Yuan, H.; Guo, W.; Zhao, L.; Yu, Y.; Wu, J.; Cheng, L.; Zhao, D.; Kang, Q.; Huang, W. Cloning and Expression Analysis of the Glycosyltransferase Gene LuUGT72E1 in Flax. China J. Crops 2016, 62–67. [Google Scholar]
  43. Yanqing, J. Study on the Mechanism of Peroxidase Gene TaPrx109-B1 in Enhancing Drought Resistance in Wheat. Ph.D. Thesis, Henan Agricultural University, Henan, China, 2024. [Google Scholar]
  44. Zhang, L.; Dai, Y.; Yue, L.; Chen, G.; Yuan, L.; Zhang, S.; Li, F.; Zhang, H.; Li, G.; Zhu, S.; et al. Heat stress response in Chinese cabbage (Brassica rapa L.) revealed by transcriptome and physiological analysis. PeerJ 2022, 10, e13427. [Google Scholar] [CrossRef]
  45. Wang, Y.; Dong, F.; Tang, M. Transcriptome Analysis of Arbuscular Mycorrhizal Casuarina glauca in Damage Mitigation of Roots on NaCl Stress. Microorganisms 2021, 10, 15. [Google Scholar] [CrossRef] [PubMed]
  46. Yong, Q.; Li, Z.; Qu, Y. Response of Endogenous Hormones in Camellia oleifera to Drought Stress and Rehydration Based on Transcriptome Analysis. Southwest Agric. J. 2024, 37, 913–924. [Google Scholar]
  47. Lee, S.C.; Luan, S. ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant Cell Environ. 2012, 35, 53–60. [Google Scholar] [CrossRef]
  48. Fatima, O.A. A Comprehensive Analysis of the 9-Cis Epoxy Carotenoid Dioxygenase Gene Family and Their Responses to Salt Stress in Hordeum vulgare L. Plants 2024, 13, 3327. [Google Scholar] [CrossRef]
  49. Garg, V.K.; Avashthi, H.; Tiwari, A.; Jain, P.A.; Ramkete, P.W.; Kayastha, A.M.; Singh, V.K. MFPPI—Multi FASTA ProtParam Interface. Bioinformation 2016, 12, 74–77. [Google Scholar] [CrossRef]
  50. Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef]
  51. Varadi, M.; Anyango, S.; Deshpande, M.; Nair, S.; Natassia, C.; Yordanova, G.; Yuan, D.; Stroe, O.; Wood, G.; Laydon, A. AlphaFold Protein Structure Database: Massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 2022, 50(D1), D439–D444. [Google Scholar] [CrossRef] [PubMed]
  52. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  53. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
  54. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
Ijms 26 06663 g001
Figure 1. Multiple sequence alignment and motif analysis of BGLU from different species. (A): Structural domain and motif analysis of BGLU from different species. (B): Phylogenetic analysis of the BGLU family in Arabidopsis, rice, and S. pennata species. (C): Multiple sequence alignment of BGLU from different species.
Figure 1. Multiple sequence alignment and motif analysis of BGLU from different species. (A): Structural domain and motif analysis of BGLU from different species. (B): Phylogenetic analysis of the BGLU family in Arabidopsis, rice, and S. pennata species. (C): Multiple sequence alignment of BGLU from different species.
Ijms 26 06663 g001
Ijms 26 06663 g002
Figure 2. Expression analysis of the SpBGLU25 gene (A): Expression levels of the SpBGLU25 gene under different drought stress durations. (B): Expression of the SpBGLU25 gene in different tissues of S. pennata. (C): Subcellular localization of the SpBGLU25 protein in onion. (Green is the 1300-GFP fluorescent protein, red is the cell membrane marker, and yellow is due to the overlap of green and red fluorescence, indicating the result of colocalization). Note: *, **, and *** denoting significant differences at p < 0.05, 0.01, and 0.001 levels, respectively.
Figure 2. Expression analysis of the SpBGLU25 gene (A): Expression levels of the SpBGLU25 gene under different drought stress durations. (B): Expression of the SpBGLU25 gene in different tissues of S. pennata. (C): Subcellular localization of the SpBGLU25 protein in onion. (Green is the 1300-GFP fluorescent protein, red is the cell membrane marker, and yellow is due to the overlap of green and red fluorescence, indicating the result of colocalization). Note: *, **, and *** denoting significant differences at p < 0.05, 0.01, and 0.001 levels, respectively.
Ijms 26 06663 g002
Ijms 26 06663 g003
Figure 3. Germination rate and root length detection of Arabidopsis seeds overexpressing SpBGLU25 under drought stress. (A): Phenotypic images of germination rates of four Arabidopsis types under different concentrations of mannitol simulating drought stress. (B): Statistical chart of germination rates of four Arabidopsis types under different concentrations of mannitol simulating drought stress. (C): Phenotypic images of root lengths of four Arabidopsis types under different concentrations of mannitol simulating drought stress. (D): Statistical chart of root lengths of four Arabidopsis types under different concentrations of mannitol simulating drought stress. Note: ** and *** denoting significant differences at p < 0.01 and 0.001 levels, respectively.
Figure 3. Germination rate and root length detection of Arabidopsis seeds overexpressing SpBGLU25 under drought stress. (A): Phenotypic images of germination rates of four Arabidopsis types under different concentrations of mannitol simulating drought stress. (B): Statistical chart of germination rates of four Arabidopsis types under different concentrations of mannitol simulating drought stress. (C): Phenotypic images of root lengths of four Arabidopsis types under different concentrations of mannitol simulating drought stress. (D): Statistical chart of root lengths of four Arabidopsis types under different concentrations of mannitol simulating drought stress. Note: ** and *** denoting significant differences at p < 0.01 and 0.001 levels, respectively.
Ijms 26 06663 g003
Ijms 26 06663 g004
Figure 4. Effects of drought stress on the phenotype of SpBGLU25 gene overexpressing Arabidopsis and its physiological indicators measurement. (A): Phenotype images of four types of Arabidopsis under drought stress. (B): RLWC measurement of four types of Arabidopsis under drought stress. (C): MDA content. (D): POD activity. (E): Soluble protein content. (F): SOD activity. (G): Proline content. (H): Soluble sugar content. (I): Chlorophyll content. Note: *, **, and *** denoting significant differences at p < 0.05, 0.01, and 0.001 levels, respectively.
Figure 4. Effects of drought stress on the phenotype of SpBGLU25 gene overexpressing Arabidopsis and its physiological indicators measurement. (A): Phenotype images of four types of Arabidopsis under drought stress. (B): RLWC measurement of four types of Arabidopsis under drought stress. (C): MDA content. (D): POD activity. (E): Soluble protein content. (F): SOD activity. (G): Proline content. (H): Soluble sugar content. (I): Chlorophyll content. Note: *, **, and *** denoting significant differences at p < 0.05, 0.01, and 0.001 levels, respectively.
Ijms 26 06663 g004
Ijms 26 06663 g005
Figure 5. Transcriptomic analysis of differentially upregulated genes in SpBGLU25-overexpressing vs. wild-type (WT) Arabidopsis. (A): GO analysis of upregulated differentially expressed genes (UDEGs) in SpBGLU25 vs. WT Arabidopsis. (B): KEGG enrichment analysis of UDEGs in SpBGLU25 vs. WT Arabidopsis. (C): Expression levels of key phenylpropanoid biosynthesis pathway genes in SpBGLU25 vs. WT. (D): Expression levels of ABA signaling pathway genes in SpBGLU25 vs. WT. (E): Expression levels of ABA biosynthesis pathway genes in SpBGLU25 vs. WT.
Figure 5. Transcriptomic analysis of differentially upregulated genes in SpBGLU25-overexpressing vs. wild-type (WT) Arabidopsis. (A): GO analysis of upregulated differentially expressed genes (UDEGs) in SpBGLU25 vs. WT Arabidopsis. (B): KEGG enrichment analysis of UDEGs in SpBGLU25 vs. WT Arabidopsis. (C): Expression levels of key phenylpropanoid biosynthesis pathway genes in SpBGLU25 vs. WT. (D): Expression levels of ABA signaling pathway genes in SpBGLU25 vs. WT. (E): Expression levels of ABA biosynthesis pathway genes in SpBGLU25 vs. WT.
Ijms 26 06663 g005
Ijms 26 06663 g006
Figure 6. Effects of ABA treatment on seed germination and root development in SpBGLU25, WT, atbglu25, and SpBGLU25-atbglu25 Arabidopsis. (A): Phenotypic images of germination rates of four Arabidopsis types under different concentrations of ABA treatment. (B): Statistical chart of germination rates of four Arabidopsis types under different concentrations of ABA treatment. (C): Phenotypic images of root lengths of four Arabidopsis types under different concentrations of ABA treatment. (D): Statistical chart of root lengths of four Arabidopsis types under different concentrations of ABA treatment. (E): Detection of ABA content in four Arabidopsis types under PEG treatment. Note: *, **, and *** denoting significant differences at p < 0.05, 0.01, and 0.001 levels, respectively.
Figure 6. Effects of ABA treatment on seed germination and root development in SpBGLU25, WT, atbglu25, and SpBGLU25-atbglu25 Arabidopsis. (A): Phenotypic images of germination rates of four Arabidopsis types under different concentrations of ABA treatment. (B): Statistical chart of germination rates of four Arabidopsis types under different concentrations of ABA treatment. (C): Phenotypic images of root lengths of four Arabidopsis types under different concentrations of ABA treatment. (D): Statistical chart of root lengths of four Arabidopsis types under different concentrations of ABA treatment. (E): Detection of ABA content in four Arabidopsis types under PEG treatment. Note: *, **, and *** denoting significant differences at p < 0.05, 0.01, and 0.001 levels, respectively.
Ijms 26 06663 g006
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer NamePrimer Sequence (from 5′ to 3′)Primer Function
SpBGLU25-FATGGAAGTACTTTGTGAAACCGene cloning
SpBGLU25-RCCTGCGGTCATTGTCAT
SpBGLU25-tong-FatttggagaggacagggtaccATGAAGGACATTGGCATGGATGGene vector construction
SpBGLU25-tong-RggtactagtgtcgactctagaAAGTCCATTGCTCGTGATGCTG
q-GAPDH-FAGTCCGTCGCCATCGTCA The reference gene
q-GAPDH-RCGTGCCCATGCCTTCTGT
q-SpBGL25-FAGCTCATGCTGGTGCTTTTCGene expression analysis
q-SpBGL25-RGTCCATTGCTCGTGATGCTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Niu, J.; Wang, J.; Zhu, F.; Li, X.; Feng, J.; Fan, J.; Chen, M.; Li, X.; Hu, M.; Song, Z.; et al. Overexpression of the β-Glucosidase Gene SpBGLU25 from the Desert Pioneer Plant Stipagrostis pennata Enhances the Drought Tolerance in Arabidopsis. Int. J. Mol. Sci. 2025, 26, 6663. https://doi.org/10.3390/ijms26146663

AMA Style

Niu J, Wang J, Zhu F, Li X, Feng J, Fan J, Chen M, Li X, Hu M, Song Z, et al. Overexpression of the β-Glucosidase Gene SpBGLU25 from the Desert Pioneer Plant Stipagrostis pennata Enhances the Drought Tolerance in Arabidopsis. International Journal of Molecular Sciences. 2025; 26(14):6663. https://doi.org/10.3390/ijms26146663

Chicago/Turabian Style

Niu, Jiahuan, Jingru Wang, Faren Zhu, Xuechi Li, Jianting Feng, Jiliang Fan, Mingsu Chen, Xiaoying Li, Ming Hu, Zhangqi Song, and et al. 2025. "Overexpression of the β-Glucosidase Gene SpBGLU25 from the Desert Pioneer Plant Stipagrostis pennata Enhances the Drought Tolerance in Arabidopsis" International Journal of Molecular Sciences 26, no. 14: 6663. https://doi.org/10.3390/ijms26146663

APA Style

Niu, J., Wang, J., Zhu, F., Li, X., Feng, J., Fan, J., Chen, M., Li, X., Hu, M., Song, Z., Li, Z., Wang, F., Li, R., & Li, H. (2025). Overexpression of the β-Glucosidase Gene SpBGLU25 from the Desert Pioneer Plant Stipagrostis pennata Enhances the Drought Tolerance in Arabidopsis. International Journal of Molecular Sciences, 26(14), 6663. https://doi.org/10.3390/ijms26146663

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop