Novel Shared Heritable Candidate Risk Loci of Breast and Endometrial Cancer—A Swedish Haplotype Genome-Wide Association Study
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Genotyping and Quality Control
4.3. Statistical Methods
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
BC | Breast cancer |
BCAC | Breast Cancer Association Consortium |
EC | Endometrial cancer |
ECAC | Endometrial Cancer Association Consortium |
GWAS | Genome-wide association study |
LOH | Loss of heterozygosity |
MDS | Multidimensional scaling |
OR | Odds ratio |
QC | Quality control |
References
- Bray, F.; Laversanne, M.; Sung, H.; Ferlay, J.; Siegel, R.L.; Soerjomataram, I.; Jemal, A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2024, 74, 229–263. [Google Scholar] [CrossRef] [PubMed]
- Raglan, O.; Kalliala, I.; Markozannes, G.; Cividini, S.; Gunter, M.J.; Nautiyal, J.; Gabra, H.; Paraskevaidis, E.; Martin-Hirsch, P.; Tsilidis, K.K.; et al. Risk factors for endometrial cancer: An umbrella review of the literature. Int. J. Cancer 2019, 145, 1719–1730. [Google Scholar] [CrossRef]
- Titus-Ernstoff, L.; Longnecker, M.P.; Newcomb, P.A.; Dain, B.; Greenberg, E.R.; Mittendorf, R.; Stampfer, M.; Willett, W. Menstrual factors in relation to breast cancer risk. Cancer Epidemiol. Biomark. Prev. 1998, 7, 783–789. [Google Scholar]
- Collaborative Group on Hormonal Factors in Breast Cancer. Breast cancer and breastfeeding: Collaborative reanalysis of individual data from 47 epidemiological studies in 30 countries, including 50302 women with breast cancer and 96973 women without the disease. Lancet 2002, 360, 187–195. [Google Scholar] [CrossRef]
- Albrektsen, G.; Heuch, I.; Hansen, S.; Kvale, G. Breast cancer risk by age at birth, time since birth and time intervals between births: Exploring interaction effects. Br. J. Cancer 2005, 92, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Key, T.J. Endogenous oestrogens and breast cancer risk in premenopausal and postmenopausal women. Steroids. 2011, 76, 812–815. [Google Scholar] [CrossRef]
- Endogenous Hormones and Breast Cancer Collaborative Group; Key, T.J.; Appleby, P.N.; Reeves, G.K.; Travis, R.C.; Alberg, A.J.; Barricarte, A.; Berrino, F.; Krogh, V.; Sieri, S.; et al. Sex hormones and risk of breast cancer in premenopausal women: A collaborative reanalysis of individual participant data from seven prospective studies. Lancet Oncol. 2013, 14, 1009–1019. [Google Scholar]
- Lu, K.H.; Broaddus, R.R. Endometrial Cancer. N. Engl. J. Med. 2020, 383, 2053–2064. [Google Scholar] [CrossRef]
- Patel, M.M.; Adrada, B.E. Hereditary Breast Cancer: BRCA Mutations and Beyond. Radiol. Clin. N. Am. 2024, 62, 627–642. [Google Scholar] [CrossRef] [PubMed]
- Graffeo, R.; Rana, H.Q.; Conforti, F.; Bonanni, B.; Cardoso, M.J.; Paluch-Shimon, S.; Pagani, O.; Goldhirsch, A.; Partridge, A.H.; Lambertini, M.; et al. Moderate penetrance genes complicate genetic testing for breast cancer diagnosis: ATM, CHEK2, BARD1 and RAD51D. Breast 2022, 65, 32–40. [Google Scholar] [CrossRef]
- Michailidou, K.; Lindstrom, S.; Dennis, J.; Beesley, J.; Hui, S.; Kar, S.; Lemacon, A.; Soucy, P.; Glubb, D.; Rostamianfar, A.; et al. Association analysis identifies 65 new breast cancer risk loci. Nature 2017, 551, 92–94. [Google Scholar] [CrossRef] [PubMed]
- O’Mara, T.A.; Glubb, D.M.; Amant, F.; Annibali, D.; Ashton, K.; Attia, J.; Auer, P.L.; Beckmann, M.W.; Black, A.; Bolla, M.K.; et al. Identification of nine new susceptibility loci for endometrial cancer. Nat. Commun. 2018, 9, 3166. [Google Scholar] [CrossRef]
- von Wachenfeldt, A.; Lindblom, A.; South Swedish Oncogenetic Study Group; Gronberg, H.; Einbeigi, Z.; Rosenquist, R.; Gardman, C.; Iselius, L. A hypothesis-generating search for new genetic breast cancer syndromes—A national study in 803 Swedish families. Hered. Cancer Clin. Pract. 2007, 5, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Wendt, C.; Lindblom, A.; Arver, B.; von Wachenfeldt, A.; Margolin, S. Tumour spectrum in non-BRCA hereditary breast cancer families in Sweden. Hered. Cancer Clin. Pract. 2015, 13, 15. [Google Scholar] [CrossRef]
- Zheng, G.; Yu, H.; Hemminki, A.; Forsti, A.; Sundquist, K.; Hemminki, K. Familial associations of female breast cancer with other cancers. Int. J. Cancer 2017, 141, 2253–2259. [Google Scholar] [CrossRef] [PubMed]
- Kazerouni, N.; Schairer, C.; Friedman, H.B.; Lacey, J.V., Jr.; Greene, M.H. Family history of breast cancer as a determinant of the risk of developing endometrial cancer: A nationwide cohort study. J. Med. Genet. 2002, 39, 826–832. [Google Scholar] [CrossRef]
- Yehia, L.; Keel, E.; Eng, C. The Clinical Spectrum of PTEN Mutations. Annu. Rev. Med. 2020, 71, 103–116. [Google Scholar] [CrossRef]
- Barnekow, E.; Liu, W.; Helgadottir, H.T.; Michailidou, K.; Dennis, J.; Bryant, P.; Thutkawkorapin, J.; Wendt, C.; Czene, K.; Hall, P.; et al. A Swedish Genome-Wide Haplotype Association Analysis Identifies a Novel Breast Cancer Susceptibility Locus in 8p21.2 and Characterizes Three Loci on Chromosomes 10, 11 and 16. Cancers 2022, 14, 1206. [Google Scholar] [CrossRef]
- Barnekow, E.; Liu, W.; Andersson, E.; Wang, X.; Helgadottir, H.T.; Thutkawkorapin, J.; Barilla, S.; Vermani, L.; Mints, M.; Tham, E.; et al. A Swedish genome-wide haplotype association analysis identifies novel candidate loci associated with endometrial cancer risk. PLoS ONE 2025, 20, e0316086. [Google Scholar] [CrossRef]
- Barot, S.; Vermani, L.; Blom, J.; Larsson, S.; Liljegren, A.; Lindblom, A. Candidate Genetic Loci Modifying the Colorectal Cancer Risk Caused by Lifestyle Risk Factors. Clin. Transl. Gastroenterol. 2025, 16, e00790. [Google Scholar] [CrossRef]
- McGrath, M.; Lee, I.M.; Buring, J.; Hunter, D.J.; De Vivo, I. Novel breast cancer risk alleles and endometrial cancer risk. Int. J. Cancer 2008, 123, 2961–2964. [Google Scholar] [CrossRef]
- Healey, C.S.; Ahmed, S.; ANECS; AOCS Management Group; O’Mara, T.A.; Ferguson, K.; Lambrechts, D.; Garcia-Dios, D.A.; Vergote, I.; Amant, F.; et al. Breast cancer susceptibility polymorphisms and endometrial cancer risk: A Collaborative Endometrial Cancer Study. Carcinogenesis 2011, 32, 1862–1866. [Google Scholar] [CrossRef]
- Miki, Y.; Swensen, J.; Shattuck-Eidens, D.; Futreal, P.A.; Harshman, K.; Tavtigian, S.; Liu, Q.; Cochran, C.; Bennett, L.M.; Ding, W.; et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994, 266, 66–71. [Google Scholar] [CrossRef] [PubMed]
- Wooster, R.; Neuhausen, S.L.; Mangion, J.; Quirk, Y.; Ford, D.; Collins, N.; Nguyen, K.; Seal, S.; Tran, T.; Averill, D.; et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12–13. Science 1994, 265, 2088–2090. [Google Scholar] [CrossRef]
- Leach, F.S.; Nicolaides, N.C.; Papadopoulos, N.; Liu, B.; Jen, J.; Parsons, R.; Peltomaki, P.; Sistonen, P.; Aaltonen, L.A.; Nystrom-Lahti, M.; et al. Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer. Cell 1993, 75, 1215–1225. [Google Scholar] [CrossRef]
- Papadopoulos, N.; Nicolaides, N.C.; Wei, Y.F.; Ruben, S.M.; Carter, K.C.; Rosen, C.A.; Haseltine, W.A.; Fleischmann, R.D.; Fraser, C.M.; Adams, M.D.; et al. Mutation of a mutL homolog in hereditary colon cancer. Science 1994, 263, 1625–1629. [Google Scholar] [CrossRef] [PubMed]
- Breast Cancer Linkage Consortium. Cancer risks in BRCA2 mutation carriers. J. Natl. Cancer Inst. 1999, 91, 1310–1316. [Google Scholar] [CrossRef]
- Ford, D.; Easton, D.F.; Bishop, D.T.; Narod, S.A.; Goldgar, D.E. Risks of cancer in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Lancet 1994, 343, 692–695. [Google Scholar] [CrossRef]
- Bonadona, V.; Bonaiti, B.; Olschwang, S.; Grandjouan, S.; Huiart, L.; Longy, M.; Guimbaud, R.; Buecher, B.; Bignon, Y.J.; Caron, O.; et al. Cancer risks associated with germline mutations in MLH1, MSH2, and MSH6 genes in Lynch syndrome. Jama Requir. Manag. 2011, 305, 2304–2310. [Google Scholar]
- Lindstrom, S.; Wang, L.; Feng, H.; Majumdar, A.; Huo, S.; Macdonald, J.; Harrison, T.; Turman, C.; Chen, H.; Mancuso, N.; et al. Genome-wide analyses characterize shared heritability among cancers and identify novel cancer susceptibility regions. J. Natl. Cancer Inst. 2023, 115, 712–732. [Google Scholar] [CrossRef]
- Wijayabahu, A.T.; Egan, K.M.; Yaghjyan, L. Uterine cancer in breast cancer survivors: A systematic review. Breast Cancer Res. Treat. 2020, 180, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Chen, L. Second malignancies after breast cancer: The impact of adjuvant therapy. Mol. Clin. Oncol. 2014, 2, 331–336. [Google Scholar] [CrossRef]
- Swerdlow, A.J.; Jones, M.E.; British Tamoxifen Second Cancer Study Group. Tamoxifen treatment for breast cancer and risk of endometrial cancer: A case-control study. J. Natl. Cancer Inst. 2005, 97, 375–384. [Google Scholar] [CrossRef]
- Sung, H.; Freedman, R.A.; Siegel, R.L.; Hyun, N.; DeSantis, C.E.; Ruddy, K.J.; Jemal, A. Risks of subsequent primary cancers among breast cancer survivors according to hormone receptor status. Cancer 2021, 127, 3310–3324. [Google Scholar] [CrossRef]
- Poole, L.P.; Macleod, K.F. Mitophagy in tumorigenesis and metastasis. Cell. Mol. Life Sci. 2021, 78, 3817–3851. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.Y.; Yu, J.C.; Lo, Y.L.; Kuo, C.H.; Yue, C.T.; Jou, Y.S.; Huang, C.S.; Lung, J.C.; Wu, C.W. Genome-wide search for loss of heterozygosity using laser capture microdissected tissue of breast carcinoma: An implication for mutator phenotype and breast cancer pathogenesis. Cancer Res. 2000, 60, 3884–3892. [Google Scholar] [PubMed]
- Lai, J.; Flanagan, J.; Phillips, W.A.; Chenevix-Trench, G.; Arnold, J. Analysis of the candidate 8p21 tumour suppressor, BNIP3L, in breast and ovarian cancer. Br. J. Cancer 2003, 88, 270–276. [Google Scholar] [CrossRef]
- Kaveh, F.; Baumbusch, L.O.; Nebdal, D.; Borresen-Dale, A.L.; Lingjaerde, O.C.; Edvardsen, H.; Kristensen, V.N.; Solvang, H.K. A systematic comparison of copy number alterations in four types of female cancer. BMC Cancer 2016, 16, 913. [Google Scholar] [CrossRef]
- Zeegers, M.P.; Nekeman, D.; Khan, H.S.; van Dijk, B.A.; Goldbohm, R.A.; Schalken, J.; Shajahan, S.; Pearlman, A.; Oddoux, C.; van den Brandt, P.A.; et al. Prostate cancer susceptibility genes on 8p21–23 in a Dutch population. Prostate Cancer Prostatic Dis. 2013, 16, 248–253. [Google Scholar] [CrossRef]
- Chourasia, A.H.; Macleod, K.F. Tumor suppressor functions of BNIP3 and mitophagy. Autophagy 2015, 11, 1937–1938. [Google Scholar] [CrossRef]
- Giatromanolaki, A.; Koukourakis, M.I.; Gatter, K.C.; Harris, A.L.; Sivridis, E. BNIP3 expression in endometrial cancer relates to active hypoxia inducible factor 1alpha pathway and prognosis. J. Clin. Pathol. 2008, 61, 217–220. [Google Scholar] [CrossRef] [PubMed]
- Bellot, G.; Garcia-Medina, R.; Gounon, P.; Chiche, J.; Roux, D.; Pouyssegur, J.; Mazure, N.M. Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. Mol. Cell Biol. 2009, 29, 2570–2581. [Google Scholar] [CrossRef]
- Wei, Y.; Huang, C.; Wu, H.; Huang, J. Estrogen Receptor Beta (ERbeta) Mediated-CyclinD1 Degradation via Autophagy Plays an Anti-Proliferation Role in Colon Cells. Int. J. Biol. Sci. 2019, 15, 942–952. [Google Scholar] [CrossRef]
- Rakha, E.A.; Green, A.R.; Powe, D.G.; Roylance, R.; Ellis, I.O. Chromosome 16 tumor-suppressor genes in breast cancer. Genes Chromosome. Cancer 2006, 45, 527–535. [Google Scholar] [CrossRef] [PubMed]
- Harkonen, P.; Kyllonen, A.P.; Nordling, S.; Vihko, P. Loss of heterozygosity in chromosomal region 16q24.3 associated with progression of prostate cancer. Prostate 2005, 62, 267–274. [Google Scholar] [CrossRef]
- Crocamo, S.; Binato, R.; Dos Santos, E.C.; de Paula, B.; Abdelhay, E. Translational Results of Zo-NAnTax: A Phase II Trial of Neoadjuvant Zoledronic Acid in HER2-Positive Breast Cancer. Int. J. Mol. Sci. 2022, 23, 15515. [Google Scholar] [CrossRef]
- Meijuan, C.; Fang, L.; Min, F.; Qian, W. Hypomethylated gene RAC3 induces cell proliferation and invasion by increasing FASN expression in endometrial cancer. Int. J. Biochem. Cell Biol. 2022, 150, 106274. [Google Scholar] [CrossRef]
- Dudas, J.; Ladanyi, A.; Ingruber, J.; Steinbichler, T.B.; Riechelmann, H. Epithelial to Mesenchymal Transition: A Mechanism that Fuels Cancer Radio/Chemoresistance. Cells 2020, 9, 428. [Google Scholar] [CrossRef]
- Sun, Y.; Leng, P.; Guo, P.; Gao, H.; Liu, Y.; Li, C.; Li, Z.; Zhang, H. G protein coupled estrogen receptor attenuates mechanical stress-mediated apoptosis of chondrocyte in osteoarthritis via suppression of Piezo1. Mol. Med. 2021, 27, 96. [Google Scholar] [CrossRef]
- Wu, R.W.; Lian, W.S.; Chen, Y.S.; Ko, J.Y.; Wang, S.Y.; Jahr, H.; Wang, F.S. Piezoelectric Microvibration Mitigates Estrogen Loss-Induced Osteoporosis and Promotes Piezo1, MicroRNA-29a, and Wnt3a Signaling in Osteoblasts. Int. J. Mol. Sci. 2021, 22, 9476. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Y.; Liu, Q.; Lu, W.; Bu, G. Wnt signaling activation and mammary gland hyperplasia in MMTV-LRP6 transgenic mice: Implication for breast cancer tumorigenesis. Oncogene 2010, 29, 539–549. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Du, X.M.; Si, W.; Zhao, X.H.; Zhou, Z.Q. Role of INPP4B in the proliferation, migration, invasion, and survival of human endometrial cancer cells. Histol. Histopathol. 2024, 39, 1197–1208. [Google Scholar]
- Xue, C.; Wei, Z.; Zhang, Y.; Liu, Y.; Zhang, S.; Li, Q.; Feng, K.; Yang, X.; Liu, G.; Chen, Y.; et al. Activation of CTU2 expression by LXR promotes the development of hepatocellular carcinoma. Cell Biol. Toxicol. 2024, 40, 23. [Google Scholar] [CrossRef]
- Miki, Y. New Insights into Breast and Endometrial Cancers. Cancers 2020, 12, 2595. [Google Scholar] [CrossRef]
- Harbeck, N.; Gnant, M. Breast cancer. Lancet 2017, 389, 1134–1150. [Google Scholar] [CrossRef] [PubMed]
- Maguire, P.; Holmberg, K.; Kost-Alimova, M.; Imreh, S.; Skoog, L.; Lindblom, A. CGH analysis of familial non-BRCA1/BRCA2 breast tumors and mutation screening of a candidate locus on chromosome 17q11.2–12. Int. J. Mol. Med. 2005, 16, 135–141. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, N.; Zhang, B.; Chen, Y. Identification of an immune cell infiltration-related gene signature for prognosis prediction in triple-negative breast cancer. Cell. Mol. Biol. 2024, 70, 91–98. [Google Scholar] [CrossRef]
- Zhou, Z.H.; Song, J.W.; Li, W.; Liu, X.; Cao, L.; Wan, L.M.; Tan, Y.X.; Ji, S.P.; Liang, Y.M.; Gong, F. The acid-sensing ion channel, ASIC2, promotes invasion and metastasis of colorectal cancer under acidosis by activating the calcineurin/NFAT1 axis. J. Exp. Clin. Cancer Res. 2017, 36, 130. [Google Scholar] [CrossRef] [PubMed]
- Sales, K.J.; Grant, V.; Cook, I.H.; Maldonado-Perez, D.; Anderson, R.A.; Williams, A.R.; Jabbour, H.N. Interleukin-11 in endometrial adenocarcinoma is regulated by prostaglandin F2alpha-F-prostanoid receptor interaction via the calcium-calcineurin-nuclear factor of activated T cells pathway and negatively regulated by the regulator of calcineurin-1. Am. J. Pathol. 2010, 176, 435–445. [Google Scholar] [CrossRef]
- Vermani, L.; Barnekow, E.; Liu, W.; Wendt, C.; Hall, P.; Margolin, S.; Lindblom, A. Swedish Genome-Wide Haplotype Association Analysis Suggests Breast Cancer Loci with Varying Risk-Modifying Effects. Genes 2024, 15, 1616. [Google Scholar] [CrossRef]
- Barnekow, E.; Hasslow, J.; Liu, W.; Bryant, P.; Thutkawkorapin, J.; Wendt, C.; Czene, K.; Hall, P.; Margolin, S.; Lindblom, A. A Swedish Familial Genome-Wide Haplotype Analysis Identified Five Novel Breast Cancer Susceptibility Loci on 9p24.3, 11q22.3, 15q11.2, 16q24.1 and Xq21.31. Int. J. Mol. Sci. 2023, 24, 4468. [Google Scholar] [CrossRef] [PubMed]
- Martin, A.R.; Gignoux, C.R.; Walters, R.K.; Wojcik, G.L.; Neale, B.M.; Gravel, S.; Daly, M.J.; Bustamante, C.D.; Kenny, E.E. Human Demographic History Impacts Genetic Risk Prediction across Diverse Populations. Am. J. Hum. Genet. 2020, 107, 788–789. [Google Scholar] [CrossRef] [PubMed]
- Gabrielson, M.; Eriksson, M.; Hammarstrom, M.; Borgquist, S.; Leifland, K.; Czene, K.; Hall, P. Cohort Profile: The Karolinska Mammography Project for Risk Prediction of Breast Cancer (KARMA). Int. J. Epidemiol. 2017, 46, 1740–1741g. [Google Scholar] [CrossRef] [PubMed]
- Margolin, S.; Werelius, B.; Fornander, T.; Lindblom, A. BRCA1 mutations in a population-based study of breast cancer in Stockholm County. Genet. Test. 2004, 8, 127–132. [Google Scholar] [CrossRef]
- Weiderpass, E.; Baron, J.A.; Adami, H.O.; Magnusson, C.; Lindgren, A.; Bergstrom, R.; Correia, N.; Persson, I. Low-potency oestrogen and risk of endometrial cancer: A case-control study. Lancet 1999, 353, 1824–1828. [Google Scholar] [CrossRef]
- Tzortzatos, G.; Wersall, O.; Danielsson, K.G.; Lindblom, A.; Tham, E.; Mints, M. Familial cancer among consecutive uterine cancer patients in Sweden. Hered. Cancer Clin. Pract. 2014, 12, 14. [Google Scholar] [CrossRef]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.I.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef]
- Purcell, S. Haplotype-Based Association Tests with GLMs. Available online: https://zzz.bwh.harvard.edu/plink/haplo.shtml#hap3 (accessed on 5 April 2025).
- Dudbridge, F.; Gusnanto, A. Estimation of significance thresholds for genomewide association scans. Genet. Epidemiol. 2008, 32, 227–234. [Google Scholar] [CrossRef]
Locus | Gene(s) | SNP1–SNP2 (BP1–BP2) | Haplotype | F | OR (95% CI) | p-Value |
---|---|---|---|---|---|---|
8p21.2 | BNIP3L | rs6995651–rs328097 (26300936–26343095) | AGGGGCGGAAGGA | 0.02 | 2.1 (1.6–2.6) | 1.6 × 10−8 |
10q26.13 * | FGFR2 | rs45631627–rs2912778 (123338552–123338654) | GG | 0.41 | 1.3 (1.2–1.4) | 2.8 × 10−15 |
11q13.3 * | - | rs680618–rs614367 (69316881–69328764) | GGAAAAGGGA | 0.11 | 1.4 (1.2–1.5) | 9.7 × 10−11 |
16q12.1 * | TOX3 | rs12918816–rs12929984 (52560213–52562811) | AG | 0.26 | 1.3 (1.2–1.4) | 4.2 × 10−14 |
16q24.3 | MVD, SNAI3, RNF166, CTU2, PIEZO1 | rs6500486–rs3743975 (88723629–88822297) | ACAGCCGGAAAAGGGGGAGGAGAA | 0.01 | 2.4 (1.8–3.3) | 3.8 × 10−8 |
17q11.2 | ASIC2 | rs7224279–rs1019412 (31450715–31488753) | GGAACGCG | 0.11 | 1.3 (1.2–1.4) | 4.3 × 10−8 |
ECBC GWAS (n = 4316) | BC GWAS (n = 3200) | EC GWAS (n = 1116) | ||||
---|---|---|---|---|---|---|
Locus | OR | p-Value | OR | p-Value | OR | p-Value |
8p21.2 | 2.01 | 1.6 × 10−8 | 2.08 | 3.9 × 10−8 | 1.95 | 3.8 × 10−4 |
10q26.13 | 1.27 | 2.8 × 10−15 | 1.30 | 1.0 × 10−20 | 1.04 | 0.41 |
11q13.3 | 1.36 | 9.7 × 10−11 | 1.44 | 6.4 × 10−13 | 1.14 | 0.099 |
16q12.1 | 1.29 | 4.1 × 10−14 | 1.37 | 1.7 × 10−18 | 1.05 | 0.35 |
16q24.3 | 2.40 | 3.9 × 10−8 | 2.27 | 1.5 × 10−6 | 2.84 | 1.8 × 10−6 |
17q11.2 | 1.27 | 4.3 × 10−8 | 1.26 | 1.4 × 10−6 | 1.32 | 4.0 × 10−5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barnekow, E.; Liu, W.; Franko, M.A.; von Wachenfeldt, A.; Wendt, C.; Tham, E.; Mints, M.; O’Mara, T.A.; Hall, P.; Margolin, S.; et al. Novel Shared Heritable Candidate Risk Loci of Breast and Endometrial Cancer—A Swedish Haplotype Genome-Wide Association Study. Int. J. Mol. Sci. 2025, 26, 5461. https://doi.org/10.3390/ijms26125461
Barnekow E, Liu W, Franko MA, von Wachenfeldt A, Wendt C, Tham E, Mints M, O’Mara TA, Hall P, Margolin S, et al. Novel Shared Heritable Candidate Risk Loci of Breast and Endometrial Cancer—A Swedish Haplotype Genome-Wide Association Study. International Journal of Molecular Sciences. 2025; 26(12):5461. https://doi.org/10.3390/ijms26125461
Chicago/Turabian StyleBarnekow, Elin, Wen Liu, Mikael Andersson Franko, Anna von Wachenfeldt, Camilla Wendt, Emma Tham, Miriam Mints, Tracy A. O’Mara, Per Hall, Sara Margolin, and et al. 2025. "Novel Shared Heritable Candidate Risk Loci of Breast and Endometrial Cancer—A Swedish Haplotype Genome-Wide Association Study" International Journal of Molecular Sciences 26, no. 12: 5461. https://doi.org/10.3390/ijms26125461
APA StyleBarnekow, E., Liu, W., Franko, M. A., von Wachenfeldt, A., Wendt, C., Tham, E., Mints, M., O’Mara, T. A., Hall, P., Margolin, S., & Lindblom, A. (2025). Novel Shared Heritable Candidate Risk Loci of Breast and Endometrial Cancer—A Swedish Haplotype Genome-Wide Association Study. International Journal of Molecular Sciences, 26(12), 5461. https://doi.org/10.3390/ijms26125461