Suk-SaiYasna Remedy, a Traditional Thai Medicine, Mitigates Stress-Induced Cognitive Impairment via Keap1-Nrf2 Pathway
Abstract
1. Introduction
2. Results
2.1. Effect of SSY in Antioxidant Activity by DPPH and ABTS Assay
2.2. Effect of SSY on UCMS-Induced Cognitive Deficits
2.3. Effect of SSY on Lipid Peroxidation and the Activities of SOD and CAT in UCMS-Exposed Mouse Brain
2.4. Effects of SSY on the Nrf2-Keap1 Pathway in UCMS-Exposed Mice
2.5. LC-MS/MS Analysis of the Constituents of the SSY and Cannabis sativa Linn. Extract
2.6. HPLC Analysis of the Constituents of the SSY Extracts and the Validation Method
3. Discussion
4. Materials and Methods
4.1. Plant Materials and SSY Preparation
4.2. In Vitro Antioxidant Activity by DPPH and ABTS Assay [46]
4.3. Animal
4.4. Unpredictable Chronic Mild Stress (UCMS)
4.5. Drug Administration
4.6. Behavioral Studies
4.6.1. Y-Maze Test
4.6.2. Novel Object Recognition Test (NORT)
4.6.3. Morris Water Maze (MWM) Test
4.7. Measurement of MDA Level by the Thiobarbituric Acid Reactive Substances (TBARS) Assay
4.8. Determination of Superoxide Dismutase (SOD) and Catalase (CAT) Activities
4.9. Quantitative Real-Time PCR
4.10. Liquid Chromatography–Mass Spectrometry with Tandem Mass Spectrometry (LC-MS/MS) Analysis
4.11. High-Performance Liquid Chromatography (HPLC) Analysis and Validation of the Analytical Method
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| The following abbreviations are used in this manuscript | . |
| SSY | Suk-SaiYasna |
| UCMS | Unpredictable chronic mild stress |
| HPA | Hypothalamic-pituitary-adrenal |
| ROS | Reactive oxygen species |
| Nrf2 | Nuclear factor erythroid 2-related factor 2 |
| Keap1 | Kelch-like ECH-associated protein 1 |
| SOD | Superoxide dismutase |
| CAT | Catalase |
| ECS | Endocannabinoid system |
| CBD | Cannabidiol |
| NQO1 | NAD(P)H quinone dehydrogenase 1 |
| HO-1 | Heme oxygenase-1 |
| MWM | Morris water maze |
| NORT | Novel object recognition test |
| TBARS | Thiobarbituric acid reactive substances |
| MDA | Malondialdehyde |
| SCMC | Sodium carboxymethyl cellulose |
| DPPH | 2,2-diphenyl-1-picrylhydrazyl |
| ABTS | 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) |
| LOD | Limit of detection |
| LOQ | Limit of quantification |
References
- Yuan, X.; Chai, J.; Xu, W.; Zhao, Y. Exploring the Potential of Probiotics and Prebiotics in Major Depression: From Molecular Function to Clinical Therapy. Probiotics Antimicro. Prot. 2024, 16, 2181–2217. [Google Scholar] [CrossRef] [PubMed]
- Djordjevic, J.; Djordjevic, A.; Adzic, M.; Mitic, M.; Lukic, I.; Radojcic, M.B. Alterations in the Nrf2–Keap1 Signaling Pathway and Its Downstream Target Genes in Rat Brain under Stress. Brain Res. 2015, 1602, 20–31. [Google Scholar] [CrossRef] [PubMed]
- Starcke, K.; Brand, M. Decision Making under Stress: A Selective Review. Neurosci. Biobehav. Rev. 2012, 36, 1228–1248. [Google Scholar] [CrossRef] [PubMed]
- Akirav, I. Cannabinoids Modulation of Emotional and Non-Emotional Memory Processes After Stress. In Cannabinoid Modulation of Emotion, Memory, and Motivation; Campolongo, P., Fattore, L., Eds.; Springer: New York, NY, USA, 2015; pp. 23–43. ISBN 978-1-4939-2294-9. [Google Scholar]
- Verhoeckx, K.C.M.; Korthout, H.A.A.J.; van Meeteren-Kreikamp, A.P.; Ehlert, K.A.; Wang, M.; van der Greef, J.; Rodenburg, R.J.T.; Witkamp, R.F. Unheated Cannabis sativa Extracts and Its Major Compound THC-Acid Have Potential Immuno-Modulating Properties Not Mediated by CB1 and CB2 Receptor Coupled Pathways. Int. Immunopharmacol. 2006, 6, 656–665. [Google Scholar] [CrossRef]
- Fernández-Ruiz, J.; Romero, J.; Velasco, G.; Tolón, R.M.; Ramos, J.A.; Guzmán, M. Cannabinoid CB2 Receptor: A New Target for Controlling Neural Cell Survival? Trends Pharmacol. Sci. 2007, 28, 39–45. [Google Scholar] [CrossRef]
- National Drug Information, M.O.P.H. Herbal Medicine List and Evidence-Based Documentation. Available online: https://herbal.fda.moph.go.th/media.php?id=553111484570411008&name=nloehd3-03.pdf (accessed on 16 November 2024).
- Damjuti, W.; Thitikornpong, W.; Saengow, S.; Thanusuwannasak, T.; Fuangfoo, T.; Boonruab, J. The interaction of Suk-Saiyasnaremedy with GABAA and CB1 receptor-targeting drugs: Enhancing hypnotic and sedative effects in in vivo models. J. Adv. Pharm. Technol. Res. 2024, 15, 13–18. [Google Scholar] [CrossRef]
- Li, J.; Xiang, H.; Huang, C.; Lu, J. Pharmacological Actions of Myricetin in the Nervous System: A Comprehensive Review of Preclinical Studies in Animals and Cell Models. Front. Pharmacol. 2021, 12, 797298. [Google Scholar] [CrossRef]
- Borre, Y.E.; Panagaki, T.; Koelink, P.J.; Morgan, M.E.; Hendriksen, H.; Garssen, J.; Kraneveld, A.D.; Olivier, B.; Oosting, R.S. Neuroprotective and cognitive enhancing effects of a multi-targeted food intervention in an animal model of neurodegeneration and depression. Neuropharmacol. 2014, 79, 738–749. [Google Scholar] [CrossRef]
- Mansouri, M.T.; Naghizadeh, B.; Ghorbanzadeh, B.; Farbood, Y.; Sarkaki, A.; Bavarsad, K. Gallic acid prevents memory deficits and oxidative stress induced by intracerebroventricular injection of streptozotocin in rats. Pharmacol. Biochem. Behav. 2013, 111, 90–96. [Google Scholar] [CrossRef]
- Zhang, F.; Zhang, J.G.; Yang, W.; Xu, P.; Xiao, Y.L.; Zhang, H.T. 6-Gingerol attenuates LPS-induced neuroinflammation and cognitive impairment partially via suppressing astrocyte overactivation. Biomed. Pharmacother. 2018, 107, 1523–1529. [Google Scholar] [CrossRef]
- El-Fadl, H.M.I.A.; Mohamed, M.F. Targeting endoplasmic reticulum stress, Nrf-2/HO-1, and NF-κB by myristicin and its role in attenuation of ulcerative colitis in rats. Life Sci. 2022, 311, 121187. [Google Scholar] [CrossRef] [PubMed]
- Maneenet, J.; Daodee, S.; Monthakantirat, O.; Boonyarat, C.; Khamphukdee, C.; Kwankhao, P.; Pitiporn, S.; Awale, S.; Chulikhit, Y.; Kijjoa, A. Kleeb Bua Daeng, a Thai Traditional Herbal Formula, Ameliorated Unpredictable Chronic Mild Stress-Induced Cognitive Impairment in ICR Mice. Molecules 2019, 24, 4587. [Google Scholar] [CrossRef] [PubMed]
- Vorhees, C.V.; Williams, M.T. Morris Water Maze: Procedures for Assessing Spatial and Related Forms of Learning and Memory. Nat. Protoc. 2006, 1, 848–858. [Google Scholar] [CrossRef] [PubMed]
- Kraeuter, A.-K.; Guest, P.C.; Sarnyai, Z. The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. Methods Mol. Biol. 2019, 1916, 105–111. [Google Scholar] [CrossRef]
- Watson, H.C.; Wilding, E.L.; Graham, K.S. A role for perirhinal cortex in memory for novel object-context associations. J. Neurosci. 2012, 32, 4473–4481. [Google Scholar] [CrossRef]
- Murray, E.A.; Richmond, B.J. Role of perirhinal cortex in object perception, memory, and associations. Curr. Opin. Neurobiol. 2001, 11, 188–193. [Google Scholar] [CrossRef]
- Goh, J.O.; Park, D.C. Neuroplasticity and Cognitive Aging: The Scaffolding Theory of Aging and Cognition. Restor. Neurol. Neurosci. 2009, 27, 391–403. [Google Scholar] [CrossRef]
- Shrager, Y.; Kirwan, C.B.; Squire, L.R. Activity in both hippocampus and perirhinal cortex predicts the memory strength of subsequently remembered information. Neuron 2008, 59, 547–553. [Google Scholar] [CrossRef]
- Yang, N.; Wang, Y.; Luo, X.; Zhan, G. Chronic restraint stress induces abnormal behaviors in pain sensitivity and cognitive function in mice: The role of Keap1/Nrf2 pathway. Stress 2024, 27, 2316050. [Google Scholar] [CrossRef]
- Ren, B.; Yuan, T.; Diao, Z.; Zhang, C.; Liu, Z.; Liu, X. Protective effects of sesamol on systemic oxidative stress-induced cognitive impairments via regulation of Nrf2/Keap1 pathway. Food Funct. 2018, 9, 5912–5924. [Google Scholar] [CrossRef]
- D’Souza, D.C.; Pittman, B.; Perry, E.; Simen, A. Preliminary Evidence of Cannabinoid Effects on Brain-Derived Neurotrophic Factor (BDNF) Levels in Humans. Psychopharmacol. 2009, 202, 569–578. [Google Scholar] [CrossRef] [PubMed]
- Segal-Gavish, H.; Gazit, N.; Barhum, Y.; Ben-Zur, T.; Taler, M.; Hornfeld, S.H.; Gil-Ad, I.; Weizman, A.; Slutsky, I.; Niwa, M.; et al. BDNF Overexpression Prevents Cognitive Deficit Elicited by Adolescent Cannabis Exposure and Host Susceptibility Interaction. Hum. Mol. Genet. 2017, 26, 2462–2471. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Luo, Z.; Zhang, Z.; Zhao, M.; Tong, C.; Cong, P.; Mao, S.; Zhao, Y.; Hou, M.; Piao, Y.; et al. Protective Effect and Mechanism of Cannabidiol on Myocardial Injury in Exhaustive Exercise Training Mice. Chem.-Biol. Interact. 2022, 365, 110079. [Google Scholar] [CrossRef] [PubMed]
- Mao, Q.-Q.; Huang, Z.; Zhong, X.-M.; Xian, Y.-F.; Ip, S.-P. Piperine Reverses the Effects of Corticosterone on Behavior and Hippocampal BDNF Expression in Mice. Neurochem. Int. 2014, 74, 36–41. [Google Scholar] [CrossRef]
- Chen, W.; An, J.; Li, J.; Hong, L.; Xing, Z.; Li, C. Piperine Attenuates Lipopolysaccharide (LPS)-Induced Inflammatory Responses in BV2 Microglia. Int. Immunopharmacol. 2017, 42, 44–48. [Google Scholar] [CrossRef]
- Chonpathompikunlert, P.; Wattanathorn, J.; Muchimapura, S. Piperine, the Main Alkaloid of Thai Black Pepper, Protects against Neurodegeneration and Cognitive Impairment in Animal Model of Cognitive Deficit like Condition of Alzheimer’s Disease. Food Chem. Toxicol. 2010, 48, 798–802. [Google Scholar] [CrossRef]
- Arcusa, R.; Villaño, D.; Marhuenda, J.; Cano, M.; Cerdà, B.; Zafrilla, P. Potential Role of Ginger (Zingiber Officinale Roscoe) in the Prevention of Neurodegenerative Diseases. Front. Nutr. 2022, 9, 809621. [Google Scholar] [CrossRef]
- Kim, C.-Y.; Seo, Y.; Lee, C.; Park, G.H.; Jang, J.-H. Neuroprotective Effect and Molecular Mechanism of [6]-Gingerol against Scopolamine-Induced Amnesia in C57BL/6 Mice. Evid.-Based Complement. Altern. Med. 2018, 2018, e8941564. [Google Scholar] [CrossRef]
- Dkhil, M.A.; Abdel Moneim, A.E.; Hafez, T.A.; Mubaraki, M.A.; Mohamed, W.F.; Thagfan, F.A.; Al-Quraishy, S. Myristica Fragrans Kernels Prevent Paracetamol-Induced Hepatotoxicity by Inducing Anti-Apoptotic Genes and Nrf2/HO-1 Pathway. Int. J. Mol. Sci. 2019, 20, 993. [Google Scholar] [CrossRef]
- Lim, J.S.; Lee, S.H.; Lee, S.R.; Lim, H.-J.; Roh, Y.-S.; Won, E.J.; Cho, N.; Chun, C.; Cho, Y.-C. Inhibitory Effects of Aucklandia Lappa Decne. Extract on Inflammatory and Oxidative Responses in LPS-Treated Macrophages. Molecules 2020, 25, 1336. [Google Scholar] [CrossRef]
- Peng, S.; Hou, Y.; Yao, J.; Fang, J. Activation of Nrf2 by Costunolide Provides Neuroprotective Effect in PC12 Cells. Food Funct. 2019, 10, 4143–4152. [Google Scholar] [CrossRef] [PubMed]
- Plekratoke, K.; Boonyarat, C.; Monthakantirat, O.; Nualkaew, N.; Wangboonskul, J.; Awale, S.; Chulikhit, Y.; Daodee, S.; Khamphukdee, C.; Chaiwiwatrakul, S.; et al. The Effect of Ethanol Extract from Mesua ferrea Linn Flower on Alzheimer’s Disease and Its Underlying Mechanism. Curr. Issues Mol. Biol. 2023, 45, 4063–4079. [Google Scholar] [CrossRef] [PubMed]
- Pan, X.; Chen, T.; Zhang, Z.; Chen, X.; Chen, C.; Chen, L.; Wang, X.; Ying, X. Activation of Nrf2/HO-1 Signal with Myricetin for Attenuating ECM Degradation in Human Chondrocytes and Ameliorating the Murine Osteoarthritis. Int. Immunopharmacol. 2019, 75, 105742. [Google Scholar] [CrossRef] [PubMed]
- Al Mamun, A.; Matsuzaki, K.; Islam, R.; Hossain, S.; Hossain, M.E.; Katakura, M.; Arai, H.; Shido, O.; Hashimoto, M. Chronic Administration of Thymoquinone Enhances Adult Hippocampal Neurogenesis and Improves Memory in Rats Via Regulating the BDNF Signaling Pathway. Neurochem. Res. 2022, 47, 933–951. [Google Scholar] [CrossRef]
- Jana, A.; Modi, K.K.; Roy, A.; Anderson, J.A.; van Breemen, R.B.; Pahan, K. Up-Regulation of Neurotrophic Factors by Cinnamon and Its Metabolite Sodium Benzoate: Therapeutic Implications for Neurodegenerative Disorders. J. Neuroimmune Pharmacol. 2013, 8, 739–755. [Google Scholar] [CrossRef]
- Bahramsoltani, R.; Shahpiri, Z.; Farzaei, M.H.; Hosseinzadeh, L.; Rezazadeh, D.; Pourfarzam, M.; Rahimi, R. Effects of cinnamon oil and its main constituents, cinnamic acid and cinnamaldehyde, on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced neurodegeneration in PC-12 cells. Boletín Latinoam. Caribe Plantas Med. Aromáticas 2023, 22, 837–847. [Google Scholar] [CrossRef]
- Arung, E.T.; Kusuma, I.W.; Purwatiningsih, S.; Yang, J.; Jeon, S.; Kim, Y.; Sukaton, E.; Wicaksono, B.D.; Sandra, F.; Susilo, J.; et al. Antioxidant Activity and Cytotoxicity of the Traditional Indonesian Medicine Tahongai (Kleinhovia hospita L.) Extract. J. Acupunct. Meridian Stud. 2009, 2, 306–308. [Google Scholar] [CrossRef]
- Raghavendra, M.; Maiti, R.; Kumar, S.; Acharya, S. Role of Aqueous Extract of Azadirachta Indica Leaves in an Experimental Model of Alzheimer’s Disease in Rats. Int. J. Appl. Basic. Med. Res. 2013, 3, 37–47. [Google Scholar] [CrossRef]
- Marini, P.; Maccarrone, M.; Saso, L.; Tucci, P. The Effect of Phytocannabinoids and Endocannabinoids on Nrf2 Activity in the Central Nervous System and Periphery. Neurol. Int. 2024, 16, 776–789. [Google Scholar] [CrossRef]
- Pang, X.; Xu, Y.; Xie, S.; Zhang, T.; Cong, L.; Qi, Y.; Liu, L.; Li, Q.; Mo, M.; Wang, G.; et al. Gallic Acid Ameliorates Cognitive Impairment Caused by Sleep Deprivation through Antioxidant Effect. Exp. Neurobiol. 2023, 32, 285–301. [Google Scholar] [CrossRef]
- Meftahi, G.H.; Aboutaleb, N. Gallic acid ameliorates behavioral dysfunction, oxidative damage, and neuronal loss in the prefrontal cortex and hippocampus in stressed rats. J. Chem. Neuroanat. 2023, 134, 102364. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.M.; Wang, G.L.; Ma, Z.G. Protective effects of myricetin on chronic stress-induced cognitive deficits. NeuroReport 2016, 27, 652–658. [Google Scholar] [CrossRef] [PubMed]
- Rinwa, P.; Kumar, A. Quercetin along with piperine prevents cognitive dysfunction, oxidative stress and neuro-inflammation associated with mouse model of chronic unpredictable stress. Arch. Pharmacal Res. 2017, 40, 1166–1175. [Google Scholar] [CrossRef] [PubMed]
- Chheng, C.; Waiwut, P.; Plekratoke, K.; Chulikhit, Y.; Daodee, S.; Monthakantirat, O.; Pitiporn, S.; Musigavong, N.; Kwankhao, P.; Boonyarat, C. Multitarget Activities of Kleeb Bua Daeng, a Thai Traditional Herbal Formula, Against Alzheimer’s Disease. Pharmaceuticals 2020, 13, 79. [Google Scholar] [CrossRef]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef]
- Chulikhit, Y.; Sukhano, W.; Daodee, S.; Putalun, W.; Wongpradit, R.; Khamphukdee, C.; Umehara, K.; Noguchi, H.; Matsumoto, K.; Monthakantirat, O. Effects of Pueraria candollei var mirifica (Airy Shaw and Suvat.) Niyomdham on ovariectomy-induced cognitive impairment and oxidative stress in the mouse brain. Molecules 2021, 26, 3442. [Google Scholar] [CrossRef]
- Daodee, S.; Monthakantirat, O.; Tantipongpiradet, A.; Maneenet, J.; Chotritthirong, Y.; Boonyarat, C.; Khamphukdee, C.; Kwankhao, P.; Pitiporn, S.; Awale, S.; et al. Effect of Yakae-Prajamduen-Jamod Traditional Thai Remedy on Cognitive Impairment in an Ovariectomized Mouse Model and Its Mechanism of Action. Molecules 2022, 27, 4310. [Google Scholar] [CrossRef]
- Zhao, S.; Ghosh, A.; Lo, C.-S.; Chenier, I.; Scholey, J.W.; Filep, J.G.; Ingelfinger, J.R.; Zhang, S.-L.; Chan, J.S.D. Nrf2 Deficiency Upregulates Intrarenal Angiotensin-Converting Enzyme-2 and Angiotensin 1-7 Receptor Expression and Attenuates Hypertension and Nephropathy in Diabetic Mice. Endocrinology 2017, 159, 836–852. [Google Scholar] [CrossRef]
- Li, Y.; Huang, Y.; Piao, Y.; Nagaoka, K.; Watanabe, G.; Taya, K.; Li, C. Protective Effects of Nuclear Factor Erythroid 2-Related Factor 2 on Whole Body Heat Stress-Induced Oxidative Damage in the Mouse Testis. Reprod. Biol. Endo-Crinol 2013, 11, 23. [Google Scholar] [CrossRef]
- Chalermwongkul, C.; Khamphukdee, C.; Maneenet, J.; Daodee, S.; Monthakantirat, O.; Boonyarat, C.; Chotritthi-rong, Y.; Awale, S.; Kijjoa, A.; Chulikhit, Y. Antidepressant-like Effect of Oroxylum Indicum Seed Extract in Mice Model of Unpredictable Chronic Mild Stress. Nutrients 2023, 15, 4742. [Google Scholar] [CrossRef]
- McRae, G.; Melanson, J.E. Quantitative Determination and Validation of 17 Cannabinoids in Cannabis and Hemp Using Liquid Chromatography-Tandem Mass Spectrometry. Anal. Bioanal. Chem. 2020, 412, 7381–7393. [Google Scholar] [CrossRef]








| Scientific Name | Part Used | Proportion (%) | Voucher Specimen |
|---|---|---|---|
| Cannabis sativa Linn. | leaves | 15.385 | ABH-SSY1 |
| Piper retrofractum Vahl. | fruits | 14.103 | ABH-SSY2 |
| Zingiber officinale Roscoe. | rhizomes | 12.821 | ABH-SSY3 |
| Piper nigrum Linn. | fruits | 11.538 | ABH-SSY4 |
| Mesua ferrea Linn. | flowers | 10.256 | ABH-SSY5 |
| Myristica fragrans Houtt. | fruits | 8.974 | ABH-SSY6 |
| Aucklandia lappa Decne. | roots | 7.692 | ABH-SSY7 |
| Nigella sativa Linn. | seeds | 6.410 | ABH-SSY8 |
| Cinnamomum bejolghota Buch.-Ham. | barks | 5.128 | ABH-SSY9 |
| Kleinhovia hospita Linn. | stem | 3.846 | ABH-SSY10 |
| Azadirachta indica A. Juss. | leaves | 2.564 | ABH-SSY11 |
| Camphor | - | 1.282 | - |
| Scientific Name | % Yield (w/w) | DPPH Assay IC50 (mg/mL) | ABTS Assay IC50 (mg/mL) |
|---|---|---|---|
| Cannabis sativa Linn. | 15.717 | 1.322 ± 0.012 | 0.249 ± 0.009 |
| Piper retrofractum Vahl. | 12.451 | 0.799 ± 0.010 | 0.640 ± 0.038 |
| Zingiber officinale Roscoe. | 4.615 | 0.285 ± 0.004 | 0.055 ± 0.005 |
| Piper nigrum Linn. | 8.362 | 0.632 ± 0.080 | 0.224 ± 0.010 |
| Mesua ferrea Linn. | 17.671 | 0.057 ± 0.000 | 0.021 ± 0.001 |
| Myristica fragrans Houtt. | 19.680 | 0.563 ± 0.007 | 0.071 ± 0.002 |
| Aucklandia lappa Decne. | 22.125 | 0.598 ± 0.006 | 0.487 ± 0.022 |
| Nigella sativa Linn. | 50.448 | 8.460 ± 0.053 | 2.047 ± 0.047 |
| Cinnamomum bejolghota Buch.-Ham. | 14.653 | 0.011 ± 0.000 | 0.013 ± 0.000 |
| Kleinhovia hospita Linn. | 2.443 | 0.295 ± 0.004 | 0.093 ± 0.001 |
| Azadirachta indica A. Juss. | 19.615 | 0.073 ± 0.001 | 0.068 ± 0.004 |
| Camphor | - | >1000 | >1000 |
| Suk-SaiYasna | 18.245 | 0.682 ± 0.010 | 0.199 ± 0.004 |
| Trolox (µM) | 39.178 ± 0.134 | 54.968 ± 4.088 |
| Chemical Constituent | Cannabis sativa Linn. (mg/g Extract) | Suk-SaiYasna (mg/g Extract) |
|---|---|---|
| CBD | 4.09 ± 0.05 | 0.03 ± 0.00 |
| delta-9-THC | 5.94 ± 0.04 | 1.04 ± 0.01 |
| delta-8-THC | n.a. | n.a. |
| THCA-A | 2.44 ± 0.03 | 0.61 ± 0.01 |
| Chemical Constituent | Amount of Chemical Constituent (mg/g Extract) | |
|---|---|---|
| Piperine | Piper retrofractum Vahl. | 5.690 ± 0.011 |
| Piper nigrum Linn. | 4.375 ± 0.009 | |
| SSY | 8.853 ± 0.014 | |
| 6-Gingerol | Zingiber officinale Roscoe. | 13.556 ± 0.012 |
| SSY | 1.687 ± 0.003 | |
| Gallic acid | Mesua ferrea Linn. | 175.047 ± 0.344 |
| Kleinhovia hospita Linn. | 6.745 ± 0.014 | |
| SSY | 167.777 ± 0.079 | |
| Myricetin | Mesua ferrea Linn. | 18.510 ± 0.063 |
| Kleinhovia hospita Linn. | 1.247 ± 0.005 | |
| SSY | 17.225 ± 0.026 | |
| Myristicin | Myristica fragrans Houtt. | 7.391 ± 0.009 |
| SSY | 6.847 ± 0.009 | |
| Thymoquinone | Nigella sativa Linn. | 15.431 ± 0.048 |
| SSY | 2.262 ± 0.024 | |
| Cinnamic acid | Cinnamomum bejolghota Buch.-Ham. | 3.931 ± 0.008 |
| SSY | 4.662 ± 0.001 | |
| Costunolide | Aucklandia lappa Decne. | 12.522 ± 0.007 |
| SSY | 7.911 ± 0.008 | |
| Azadirachtin | Azadirachta indica A. Juss. | 10.278 ± 0.050 |
| SSY | 2.146 ± 0.073 | |
| Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) | Reference |
|---|---|---|---|
| Keap1 | CATCCACCCTAAGGTCATGGA | GACAGGTTGAGAACTCCTCC | [50] |
| Nrf2 | CAGTGCTCCTATGCGTGAA | GCGGCTTGAATGTTTGTC | [51] |
| HO-1 | ACAGATGGCGTCACTTCG | TGAGGACCCACTGGAGGA | |
| NQO1 | CTTTAGGGTCGTCTTGG | CAATCAGGGCTCTTCTCG | |
| GAPDH | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA | [52] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Masraksa, W.; Daodee, S.; Monthakantirat, O.; Boonyarat, C.; Khamphukdee, C.; Kwankhao, P.; Mading, A.; Muenhong, P.; Maneenet, J.; Awale, S.; et al. Suk-SaiYasna Remedy, a Traditional Thai Medicine, Mitigates Stress-Induced Cognitive Impairment via Keap1-Nrf2 Pathway. Int. J. Mol. Sci. 2025, 26, 5388. https://doi.org/10.3390/ijms26115388
Masraksa W, Daodee S, Monthakantirat O, Boonyarat C, Khamphukdee C, Kwankhao P, Mading A, Muenhong P, Maneenet J, Awale S, et al. Suk-SaiYasna Remedy, a Traditional Thai Medicine, Mitigates Stress-Induced Cognitive Impairment via Keap1-Nrf2 Pathway. International Journal of Molecular Sciences. 2025; 26(11):5388. https://doi.org/10.3390/ijms26115388
Chicago/Turabian StyleMasraksa, Wuttipong, Supawadee Daodee, Orawan Monthakantirat, Chantana Boonyarat, Charinya Khamphukdee, Pakakrong Kwankhao, Abdulwaris Mading, Poowanarth Muenhong, Juthamart Maneenet, Suresh Awale, and et al. 2025. "Suk-SaiYasna Remedy, a Traditional Thai Medicine, Mitigates Stress-Induced Cognitive Impairment via Keap1-Nrf2 Pathway" International Journal of Molecular Sciences 26, no. 11: 5388. https://doi.org/10.3390/ijms26115388
APA StyleMasraksa, W., Daodee, S., Monthakantirat, O., Boonyarat, C., Khamphukdee, C., Kwankhao, P., Mading, A., Muenhong, P., Maneenet, J., Awale, S., Matsumoto, K., & Chulikhit, Y. (2025). Suk-SaiYasna Remedy, a Traditional Thai Medicine, Mitigates Stress-Induced Cognitive Impairment via Keap1-Nrf2 Pathway. International Journal of Molecular Sciences, 26(11), 5388. https://doi.org/10.3390/ijms26115388

