Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling
Abstract
1. Introduction
2. Results
2.1. Proliferation- and Apoptosis-Related Gene Detection
2.2. Determination of the Proliferation, Apoptosis, and Migration Capacity of M60 and CL23 Cells
2.3. Construction and Characterisation of THBS1-Knockdown and -Overexpressing MDCK Cell Lines
2.4. Effect of Knockdown of THBS1 on Proliferation, Apoptosis, and Migration Ability of CL23 Cells
2.5. Effects of Overexpression of THBS1 on Cell Proliferation, Apoptosis, and Migration Ability
2.6. Effects of the Knockdown and Overexpression of THBS1 on H1N1 Influenza Virus Replication
2.7. Expression of TGF-β/Smad Pathway Target Genes in M60 and CL23 Cells
2.8. Effects of Knockdown and Overexpression of THBS1 on the Expression of Target Genes Downstream of TGF-β/Smad Signalling
2.9. Effects of TGF-β Activators and Inhibitors on TGF-β/Smad Signalling Target Genes and THBS1 Expression in MDCK Cells
2.10. Effects of TGF-β Activators and Inhibitors on Target Genes Downstream of PI3K/Akt and P53 Signalling in MDCK Cells
2.11. Effects of TGF-β Activators and Inhibitors on the Proliferative, Migratory Capacities and Apoptosis Ability of THBS1-Knockdown and -Overexpressing Cells
3. Discussion
4. Material and Methods
4.1. Cell Culture and Virus
4.2. Lentivirus Transfection
4.3. Treatment of THBS1-Knockdown/Overexpression Cell Lines with TGF-β Activator and Inhibitor
4.4. RNA Extraction and cDNA Library Construction
4.5. Reverse Transcription and RT-qPCR of RNA Samples
4.6. Western Blotting
4.7. Cell Proliferative Capacity Assay
4.8. Detection of Apoptotic Capacity
4.9. Cell Migration Assays
4.10. Analysing the Cell Cycle Viaflow Cytometry
4.11. H1N1 Influenza Virus Infects MDCK Cells
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Uyeki, T.M.; Hui, D.S.; Zambon, M.; Wentworth, D.E.; Monto, A.S. Influenza. Lancet 2022, 400, 693–706. [Google Scholar] [CrossRef] [PubMed]
- Guan, L.; Ping, J.; Lopes, T.J.S.; Fan, S.; Presler, R.; Neumann, G.; Kawaoka, Y. Development of an Enhanced High-Yield Influenza Vaccine Backbone in Embryonated Chicken Eggs. Vaccines 2023, 11, 1364. [Google Scholar] [CrossRef] [PubMed]
- Chia, M.Y.; Lin, C.Y.; Chen, P.L.; Lai, C.C.; Weng, T.C.; Sung, W.C.; Hu, A.Y.; Lee, M.S. Characterization and Immunogenicity of Influenza H7N9 Vaccine Antigens Produced Using a Serum-Free Suspension MDCK Cell-Based Platform. Viruses 2022, 14, 1937. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Z.; Guo, S.; Liu, G.; Pei, M.; Liao, Y.; Wang, J.; Zhang, J.; Yang, D.; Qiao, Z.; Li, Z.; et al. TGM2 inhibits the proliferation, migration and tumorigenesis of MDCK cells. PLoS ONE 2023, 18, e0285136. [Google Scholar] [CrossRef]
- Feng, S.Z.; Jiao, P.R.; Qi, W.B.; Fan, H.Y.; Liao, M. Development and strategies of cell-culture technology for influenza vaccine. Appl. Microbiol. Biotechnol. 2011, 89, 893–902. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Yu, S.; Xu, Y.; Zhao, Y.; Li, L.; Sun, J.; Wang, X.; Guo, Y.; Zhang, Y. The Screening and Mechanism of Influenza-Virus Sensitive MDCK Cell Lines for Influenza Vaccine Production. Diseases 2024, 12, 20. [Google Scholar] [CrossRef]
- Bruckhoff, B. The production of influenza vaccines from MDCK cell cultures. Pharm. Unserer Zeit 2011, 40, 140–142. [Google Scholar] [CrossRef]
- Ma, G.L.; Qiao, Z.L.; He, D.; Wang, J.; Kong, Y.Y.; Xin, X.Y.; Wen, F.Q.; Bao, S.J.; Ma, Z.R.; Wang, F.S.; et al. Establishment of a low-tumorigenic MDCK cell line and study of differential molecular networks. Biologicals 2020, 68, 112–121. [Google Scholar] [CrossRef]
- Short, S.M.; Derrien, A.; Narsimhan, R.P.; Lawler, J.; Ingber, D.E.; Zetter, B.R. Inhibition of endothelial cell migration by thrombospondin-1 type-1 repeats is mediated by beta1 integrins. J. Cell Biol. 2005, 168, 643–653. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, K.; Sumarriva, K.; Kim, R.; Jiang, R.; Brantley-Sieders, D.M.; Chen, J.; Mernaugh, R.L.; Takahashi, T. Determination of the CD148-Interacting Region in Thrombospondin-1. PLoS ONE 2016, 11, e0154916. [Google Scholar] [CrossRef]
- Jiang, D.; Guo, B.; Lin, F.; Hui, Q.; Tao, K. Effect of THBS1 on the Biological Function of Hypertrophic Scar Fibroblasts. BioMed Res. Int. 2020, 2020, 8605407. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Xu, Y.; Xiao, F.; Zhang, J.; Wang, Y.; Yao, Y.; Yang, J. Comprehensive Analysis of a circRNA-miRNA-mRNA Network to Reveal Potential Inflammation-Related Targets for Gastric Adenocarcinoma. Mediat. Inflamm. 2020, 2020, 9435608. [Google Scholar] [CrossRef]
- Isenberg, J.S.; Roberts, D.D. THBS1 (thrombospondin-1). Atlas Genet. Cytogenet. Oncol. Haematol. 2020, 24, 291–299. [Google Scholar] [CrossRef]
- Rosini, S.; Pugh, N.; Bonna, A.M.; Hulmes, D.J.S.; Farndale, R.W.; Adams, J.C. Thrombospondin-1 promotes matrix homeostasis by interacting with collagen and lysyl oxidase precursors and collagen cross-linking sites. Sci. Signal. 2018, 11, eaar2566. [Google Scholar] [CrossRef]
- Isenberg, J.S.; Hyodo, F.; Ridnour, L.A.; Shannon, C.S.; Wink, D.A.; Krishna, M.C.; Roberts, D.D. Thrombospondin 1 and vasoactive agents indirectly alter tumor blood flow. Neoplasia 2008, 10, 886–896. [Google Scholar] [CrossRef] [PubMed]
- Lv, Y.; Huang, Y.; Fan, H.; Zhao, Y.; Ma, L.; Lan, Y.; Li, C.; Chen, P.; Lou, Z.; Zhou, J. 17β-Estradiol inhibits hydrogen peroxide-induced senescence and apoptosis in human umbilical vein endothelial cells by regulating the THBS1/TGF-β/Smad axis. Mol. Cell Endocrinol. 2024, 580, 112111. [Google Scholar] [CrossRef]
- Rouanne, M.; Adam, J.; Goubar, A.; Robin, A.; Ohana, C.; Louvet, E.; Cormier, J.; Mercier, O.; Dorfmüller, P.; Fattal, S.; et al. Osteopontin and thrombospondin-1 play opposite roles in promoting tumor aggressiveness of primary resected non-small cell lung cancer. BMC Cancer 2016, 16, 483. [Google Scholar] [CrossRef] [PubMed]
- Nakao, T.; Kurita, N.; Komatsu, M.; Yoshikawa, K.; Iwata, T.; Utsunomiya, T.; Shimada, M. Expression of thrombospondin-1 and Ski are prognostic factors in advanced gastric cancer. Int. J. Clin. Oncol. 2011, 16, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Isenberg, J.S.; Martin-Manso, G.; Maxhimer, J.B.; Roberts, D.D. Regulation of nitric oxide signalling by thrombospondin 1: Implications for anti-angiogenic therapies. Nat. Rev. Cancer 2009, 9, 182–194. [Google Scholar] [CrossRef]
- Poon, R.T.; Chung, K.K.; Cheung, S.T.; Lau, C.P.; Tong, S.W.; Leung, K.L.; Yu, W.C.; Tuszynski, G.P.; Fan, S.T. Clinical significance of thrombospondin 1 expression in hepatocellular carcinoma. Clin. Cancer Res. 2004, 10 Pt 1, 4150–4157. [Google Scholar] [CrossRef] [PubMed]
- Panetti, T.S.; Chen, H.; Misenheimer, T.M.; Getzler, S.B.; Mosher, D.F. Endothelial cell mitogenesis induced by LPA: Inhibition by thrombospondin-1 and thrombospondin-2. J. Lab. Clin. Med. 1997, 129, 208–216. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.Y.; Ooyama, A.; Yamamoto, M.; Ikeda, R.; Haraguchi, M.; Tabata, S.; Furukawa, T.; Che, X.F.; Zhang, S.; Oka, T.; et al. Molecular basis for the induction of an angiogenesis inhibitor, thrombospondin-1, by 5-fluorouracil. Cancer Res. 2008, 68, 7035–7041. [Google Scholar] [CrossRef]
- Dailey, L.; Ambrosetti, D.; Mansukhani, A.; Basilico, C. Mechanisms underlying differential responses to FGF signaling. Cytokine Growth Factor. Rev. 2005, 16, 233–247. [Google Scholar] [CrossRef] [PubMed]
- Lawler, J. Counter regulation of tumor angiogenesis by vascular endothelial growth factor and thrombospondin-1. Semin. Cancer Biol. 2022, 86 Pt 2, 126–135. [Google Scholar] [CrossRef]
- Shih, H.J.; Chen, C.L.; Torng, P.L. IGFBP3 inhibits angiogenesis through intracellular regulation of THBS1 expression. Am. J. Cancer Res. 2020, 10, 1728–1744. [Google Scholar]
- Wang, Y.; Chen, J.; Gao, W.Q.; Yang, R. METTL14 promotes prostate tumorigenesis by inhibiting THBS1 via an m6A-YTHDF2-dependent mechanism. Cell Death Discov. 2022, 8, 143. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Yue, L.; Ju, Y.; Wang, J.; Lu, H.; Li, L.; Chen, M.; Wang, C.; Li, S.; Liu, T.; et al. Transcriptomic analysis for the retested positive COVID-19 patients with long-term persistent SARS-CoV-2 but without symptoms in Wuhan. Clin. Transl. Med. 2023, 13, e1172. [Google Scholar] [CrossRef]
- Li, F.; Liu, B.; Xiong, Y.; Zhang, Z.; Zhang, Q.; Qiu, R.; Peng, F.; Nian, X.; Wu, D.; Li, X.; et al. Enhanced Downstream Processing for a Cell-Based Avian Influenza (H5N1) Vaccine. Vaccines 2024, 12, 138. [Google Scholar] [CrossRef]
- Omeir, R.; Thomas, R.; Teferedegne, B.; Williams, C.; Foseh, G.; Macauley, J.; Brinster, L.; Beren, J.; Peden, K.; Breen, M.; et al. A novel canine kidney cell line model for the evaluation of neoplastic development: Karyotype evolution associated with spontaneous immortalization and tumorigenicity. Chromosome Res. 2015, 23, 663–680. [Google Scholar] [CrossRef] [PubMed]
- Jian, S.; Di, Y.; Lingwei, H.; Zhenbin, L.; Jiamin, W.; Zhiyong, M.; Ayimuguli, A.; Zhihua, Q. MiR-2779-x, a Key microRNA that is Related to the Tumorigenicity of the MDCK Cell Line. Res. Sq. 2024. [Google Scholar] [CrossRef]
- Liu, Z.; Pei, M.; Liu, G.; Qiu, Z.; Wang, S.; Qiao, Z.; Wang, J.; Jin, D.; Zhang, J.; Duan, K.; et al. CDC20 is a potential target gene to inhibit the tumorigenesis of MDCK cells. Biologicals 2023, 83, 101697. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Z.; Yang, D.; Liu, L.; Liu, Z.; Wang, J.; He, D.; Wu, H.; Wang, J.; Ma, Z. Genome-wide identification and characterization of long non-coding RNAs in MDCK cell lines with high and low tumorigenicities. Genomics 2020, 112, 1077–1086. [Google Scholar] [CrossRef] [PubMed]
- Le, Y.; Zhang, J.; Gong, Z.; Zhang, Z.; Nian, X.; Li, X.; Yu, D.; Ma, N.; Zhou, R.; Zhang, G.; et al. TRAF3 deficiency in MDCK cells improved sensitivity to the influenza A virus. Heliyon 2023, 9, e19246. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Wharton, S.A.; Whittaker, L.; Dai, M.; Ermetal, B.; Lo, J.; Pontoriero, A.; Baumeister, E.; Daniels, R.S.; McCauley, J.W. The characteristics and antigenic properties of recently emerged subclade 3C. 3a and 3C.2a human influenza A(H3N2) viruses passaged in MDCK cells. Influenza Other Respir. Viruses 2017, 11, 263–274. [Google Scholar] [CrossRef] [PubMed]
- Jing, W.; Zhang, X.; Sun, W.; Hou, X.; Yao, Z.; Zhu, Y. CRISPR/CAS9-Mediated Genome Editing of miRNA-155 Inhibits Proinflammatory Cytokine Production by RAW264.7 Cells. BioMed Res. Int. 2015, 2015, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Teng, Y.; Luo, M.; Yu, T.; Chen, L.; Huang, Q.; Chen, S.; Xie, L.; Zeng, Y.; Luo, F.; Xiong, H.; et al. CRISPR/Cas9-mediated deletion of miR-146a enhances antiviral response in HIV-1 infected cells. Genes. Immun. 2019, 20, 327–337. [Google Scholar] [CrossRef] [PubMed]
- Chang, H.; Yi, B.; Ma, R.; Zhang, X.; Zhao, H.; Xi, Y. CRISPR/cas9, a novel genomic tool to knock down microRNA in vitro and in vivo. Sci. Rep. 2016, 6, 22312. [Google Scholar] [CrossRef]
- Jiang, D.; Guo, B.; Lin, F.; Lin, S.; Tao, K. miR-205 inhibits the development of hypertrophic scars by targeting THBS1. Aging 2020, 12, 22046–22058. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Pagadala, J.; Miller, D.D.; Steinle, J.J. Insulin-like growth factor-1 binding protein 3 (IGFBP-3) promotes recovery from trauma-induced expression of inflammatory and apoptotic factors in retina. Cytokine 2014, 70, 115–119. [Google Scholar] [CrossRef][Green Version]
- Resovi, A.; Pinessi, D.; Chiorino, G.; Taraboletti, G. Current understanding of the thrombospondin-1 interactome. Matrix Biol. 2014, 37, 83–91. [Google Scholar] [CrossRef]
- Calzada, M.J.; Roberts, D.D. Novel integrin antagonists derived from thrombospondins. Curr. Pharm. Des. 2005, 11, 849–866. [Google Scholar] [CrossRef] [PubMed]
- Bender, H.R.; Campbell, G.E.; Aytoda, P.; Mathiesen, A.H.; Duffy, D.M. Thrombospondin 1 (THBS1) Promotes Follicular Angiogenesis, Luteinization, and Ovulation in Primates. Front. Endocrinol. 2019, 10, 727. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.Y.; Fang, Y.; Zheng, F.X.; Zhang, Y.Z.; Li, Q.L. LncRNA NEAT1 facilitates the progression of sepsis through up-regulating TSP-1 via sponging miR-370-3p. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 333–344. [Google Scholar] [CrossRef]
- Kamijo, H.; Miyagaki, T.; Takahashi-Shishido, N.; Nakajima, R.; Oka, T.; Suga, H.; Sugaya, M.; Sato, S. Thrombospondin-1 promotes tumor progression in cutaneous T-cell lymphoma via CD47. Leukemia 2020, 34, 845–856. [Google Scholar] [CrossRef] [PubMed]
- Chen, W. TGF-β Regulation of T Cells. Annu. Rev. Immunol. 2023, 41, 483–512. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Ten Dijke, P. Immunoregulation by members of the TGFβ superfamily. Nat. Rev. Immunol. 2016, 16, 723–740. [Google Scholar] [CrossRef] [PubMed]
- Kulkarni, A.B.; Huh, C.G.; Becker, D.; Geiser, A.; Lyght, M.; Flanders, K.C.; Roberts, A.B.; Sporn, M.B.; Ward, J.M.; Karlsson, S. Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proc. Natl. Acad. Sci. USA 1993, 90, 770–774. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.; Yin, J.; Ding, L.; Luo, J.; Luo, J.; Mu, J.; Pan, S.; Du, J.; Zhong, Y.; Zhang, L.; et al. SPAG6 regulates cell proliferation and apoptosis via TGF-β/Smad signal pathway in adult B-cell acute lymphoblastic leukemia. Int. J. Hematol. 2024, 119, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Siegel, P.M.; Massagué, J. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer 2003, 3, 807–821. [Google Scholar] [CrossRef]
- Lin, H.K.; Bergmann, S.; Pandolfi, P.P. Deregulated TGF-beta signaling in leukemogenesis. Oncogene 2005, 24, 5693–5700. [Google Scholar] [CrossRef] [PubMed]
- Ikushima, H.; Miyazono, K. TGF-β signal transduction spreading to a wider field: A broad variety of mechanisms for context-dependent effects of TGF-β. Cell Tissue Res. 2012, 347, 37–49. [Google Scholar] [CrossRef] [PubMed]
- Spender, L.C.; Inman, G.J. TGF-beta induces growth arrest in Burkitt lymphoma cells via transcriptional repression of E2F-1. J. Biol. Chem. 2009, 284, 1435–1442. [Google Scholar] [CrossRef]
- Naka, K.; Hirao, A. Regulation of Hematopoiesis and Hematological Disease by TGF-β Family Signaling Molecules. Cold Spring Harb. Perspect. Biol. 2017, 9, a027987. [Google Scholar] [CrossRef] [PubMed]
- Derynck, R.; Zhang, Y.E. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 2003, 425, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Massagué, J. TGFbeta signaling: Receptors, transducers, and Mad proteins. Cell 1996, 85, 947–950. [Google Scholar] [CrossRef] [PubMed]
- Takimoto, T.; Wakabayashi, Y.; Sekiya, T.; Inoue, N.; Morita, R.; Ichiyama, K.; Takahashi, R.; Asakawa, M.; Muto, G.; Mori, T.; et al. Smad2 and Smad3 are redundantly essential for the TGF-beta-mediated regulation of regulatory T plasticity and Th1 development. J. Immunol. 2010, 185, 842–855. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.M.; Han, Y.; Cho, K.H. Deep learning untangles the resistance mechanism of p53 reactivator in lung cancer cells. iScience 2023, 26, 108377. [Google Scholar] [CrossRef] [PubMed]




















| Gene Name | Primer Sequence (5′→3′) |
|---|---|
| Ataxin-1 (ATXN1) | F: CTGAAGAAGGTGGAGGACTTG |
| R: CCGACGGCAAACTGTATCA | |
| BCL2-Associated X (Bax) | F: TCCCCGTGAGGTCTTCTTCC |
| R: GGGCCTTGAGCACCAGTTT | |
| B-cell lymphoma-2 (Bcl2) | F: TCATCCAAGAATGCAAAGCAC |
| R: CCCGGTTATCGTACCCTGTT | |
| Cyclin D1 | F: TGCCAGTGGCAGAGGAGAA |
| R: TGGAGGGTGGGTTGGAAAT | |
| EPH receptor B2 (EPHB2) | F: GTACCTGGCAGACATGAACTAC |
| R: GAAAGCGTGAAAGCCCAAAG | |
| Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) | F: TGACGACATCAAGAAGGTAGTG |
| R: AGTGGGTGTCACTGTTGAAG | |
| Nucleoprotein (NP) | F: TGTCAGCTATTATGGAGCTGTTAG |
| R: TGTCAGCTATTATGGAGCTGTTAG | |
| Non-Structural Protein 1 (NS1) | F: CGAAATTTCACCATTGCCTT |
| R: GTGGAGGTCTCCCATTCTCA | |
| Scavenger Receptor Class B, Member 2 (SCARB2) | F: AAGAGCACCCCTCATACGAAC |
| R: CTCCTCCCTCCTCACTACAACA | |
| Mothers against decapentaplegic homolog 2 (Smad2) | F: AGACCTTCCACGCATCACA |
| R: CACTATCACTTAGGCACTCAGCA | |
| Mothers against decapentaplegic homolog 3 (Smad3) | F: TGACCACCAGATGAACCACA |
| R: TCGCAGTAGGTGACAGGCT | |
| Transforming growth factor-β1 (TGF-β1) | F: CTGCCCACCTGGAACCTACT |
| R: TTCCTTCAAGTCCCAAATGCT | |
| Thrombosponin-1 (THBS1) | F: CTATGACAAGGACGGGATTGG |
| R: ATACTGGGCTGGGTTGTAATG | |
| TP53 | F: GTTGGCCTGCACAGTTGGT |
| R: GTTGGCCTGCACAGTTGGT | |
| Uroplakin3A (UPK3A) | F: GTGGCCTTTGGCCTGAT |
| R: GAGGTACGCGTTCAGGATTT | |
| β-actin | F: CTGCCCACCTGGAACCTACT |
| R: TTCCTTCAAGTCCCAAATGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, R.; Zhang, F.; Wang, L.; Wang, S.; Zhou, M.; Wang, J.; Zhang, Y.; Tan, X.; Chen, W.; Yang, K.; et al. Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling. Int. J. Mol. Sci. 2025, 26, 395. https://doi.org/10.3390/ijms26010395
Li R, Zhang F, Wang L, Wang S, Zhou M, Wang J, Zhang Y, Tan X, Chen W, Yang K, et al. Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling. International Journal of Molecular Sciences. 2025; 26(1):395. https://doi.org/10.3390/ijms26010395
Chicago/Turabian StyleLi, Rui, Fan Zhang, Lijin Wang, Siya Wang, Manlin Zhou, Jun Wang, Yiyang Zhang, Xiao Tan, Weiji Chen, Kun Yang, and et al. 2025. "Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling" International Journal of Molecular Sciences 26, no. 1: 395. https://doi.org/10.3390/ijms26010395
APA StyleLi, R., Zhang, F., Wang, L., Wang, S., Zhou, M., Wang, J., Zhang, Y., Tan, X., Chen, W., Yang, K., & Qiao, Z. (2025). Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling. International Journal of Molecular Sciences, 26(1), 395. https://doi.org/10.3390/ijms26010395
