Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients
Abstract
1. Introduction
2. Results
2.1. Levels of Anti-Viral Response Cytokines
2.2. Levels of Inflammation-Associated Cytokines
2.3. Numbers of Copies of Viral and Bacterial DNA
2.4. There Are Correlations Between Measured Cytokines and Patients’ Clinical Features
3. Discussion
Limitations of the Study
4. Materials and Methods
4.1. Clinical Sample Analysis
4.2. Cytokine Quantification by Flow Cytometer
4.3. Cytometric Raw Data Analysis
4.4. Viral DNA Extraction
4.5. Bacterial DNA Extraction
4.6. Real-Time Quantitative Polymerase Chain Reaction—Viral Assay
4.7. Real-Time Quantitative Polymerase Chain Reaction—Bacterial Assay
4.8. qRT-PCR Raw Data Analysis
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Patients | Age | Sex | Disease Activity Score (DAS) 28 | The Health Assessment Questionnaire (HAQ) | American College of Rheumatology (ACR) Joint Pain | ACR Joint Swelling | Total Score of Joint Pain | Total Score of Joint Swelling | Number of Painful Joints DAS28 | Number of Swelling Joints DAS28 | Rheumatoid Factor (RF) | Anti-Cyclic Citrullinated Peptide (Anti-CCP) [U/mL] | Neutrocytes [%] | Lymphocytes [%] | Monocytes [%] | Eosinophils [%] | Basophils [%] |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ORD1 | 42 | female | 1.81 | - | 0 | 0 | 1 | 1 | 0 | 0 | <10 | - | 45.6 | 42.3 | 9.3 | 2.5 | 0.3 |
| ORD2 | 41 | female | 3.86 | 0.375 | 2 | 2 | 4 | 4 | 2 | 2 | <10 | <7 | 56.7 | 33.8 | 6.2 | 2.4 | 0.9 |
| ORD3 | 22 | female | 4.56 | 0.500 | 5 | 0 | 5 | 0 | 18 | 0 | <10 | <7 | 62.5 | 26.0 | 10.1 | 1.3 | 0.1 |
| ORD4 | 32 | female | 3.60 | 0.625 | 3 | 3 | 4 | 4 | - | - | <10 | <7 | 62.9 | 29.5 | 5.8 | 1.7 | 0.1 |
| ORD5 | 34 | female | 0.64 | 0.250 | 1 | 0 | 2 | 1 | 0 | 0 | 17 | <7 | 49.3 | 40.9 | 6.2 | 3.3 | 0.3 |
| ORD6 | 38 | female | 2.10 | 0.250 | 3 | 2 | 4 | 3 | 3 | 1 | <10 | <7 | 51.4 | 38.0 | 8.5 | 1.9 | 0.2 |
| ORD7 | 24 | female | 1.68 | 0.250 | 2 | 2 | 3 | 3 | 2 | 1 | <10 | <7 | 45.2 | 47.7 | 5.6 | 1.3 | 0.2 |
| ORD8 | 46 | female | 2.91 | - | 3 | 0 | 4 | 1 | 5 | 0 | <10 | <7 | 53.1 | 33.1 | 10.5 | 2.9 | 0.4 |
| ORD9 | 43 | female | 1.36 | 0 | 0 | 0 | 1 | 1 | 0 | 2 | <10 | <7 | 58.3 | 27.7 | 10.2 | 3.6 | 0.2 |
| ORD10 | 23 | female | 4.17 | 1.000 | 5 | 5 | 9 | 9 | 26 | 0 | 96 | <7 | 38.9 | 51.7 | 7.2 | 2.0 | 0.2 |
| ORD11 | 20 | female | 3.38 | 0.750 | 3 | 0 | 6 | 3 | 10 | 0 | 23 | <7 | 61.5 | 29.5 | 7.5 | 1.1 | 0.4 |
| ORD12 | 46 | female | 2.04 | 0 | - | - | - | - | 0 | 0 | <10 | - | 54.4 | 36.3 | 6.6 | 2.1 | 0.6 |
| ORD13 | 52 | female | 3.53 | 0.875 | - | - | - | - | 2 | 1 | <10 | <7 | 46.6 | 41.1 | 8.5 | 3.5 | 0.3 |
| ORD14 | 53 | female | 0 | 0 | 2 | 2 | 3 | 3 | 0 | 0 | <10 | <7 | 68.3 | 24.5 | 5.8 | 1.3 | 0.1 |
| ORD15 | 56 | female | - | - | 0 | 0 | 1 | 1 | - | - | <10 | <7 | 41.9 | 46.3 | 8.7 | 2.7 | 0.4 |
| ORD16 | 43 | female | 1.95 | 0 | 2 | 2 | 3 | 3 | 1 | 0 | <10 | - | - | - | - | - | - |
| ORD17 | 56 | female | 4.90 | 1.125 | 3 | 0 | 4 | 1 | 11 | 5 | <10 | <7 | 57.9 | 30.8 | 6.5 | 4.5 | 0.3 |
| ORD18 | 44 | female | 2.02 | 0.625 | 2 | 2 | 3 | 3 | 0 | 3 | <10 | <7 | 52.4 | 35.4 | 7.3 | 3.4 | 1.5 |
| ORD19 | 36 | male | 0.90 | 0 | 2 | 2 | 3 | 3 | 0 | 2 | <10 | <7 | 46.4 | 38.7 | 12.0 | 2.4 | 0.5 |
| RA1 | 44 | female | 4.65 | 0.625 | 3 | 3 | 7 | 7 | 8 | 4 | 21 | 268.8 | 69.7 | 23.8 | 5.7 | 0.6 | 0.2 |
| RA2 | 61 | female | 4.13 | 1.375 | 1 | 0 | 3 | 2 | - | - | 11 | 24.79 | 65.7 | 22.4 | 7.9 | 3.8 | 0.2 |
| RA3 | 55 | female | 5.26 | 0.375 | 2 | 2 | 6 | 6 | 14 | 1 | 106 | 481.4 | 50.1 | 36.8 | 10.1 | 2.8 | 0.2 |
| RA4 | 33 | female | 6.26 | 0.375 | 5 | 5 | 10 | 10 | 12 | 7 | 13 | >500 | 71.0 | 20.9 | 6.1 | 1.6 | 0.4 |
| RA5 | 39 | female | 2.67 | 0 | 3 | 0 | 3 | 0 | 4 | 0 | <10 | <7 | 54.4 | 30.7 | 8 | 6.7 | 0.2 |
| RA6 | 18 | female | 5.01 | 1.375 | 2 | 5 | 6 | 9 | 10 | 10 | 57 | 17.31 | 45.4 | 43.0 | 8.2 | 3.1 | 0.3 |
| RA7 | 42 | female | 4.08 | 0.375 | 3 | 3 | 4 | 4 | 10 | 1 | <10 | <7 | 59.8 | 29.1 | 8.4 | 2.5 | 0.2 |
| RA8 | 47 | female | 4.95 | 0.875 | 2 | 3 | 2 | 3 | 4 | 6 | <10 | <7 | 66.7 | 22.0 | 8.6 | 2.5 | 0.2 |
| RA9 | 51 | female | 4.07 | 0.750 | 3 | 2 | 4 | 4 | 7 | 3 | <10 | <7 | 67.4 | 20.2 | 8.8 | 3.1 | 0.5 |
| RA10 | 50 | female | 4.35 | 1.625 | 2 | 2 | 5 | 5 | 3 | 1 | 12 | 72.18 | 71.4 | 21.8 | 4.9 | 1.6 | 0.3 |
| RA11 | 55 | female | 5.18 | 0.750 | 5 | 5 | 6 | 6 | 8 | 8 | <10 | <7 | 56.5 | 31.2 | 7.2 | 4.3 | 0.8 |
| RA12 | 42 | female | 5.93 | 2.000 | 5 | 5 | 10 | 10 | 12 | 8 | 28 | 455.0 | 63.6 | 23.5 | 8.5 | 4.1 | 0.3 |
| RA13 | 55 | male | 4.98 | 0 | 2 | 2 | 4 | 4 | - | - | <10 | <7 | 67.9 | 21.6 | 6.7 | 3.4 | 0.4 |
| RA14 | 23 | female | 4.67 | 0.625 | 3 | 3 | 8 | 8 | 1 | 10 | 79 | 17.85 | 71.2 | 17.2 | 9.3 | 2.1 | 0.2 |
| RA15 | 51 | male | 3.60 | 0.875 | 3 | 3 | 7 | 7 | 4 | 0 | 143 | >500 | 62.0 | 27.0 | 9.1 | 1.6 | 0.3 |
| HC1 | 41 | male | - | - | - | - | - | - | - | - | <10 | <7 | 52.3 | 35.7 | 8.6 | 2.6 | 0.8 |
| HC2 | 31 | female | - | - | - | - | - | - | - | - | <10 | <7 | 43.9 | 43.1 | 9.2 | 3.1 | 0.7 |
| HC3 | 32 | female | - | - | - | - | - | - | - | - | <10 | <7 | 46.7 | 43.3 | 7.0 | 2.7 | 0.3 |
| HC4 | 43 | female | - | - | - | - | - | - | - | - | <10 | <7 | 36.6 | 47.8 | 11.6 | 3.5 | 0.5 |
| HC5 | 42 | female | - | - | - | - | - | - | - | - | <10 | <7 | 48.4 | 40.4 | 8.6 | 2.5 | 0.1 |
| HC6 | 47 | female | - | - | - | - | - | - | - | - | <10 | <7 | 59.3 | 29.5 | 5.8 | 5.2 | 0.2 |
| HC7 | 55 | female | - | - | - | - | - | - | - | - | 11 | <7 | 56.5 | 35.6 | 6.4 | 1.2 | 0.3 |
| HC8 | 46 | female | - | - | - | - | - | - | - | - | <10 | <7 | 55.5 | 32.2 | 8.4 | 3.7 | 0.2 |
| HC9 | 34 | female | - | - | - | - | - | - | - | - | <10 | <7 | 60.4 | 30.5 | 6.3 | 2.1 | 0.7 |
| HC10 | 57 | male | - | - | - | - | - | - | - | - | <10 | <7 | 51.4 | 34.3 | 11.9 | 2.0 | 0.4 |
| HC11 | 48 | female | - | - | - | - | - | - | - | - | 304 | <7 | 60.8 | 28.1 | 8.6 | 2.4 | 0.1 |
| HC12 | 28 | female | - | - | - | - | - | - | - | - | <10 | <7 | 57.2 | 29.6 | 10.5 | 2.0 | 0.7 |
| HC13 | 43 | female | - | - | - | - | - | - | - | - | <10 | <7 | 55.3 | 35.8 | 7.2 | 1.6 | 0.1 |
| HC14 | 42 | female | - | - | - | - | - | - | - | - | <10 | <7 | 44.5 | 44.3 | 9.8 | 0.9 | 0.5 |
| HC15 | 44 | male | - | - | - | - | - | - | - | - | <10 | <7 | 65.9 | 25.5 | 7.3 | 1.2 | 0.1 |
| HC16 | 35 | female | - | - | - | - | - | - | - | - | <10 | <7 | 57.6 | 30.0 | 11.4 | 0.8 | 0.2 |
| HC17 | 39 | female | - | - | - | - | - | - | - | - | <10 | <7 | 57.2 | 30.1 | 8.8 | 3.4 | 0.5 |
| HC18 | 26 | female | - | - | - | - | - | - | - | - | <10 | <7 | 41.8 | 44.8 | 9.7 | 3.0 | 0.7 |
| HC19 | 34 | female | - | - | - | - | - | - | - | - | <10 | <7 | 38.3 | 47.6 | 11.0 | 2.9 | 0.2 |
| HC20 | 26 | female | - | - | - | - | - | - | - | - | <10 | <7 | 54.9 | 31.3 | 11.0 | 2.7 | 0.1 |
Appendix B
| Patients | Hemoglobin [g/dL] | Hematocrit [%] | Mean Corpuscular Volume (MCV) [fL] | Mean Corpuscular Hemoglobin (MCH) [pg/cell] | Mean Corpuscular Hemoglobin Concentration (MCHC) [g/dL] | Red Cell Distribution Width (RDW) [%] | Platelet Count Test (PLT) × 109/L | Mean Platelet Volume (MPV) [fL] | Erythrocyte Sedimentation Rate (ESR) [mm/hr] | Glucose [mg/dL] | Creatinine [mg/dL] | Glomerular Filtration Rate (GFR) [mL/min/1.73m2] | Uric Acid [mg/dL] | Albumin [g/dL] | C-Reactive Protein (CRP) [mg/dL] | Alanine Aminotransferase (ALAT) [U/L] |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ORD1 | 11.9 | 37.1 | 81.2 | 26.0 | 32.1 | 14.1 | 266 | 10.0 | 6 | 92 | 0.85 | >60 | 4.3 | 46.5 | 0 | 11 |
| ORD2 | 14.0 | 41.9 | 86.0 | 28.7 | 33.4 | 13.1 | 478 | 9.8 | 23 | 97 | 0.65 | >60 | 4.7 | 49.0 | 5.9 | 19 |
| ORD3 | 13.4 | 40.7 | 91.9 | 30.2 | 32.9 | 13.7 | 261 | 10.5 | 26 | 88 | 0.82 | >60 | 6.1 | 41.3 | 0.4 | 10 |
| ORD4 | 14.2 | 42.2 | 84.7 | 28.5 | 33.6 | 12.9 | 266 | 11.2 | 18 | 109 | 0.58 | >60 | 5.3 | 46.3 | 1.3 | 22 |
| ORD5 | 12.3 | 36.3 | 87.5 | 29.6 | 33.9 | 12.6 | 226 | 12.1 | 2 | 91 | 0.82 | >60 | 3.6 | 44.0 | 0.3 | 12 |
| ORD6 | 14.1 | 41.0 | 87.8 | 30.2 | 34.4 | 12.4 | 209 | 11.7 | 2 | 91 | 0.65 | >60 | 3.8 | 46.0 | 0.3 | 15 |
| ORD7 | 14.5 | 42.0 | 82.7 | 28.5 | 34.5 | 12.1 | 200 | 11.6 | 2 | 91 | 0.80 | >60 | 5.1 | 50.6 | 0 | 12 |
| ORD8 | 12.2 | 35.5 | 87.7 | 30.1 | 34.4 | 13.1 | 334 | 10.4 | 4 | 85 | 0.67 | >60 | 3.7 | 47.4 | 0 | 11 |
| ORD9 | 13.0 | 38.8 | 94.6 | 31.7 | 33.5 | 13.5 | 318 | 9.6 | 4 | 85 | 0.87 | >60 | 4.0 | 47.3 | 0.5 | 10 |
| ORD10 | 14.4 | 41.9 | 88.4 | 30.4 | 34.4 | 12.4 | 238 | 11.7 | 3 | 79 | 0.86 | >60 | 5.3 | 51.7 | 0 | 16 |
| ORD11 | 14.1 | 41.4 | 88.5 | 30.1 | 34.1 | 12.9 | 262 | 11.1 | 2 | 107 | 0.80 | >60 | 3.7 | 50.0 | 0 | 16 |
| ORD12 | 12.5 | 38.5 | 80.5 | 26.2 | 32.5 | 15.4 | 314 | 11.8 | 17 | 100 | 0.85 | >60 | 3.8 | 48.7 | 1.3 | 16 |
| ORD13 | 15.5 | 45.1 | 95.6 | 32.8 | 34.4 | 13.3 | 284 | 10.9 | 15 | 99 | 0.71 | >60 | 3.6 | 51.6 | 0 | 15 |
| ORD14 | 13.9 | 42 | 89.9 | 29.8 | 33.1 | 13.2 | 334 | 10.0 | 26 | 93 | 0.71 | >60 | 3.2 | 46.8 | 0.8 | 11 |
| ORD15 | 14.2 | 41.9 | 86.4 | 29.3 | 33.9 | 12.7 | 229 | 10.5 | 9 | 93 | 0.84 | >60 | 4.5 | 45.5 | 0.5 | 14 |
| ORD17 | 13.9 | 39.6 | 89.6 | 31.4 | 35.1 | 12.1 | 202 | 11.9 | 8 | 86 | 0.76 | >60 | 4.9 | 49.1 | 2.8 | 28 |
| ORD18 | 12.2 | 37.3 | 82.9 | 27.1 | 32.7 | 15.4 | 290 | 11.5 | 7 | 88 | 0.88 | >60 | - | - | 0 | 13 |
| ORD19 | 16.8 | 47.6 | 88.5 | 31.2 | 35.3 | 12.9 | 254 | 10.1 | 2 | 82 | 0.80 | >60 | 5.5 | 48.2 | 0.7 | 29 |
| RA1 | 12.9 | 38.6 | 89.6 | 29.9 | 33.4 | 13.5 | 372 | 10.4 | 8 | 83 | 0.64 | >60 | 3.1 | 46.1 | 1.3 | 31 |
| RA2 | 13.6 | 40.4 | 87.1 | 29.3 | 33.7 | 13.1 | 271 | 10.9 | 25 | 98 | 0.97 | 59 | 5.3 | 44.5 | 1.8 | 19 |
| RA3 | 12.9 | 37 | 82.6 | 28.8 | 34.9 | 13.5 | 214 | 12.4 | 18 | 88 | 0.75 | >60 | 4.3 | 48.6 | 1.5 | 14 |
| RA4 | 12.4 | 36.4 | 86.7 | 29.5 | 34.1 | 13.4 | 245 | 10.4 | 32 | 1 | 0.68 | >60 | 3.3 | 49.3 | 0.7 | 18 |
| RA5 | 12.8 | 36.7 | 85.2 | 29.7 | 34.9 | 17.6 | 275 | 10.7 | 5 | 95 | 0.79 | >60 | 3.5 | 46.9 | 0 | 18 |
| RA6 | 13.6 | 40.5 | 85.6 | 28.8 | 33.6 | 13.2 | 327 | 11.9 | 18 | 91 | 0.62 | >60 | - | 40.4 | 0.7 | 11 |
| RA7 | 12.6 | 38.7 | 86.4 | 28.1 | 32.6 | 12.9 | 224 | 11.8 | 5 | 87 | 0.65 | >60 | 3.6 | 44.4 | 0.5 | 12 |
| RA8 | 12.7 | 37.9 | 83.1 | 27.9 | 33.5 | 13.0 | 303 | 10.3 | 27 | 96 | 0.61 | >60 | 2.2 | 45.0 | 4.5 | 14 |
| RA9 | 14.1 | 42 | 90.3 | 30.3 | 33.6 | 13.8 | 318 | 11.6 | 13 | 1 | 0.71 | >60 | 5.2 | 45.9 | 1.3 | 26 |
| RA10 | 13.4 | 38.4 | 89.5 | 31.2 | 34.9 | 13.0 | 174 | 10.1 | 10 | 91 | 0.81 | >60 | 4.6 | 46.3 | 1.4 | 32 |
| RA11 | 12.9 | 40.7 | 87 | 27.6 | 31.7 | 12.9 | 225 | 10.5 | 19 | 112 | 0.60 | >60 | 6.1 | 45.2 | 3.0 | 28 |
| RA12 | 13.6 | 40.8 | 81.4 | 27.1 | 33.3 | 14.7 | 346 | 10.6 | 23 | 93 | 0.82 | >60 | 4.5 | 41.2 | 7.9 | 11 |
| RA13 | 12.4 | 38.8 | 77.8 | 24.8 | 32.0 | 23.2 | 330 | 10.2 | 32 | 96 | 0.89 | >60 | 3.7 | 41.3 | 15.5 | 23 |
| RA14 | 10.9 | 34.5 | 79.7 | 25.2 | 31.6 | 14.1 | 501 | 10.2 | 44 | 88 | 0.61 | >60 | 3.9 | 41.7 | 17.6 | 8 |
| RA15 | 14.6 | 43.4 | 91.9 | 30.9 | 33.6 | 13.1 | 259 | 10.2 | 14 | 139 | 0.82 | >60 | 4.2 | 42.6 | 1.0 | 12 |
| HC1 | 15.1 | 45.7 | 79.5 | 26.3 | 33.0 | 13.9 | 284 | 10.4 | 6 | 85 | 0.91 | >60 | 5.7 | 47.0 | 0 | 26 |
| HC2 | 13.8 | 41.1 | 91.7 | 30.8 | 33.6 | 13.6 | 296 | 9.7 | 5 | 89 | 0.83 | >60 | 5.0 | 0.83 | 0 | 11 |
| HC3 | 12.8 | 37.2 | 89.2 | 30.7 | 34.4 | 12.2 | 296 | 9.7 | 21 | 84 | 0.84 | >60 | 3.6 | 42.9 | 13.7 | 15 |
| HC4 | 11.5 | 34 | 82.3 | 27.8 | 33.8 | 14.3 | 309 | 10.2 | 19 | 88 | 0.71 | >60 | 3.4 | 46.0 | 0 | 15 |
| HC5 | 14.2 | 41.1 | 87.4 | 30.2 | 34.5 | 12.5 | 260 | 10.9 | 8 | 89 | 0.96 | >60 | 3.2 | 42.7 | 6.2 | 10 |
| HC6 | 12.7 | 37.9 | 91.3 | 30.6 | 33.5 | 13.2 | 296 | 10.4 | 15 | 95 | 0.82 | >60 | 3.1 | 43.6 | 1.7 | 12 |
| HC7 | 12.9 | 37.8 | 90.9 | 31 | 34.1 | 12.4 | 280 | 11.2 | 40 | 87 | 0.76 | >60 | 4.6 | 42.4 | 2.1 | 16 |
| HC8 | 10.7 | 32.7 | 74.3 | 24.3 | 32.7 | 16.4 | 360 | 9.7 | 55 | 84 | 0.73 | >60 | 3.9 | 0.7 | 3.3 | 16 |
| HC9 | 12.4 | 37.6 | 76.7 | 25.3 | 33.0 | 15.7 | 344 | 10.9 | 41 | 101 | 0.88 | >60 | 6.8 | 45.1 | 2.2 | 21 |
| HC10 | 15.9 | 45.6 | 86.7 | 30.2 | 34.9 | 13.9 | 151 | 11.4 | 9 | 107 | 1.20 | >60 | 6.4 | 44.3 | 0.9 | 20 |
| HC11 | 14.4 | 42.1 | 90.7 | 32.2 | 34.7 | 12.3 | 214 | 11.4 | 4 | 82 | 0.75 | >60 | 4.0 | 43.8 | 0.7 | 16 |
| HC12 | 14.3 | 40.4 | 82.1 | 29.1 | 35.4 | 13.6 | 170 | 12.6 | 10 | 96 | 1.02 | >60 | 4.9 | 46.4 | 0 | 7 |
| HC13 | 15 | 43 | 83.5 | 29.1 | 34.9 | 11.8 | 342 | 10.6 | 9 | 87 | 0.79 | >60 | 3.4 | 46.3 | 2.7 | 20 |
| HC14 | 13.1 | 38.7 | 93 | 31.5 | 33.9 | 13.7 | 338 | 11.5 | 9 | 89 | 0.65 | >60 | 3.4 | 44.0 | 0 | 14 |
| HC15 | 13.4 | 39.1 | 85 | 29.1 | 34.3 | 13.5 | 235 | 12.5 | 33 | 88 | 0.75 | >60 | 5.0 | 0.8 | 4.2 | 17 |
| HC16 | 12.5 | 37.7 | 92 | 30.5 | 33.2 | 14.0 | 285 | 10.4 | 8 | 83 | 0.75 | >60 | 3.3 | 44.5 | 0 | 8 |
| HC17 | 14 | 41.6 | 78.9 | 26.6 | 33.7 | 13.3 | 275 | 9.5 | 22 | 84 | 0.77 | >60 | 5.7 | 42.1 | 10.1 | 14 |
| HC18 | 13.1 | 38.2 | 86.8 | 29.8 | 34.3 | 12.9 | 229 | 11.8 | 10 | 83 | 0.79 | >60 | 3.9 | 48.0 | 0 | 11 |
| HC19 | 13 | 38.2 | 84.5 | 28.8 | 34.0 | 13.3 | 259 | 12.1 | 4 | 76 | 0.77 | >60 | 3.8 | 41.2 | 3.3 | 17 |
| HC20 | 13.4 | 39.1 | 92.9 | 31.8 | 34.3 | 12.5 | 244 | 12.3 | 2 | 87 | 0.67 | >60 | 5.5 | 47.0 | 0 | 17 |
References
- Gilbert, B.T.P.; Lamacchia, C. Predicting the Onset of Rheumatoid Arthritis. Jt. Bone Spine 2023, 90, 105556. [Google Scholar] [CrossRef]
- Liao, K.P.; Alfredsson, L.; Karlson, E.W. Environmental Influences on Risk for Rheumatoid Arthritis. Curr. Opin. Rheumatol. 2009, 21, 279–283. [Google Scholar] [CrossRef] [PubMed]
- Salliot, C.; Nguyen, Y.; Boutron-Ruault, M.-C.; Seror, R. Environment and Lifestyle: Their Influence on the Risk of RA. J. Clin. Med. 2020, 9, 3109. [Google Scholar] [CrossRef] [PubMed]
- Bo, M.; Jasemi, S.; Uras, G.; Erre, G.L.; Passiu, G.; Sechi, L.A. Role of Infections in the Pathogenesis of Rheumatoid Arthritis: Focus on Mycobacteria. Microorganisms 2020, 8, 1459. [Google Scholar] [CrossRef]
- Soroczyńska-Cybula, M.; Bryl, E.; Smoleńska, Ż.; Witkowski, J.M. Varying Expression of Four Genes Sharing a Common Regulatory Sequence May Differentiate Rheumatoid Arthritis from Ageing Effects on the CD4+ Lymphocytes: Genes Sharing a Regulatory Motif in Helper Cells. Immunology 2011, 132, 78–86. [Google Scholar] [CrossRef] [PubMed]
- Witkowski, J.M.; Soroczyńska-Cybula, M.; Bryl, E.; Smoleńska, Ż.; Jóźwik, A. Klotho—A Common Link in Physiological and Rheumatoid Arthritis-Related Aging of Human CD4+ Lymphocytes. J. Immunol. 2007, 178, 771–777. [Google Scholar] [CrossRef]
- Tong, Y.; Zheng, L.; Qing, P.; Zhao, H.; Li, Y.; Su, L.; Zhang, Q.; Zhao, Y.; Luo, Y.; Liu, Y. Oral Microbiota Perturbations Are Linked to High Risk for Rheumatoid Arthritis. Front. Cell. Infect. Microbiol. 2020, 9, 475. [Google Scholar] [CrossRef]
- Afrasiabi, S.; Chiniforush, N.; Partoazar, A.; Goudarzi, R. The Role of Bacterial Infections in Rheumatoid Arthritis Development and Novel Therapeutic Interventions: Focus on Oral Infections. J. Clin. Lab. Anal. 2023, 37, e24897. [Google Scholar] [CrossRef]
- Ridgley, L.A.; Anderson, A.E.; Pratt, A.G. What Are the Dominant Cytokines in Early Rheumatoid Arthritis? Curr. Opin. Rheumatol. 2018, 30, 207–214. [Google Scholar] [CrossRef]
- Kondo, N.; Kuroda, T.; Kobayashi, D. Cytokine Networks in the Pathogenesis of Rheumatoid Arthritis. Int. J. Mol. Sci. 2021, 22, 10922. [Google Scholar] [CrossRef]
- Available online: https://go.drugbank.com/ (accessed on 1 July 2024).
- Arend, W.P. Physiology of Cytokine Pathways in Rheumatoid Arthritis. Arthritis Care Res. Off. J. Am. Coll. Rheumatol. 2001, 45, 101–106. [Google Scholar] [CrossRef]
- Johnson, D.; Jiang, W. Infectious Diseases, Autoantibodies, and Autoimmunity. J. Autoimmun. 2023, 137, 102962. [Google Scholar] [CrossRef]
- Kudaeva, F.M.; Speechley, M.R.; Pope, J.E. A Systematic Review of Viral Exposures as a Risk for Rheumatoid Arthritis. Semin. Arthritis Rheum. 2019, 48, 587–596. [Google Scholar] [CrossRef]
- Rojas, M.; Restrepo-Jiménez, P.; Monsalve, D.M.; Pacheco, Y.; Acosta-Ampudia, Y.; Ramírez-Santana, C.; Leung, P.S.C.; Ansari, A.A.; Gershwin, M.E.; Anaya, J.-M. Molecular Mimicry and Autoimmunity. J. Autoimmun. 2018, 95, 100–123. [Google Scholar] [CrossRef] [PubMed]
- Kozak, M.; Pawlik, A. The Role of the Oral Microbiome in the Development of Diseases. Int. J. Mol. Sci. 2023, 24, 5231. [Google Scholar] [CrossRef] [PubMed]
- Murugaiyan, V.; Utreja, S.; Hovey, K.M.; Sun, Y.; LaMonte, M.J.; Wactawski-Wende, J.; Diaz, P.I.; Buck, M.J. Defining Porphyromonas Gingivalis Strains Associated with Periodontal Disease. Sci. Rep. 2024, 14, 6222. [Google Scholar] [CrossRef]
- Ahmadi, P.; Mahmoudi, M.; Kheder, R.K.; Faraj, T.A.; Mollazadeh, S.; Abdulabbas, H.S.; Esmaeili, S.-A. Impacts of Porphyromonas Gingivalis Periodontitis on Rheumatoid Arthritis Autoimmunity. Int. Immunopharmacol. 2023, 118, 109936. [Google Scholar] [CrossRef] [PubMed]
- Tar, I.; Csősz, É.; Végh, E.; Lundberg, K.; Kharlamova, N.; Soós, B.; Szekanecz, Z.; Márton, I. Salivary Citrullinated Proteins in Rheumatoid Arthritis and Associated Periodontal Disease. Sci. Rep. 2021, 11, 13525. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Kim, W. Editorial: Can Prevotella copri Be a Causative Pathobiont in Rheumatoid Arthritis? Arthritis Rheumatol. 2016, 68, 2565–2567. [Google Scholar] [CrossRef]
- Amend, L.; Gilbert, B.T.P.; Pelczar, P.; Böttcher, M.; Huber, S.; Witte, T.; Finckh, A.; Strowig, T. Characterization of Serum Biomarkers and Antibody Responses against Prevotella spp. in Preclinical and New-Onset Phase of Rheumatic Diseases. Front. Cell. Infect. Microbiol. 2023, 12, 1096211. [Google Scholar] [CrossRef]
- Miljanovic, D.; Cirkovic, A.; Jermic, I.; Basaric, M.; Lazarevic, I.; Grk, M.; Miskovic, R.; Despotovic, A.; Banko, A. Markers of Epstein–Barr Virus Infection in Association with the Onset and Poor Control of Rheumatoid Arthritis: A Prospective Cohort Study. Microorganisms 2023, 11, 1958. [Google Scholar] [CrossRef]
- Arvikar, S.L.; Collier, D.S.; Fisher, M.C.; Unizony, S.; Cohen, G.L.; McHugh, G.; Kawai, T.; Strle, K.; Steere, A.C. Clinical Correlations with Porphyromonas Gingivalis Antibody Responses in Patients with Early Rheumatoid Arthritis. Arthritis Res. Ther. 2013, 15, R109. [Google Scholar] [CrossRef] [PubMed]
- Brzustewicz, E.; Bzoma, I.; Daca, A.; Szarecka, M.; Bykowska, M.S.; Witkowski, J.M.; Bryl, E. Heterogeneity of the Cytokinome in Undifferentiated Arthritis Progressing to Rheumatoid Arthritis and Its Change in the Course of Therapy. Move toward Personalized Medicine. Cytokine 2017, 97, 1–13. [Google Scholar] [CrossRef]
- Ruscitti, P.; Cipriani, P.; Cantarini, L.; Liakouli, V.; Vitale, A.; Carubbi, F.; Berardicurti, O.; Galeazzi, M.; Valenti, M.; Giacomelli, R. Efficacy of Inhibition of IL-1 in Patients with Rheumatoid Arthritis and Type 2 Diabetes Mellitus: Two Case Reports and Review of the Literature. J. Med. Case Rep. 2015, 9, 123. [Google Scholar] [CrossRef] [PubMed]
- Cutolo, M. Effects of DMARDs on IL-Ra Levels in Rheumatoid Arthritis: Is There Any Evidence ? Clin. Exp. Rheumatol. 2002, 20, S26–S31. [Google Scholar]
- Kay, J. The Role of Interleukin-1 in the Pathogenesis of Rheumatoid Arthritis. Rheumatology 2004, 43, iii2–iii9. [Google Scholar] [CrossRef] [PubMed]
- Brennan, F.M.; McInnes, I.B. Evidence That Cytokines Play a Role in Rheumatoid Arthritis. J. Clin. Investig. 2008, 118, 3537–3545. [Google Scholar] [CrossRef] [PubMed]
- Burger, D.; Dayer, J.-M.; Palmer, G.; Gabay, C. Is IL-1 a Good Therapeutic Target in the Treatment of Arthritis? Best Pract. Res. Clin. Rheumatol. 2006, 20, 879–896. [Google Scholar] [CrossRef] [PubMed]
- Mercado, M.V.-D.; Garcia-Gonzalez, A.; Muñoz-Valle, J.F.; Garcia-Iglesias, T.; Martinez-Bonilla, G.; Bernard-Medina, G.; Sanchez-Ortiz, A.; Ornelas-Aguirre, J.M.; Salazar-Paramo, M.; Gamez-Nava, J.I.; et al. Interleukin 1β (IL-1β), IL-10, Tumor Necrosis Factor-α, and Cellular Proliferation Index in Peripheral Blood Mononuclear Cells in Patients with Ankylosing Spondylitis. J. Rheumatol. 2002, 29, 522–526. [Google Scholar]
- Daheshia, M.; Yao, J.Q. The Interleukin 1β Pathway in the Pathogenesis of Osteoarthritis. J. Rheumatol. 2008, 35, 2306–2312. [Google Scholar] [CrossRef]
- Lee, J.-H.; Kim, B.; Jin, W.J.; Kim, H.-H.; Ha, H.; Lee, Z.H. Pathogenic Roles of CXCL10 Signaling through CXCR3 and TLR4 in Macrophages and T Cells: Relevance for Arthritis. Arthritis Res. Ther. 2017, 19, 163. [Google Scholar] [CrossRef] [PubMed]
- Politti, U. Rheumatoid Arthritis and the Alpha-Chemokine IP-10. Clin. Ter. 2014, 165, e447–e451. [Google Scholar] [CrossRef]
- Lan, R.Y.; Selmi, C.; Gershwin, M.E. The Regulatory, Inflammatory, and T Cell Programming Roles of Interleukin-2 (IL-2). J. Autoimmun. 2008, 31, 7–12. [Google Scholar] [CrossRef]
- Li, B.; Guo, Q.; Wang, Y.; Su, R.; Gao, C.; Zhao, J.; Li, X.; Wang, C. Increased Serum Interleukin-2 Levels Are Associated with Abnormal Peripheral Blood Natural Killer Cell Levels in Patients with Active Rheumatoid Arthritis. Mediat. Inflamm. 2020, 2020, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Kogure, T.; Niizawa, A.; Hai, L.X.; Fujinaga, H.; Shimada, Y.; Ochiai, H.; Terasawa, K. Effect of Interleukin 2 on Killer Cell Inhibitory Receptors in Patients with Rheumatoid Arthritis. Ann. Rheum. Dis. 2001, 60, 166–169. [Google Scholar] [CrossRef]
- Heeb, L.E.M.; Egholm, C.; Boyman, O. Evolution and Function of Interleukin-4 Receptor Signaling in Adaptive Immunity and Neutrophils. Genes Immun. 2020, 21, 143–149. [Google Scholar] [CrossRef]
- Luzina, I.G.; Keegan, A.D.; Heller, N.M.; Rook, G.A.W.; Shea-Donohue, T.; Atamas, S.P. Regulation of Inflammation by Interleukin-4: A Review of “Alternatives”. J. Leukoc. Biol. 2012, 92, 753–764. [Google Scholar] [CrossRef] [PubMed]
- Hussein, Y.M. Influence of Interleukin-4 Gene Polymorphisms and Interleukin-4 Serum Level on Susceptibility and Severity of Rheumatoid Arthritis in Egyptian Population. Cytokine 2013, 61, 849–855. [Google Scholar] [CrossRef] [PubMed]
- Yoshino, S. Effect of a Monoclonal Antibody against Interleukin-4 on Collagen-Induced Arthritis in Mice. Br. J. Pharmacol. 1998, 123, 237–242. [Google Scholar] [CrossRef] [PubMed]
- Rivas, D.; Mozo, L.; Zamorano, J.; Gayo, A.; Torre-Alonsot, J.C.; Rodrlguezt, A.; Guti, C. Upregulated Expression of IL-4 Receptors and Increased Levels of IL-4 in Rheumatoid Arthritis Patients. J. Autoimmun. 1995, 8, 587–600. [Google Scholar] [CrossRef]
- Petersen, L.E.; Baptista, T.S.A.; Molina, J.K.; Motta, J.G.; Do Prado, A.; Piovesan, D.M.; De Nardi, T.; Viola, T.W.; Vieira, É.L.M.; Teixeira, A.L.; et al. Cognitive Impairment in Rheumatoid Arthritis: Role of Lymphocyte Subsets, Cytokines and Neurotrophic Factors. Clin. Rheumatol. 2018, 37, 1171–1181. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Fu, T.; Ji, J.; Li, Z.; Gu, Z. The Role of Interleukin-4 in Rheumatic Diseases. Clin. Exp. Pharmacol. Physiol. 2018, 45, 747–754. [Google Scholar] [CrossRef]
- Sebba, A.; Bingham, C.O.; Bykerk, V.P.; Fiore, S.; Ford, K.; Janak, J.C.; Pappas, D.A.; Blachley, T.; Dave, S.S.; Kremer, J.M.; et al. Comparative Effectiveness of TNF Inhibitor vs IL-6 Receptor Inhibitor as Monotherapy or Combination Therapy with Methotrexate in Biologic-Experienced Patients with Rheumatoid Arthritis: An Analysis from the CorEvitas RA Registry. Clin. Rheumatol. 2023, 42, 2037–2051. [Google Scholar] [CrossRef]
- Szabo, Y.Z.; Slavish, D.C. Measuring Salivary Markers of Inflammation in Health Research: A Review of Methodological Considerations and Best Practices. Psychoneuroendocrinology 2021, 124, 105069. [Google Scholar] [CrossRef] [PubMed]
- Banko, A.; Cirkovic, A.; Jeremic, I.; Basaric, M.; Grk, M.; Miskovic, R.; Lazarevic, I.; Miljanovic, D. Uncovering the Role of Epstein–Barr Virus Infection Markers for Remission in Rheumatoid Arthritis. Biomedicines 2023, 11, 2375. [Google Scholar] [CrossRef] [PubMed]
- Fafi-Kremer, S.; Morand, P.; Brion, J.; Pavese, P.; Baccard, M.; Germi, R.; Genoulaz, O.; Nicod, S.; Jolivet, M.; Ruigrok, R.W.H.; et al. Long-Term Shedding of Infectious Epstein-Barr Virus after Infectious Mononucleosis. J. Infect. Dis. 2005, 191, 985–989. [Google Scholar] [CrossRef]
- Fechtner, S.; Berens, H.; Bemis, E.; Johnson, R.L.; Guthridge, C.J.; Carlson, N.E.; Demoruelle, M.K.; Harley, J.B.; Edison, J.D.; Norris, J.A.; et al. Antibody Responses to Epstein-Barr Virus in the Preclinical Period of Rheumatoid Arthritis Suggest the Presence of Increased Viral Reactivation Cycles. Arthritis Rheumatol. 2022, 74, 597–603. [Google Scholar] [CrossRef]
- Balandraud, N.; Roudier, J. Epstein-Barr Virus and Rheumatoid Arthritis. Jt. Bone Spine 2018, 85, 165–170. [Google Scholar] [CrossRef] [PubMed]
- Velapasamy, S.; Dawson, C.; Young, L.; Paterson, I.; Yap, L. The Dynamic Roles of TGF-β Signalling in EBV-Associated Cancers. Cancers 2018, 10, 247. [Google Scholar] [CrossRef] [PubMed]
- Rahajoe, P.S.; Smit, M.J.; Kertia, N.; Westra, J.; Vissink, A. Cytokines in Gingivocrevicular Fluid of Rheumatoid Arthritis Patients: A Review of the Literature. Oral Dis. 2019, 25, 1423–1434. [Google Scholar] [CrossRef] [PubMed]
- Techatanawat, S.; Surarit, R.; Chairatvit, K.; Khovidhunkit, W.; Roytrakul, S.; Thanakun, S.; Kobayashi, H.; Khovidhunkit, S.P.; Izumi, Y. Salivary and Serum Interleukin-17A and Interleukin-18 Levels in Patients with Type 2 Diabetes Mellitus with and without Periodontitis. PLoS ONE 2020, 15, e0228921. [Google Scholar] [CrossRef]
- Mohammed Fadhil, H.N.; Ahmed, K.M. Evaluation of Salivary Flow Rate, pH and Anti-CCP Antibodies in Relation to Oral Manifestations in Patients with Rheumatoid Arthritis: A Matched Case-Control Study in Sulaimaniyah, Iraq. Saudi Dent. J. 2024, 36, 1606–1610. [Google Scholar] [CrossRef]
- Moen, K.; Bertelsen, L.; Hellem, S.; Jonsson, R.; Brun, J. Salivary Gland and Temporomandibular Joint Involvement in Rheumatoid Arthritis: Relation to Disease Activity. Oral Dis. 2005, 11, 27–34. [Google Scholar] [CrossRef]
- Rinderknecht, C.; Filippi, C.; Ritz, N.; Fritschi, N.; Simmen, U.; Filippi, A.; Diesch-Furlanetto, T. Associations between Salivary Cytokines and Oral Health, Age, and Sex in Healthy Children. Sci. Rep. 2022, 12, 15991. [Google Scholar] [CrossRef] [PubMed]






| Patients | Sex | Age | Diagnosis | DAS-28 | RF (UI/mL) | Anti-CCP (U/mL) | ESR (mm/h) | CRP (mg/dL) |
|---|---|---|---|---|---|---|---|---|
| ORD 1 | female | 42 | other | 1.81 | <10 | 6 | 0 | |
| ORD 2 | female | 41 | psoriatic arthritis | 3.86 | <10 | <7 | 23 | 5.9 |
| ORD 3 | female | 22 | other | 4.56 | <10 | <7 | 26 | 0.4 |
| ORD 4 | female | 32 | psoriatic arthritis | 3.60 | <10 | <7 | 18 | 1.3 |
| ORD 5 | female | 34 | osteoarthritis | 0.64 | 17 | <7 | 2 | 0.3 |
| ORD 6 | female | 38 | other | 2.10 | <10 | <7 | 2 | 0.3 |
| ORD 7 | female | 24 | other | 1.68 | <10 | <7 | 2 | 0 |
| ORD 8 | female | 46 | other | 2.91 | <10 | <7 | 4 | 0 |
| ORD 9 | female | 43 | osteoarthritis | 1.36 | <10 | <7 | 4 | 0.5 |
| ORD 10 | female | 23 | ankylosing spondylitis | 4.17 | 96 | <7 | 3 | 0 |
| ORD 11 | female | 20 | ankylosing spondylitis | 3.38 | 23 | <7 | 2 | 0 |
| ORD 12 | female | 46 | osteoarthritis | 2.04 | <10 | - | 17 | 1.3 |
| ORD 13 | female | 52 | osteoarthritis | 3.53 | <10 | <7 | 15 | 0 |
| ORD 14 | female | 53 | osteoarthritis | 0 | <10 | <7 | 26 | 0.8 |
| ORD 15 | female | 56 | other | 0 | <10 | <7 | 9 | 0.5 |
| ORD 16 | female | 43 | other | 1.95 | <10 | - | - | - |
| ORD 17 | female | 56 | psoriatic arthritis | 4.90 | <10 | <7 | 8 | 2.8 |
| ORD 18 | female | 44 | psoriatic arthritis | 2.02 | <10 | <7 | 7 | 0 |
| ORD 19 | male | 36 | ankylosing spondylitis | 0.90 | <10 | <7 | 2 | 0.7 |
| RA 1 | female | 44 | rheumatoid arthritis | 4.65 | 21 | 268.80 | 8 | 1.3 |
| RA 2 | female | 61 | rheumatoid arthritis | 4.13 | 11 | 24.79 | 25 | 1.8 |
| RA 3 | female | 55 | rheumatoid arthritis | 5.26 | 106 | 481.40 | 18 | 1.5 |
| RA 4 | female | 33 | rheumatoid arthritis | 6.26 | 13 | >500 | 32 | 0.7 |
| RA 5 | female | 39 | rheumatoid arthritis | 2.67 | <10 | <7 | 5 | 0 |
| RA 6 | female | 18 | rheumatoid arthritis | 5.01 | 57 | 17.31 | 18 | 0.7 |
| RA 7 | female | 42 | rheumatoid arthritis | 4.08 | <10 | <7 | 5 | 0.5 |
| RA 8 | female | 47 | rheumatoid arthritis | 4.95 | <10 | <7 | 27 | 4.5 |
| RA 9 | female | 51 | rheumatoid arthritis | 4.07 | <10 | <7 | 13 | 1.3 |
| RA 10 | female | 50 | rheumatoid arthritis | 4.35 | 12 | 72.18 | 10 | 1.4 |
| RA 11 | female | 55 | rheumatoid arthritis | 5.18 | <10 | <7 | 19 | 3.0 |
| RA 12 | female | 42 | rheumatoid arthritis | 5.93 | 28 | 455 | 23 | 7.9 |
| RA 13 | male | 55 | rheumatoid arthritis | 4.98 | <10 | <7 | 32 | 15.5 |
| RA 14 | female | 23 | rheumatoid arthritis | 4.67 | 79 | 17.85 | 44 | 17.6 |
| RA 15 | male | 51 | rheumatoid arthritis | 3.60 | 143 | >500 | 14 | 1 |
| HC 1 | male | 41 | healthy control | - | <10 | <7 | 6 | 0 |
| HC 2 | female | 31 | healthy control | - | <10 | <7 | 5 | 0 |
| HC 3 | female | 32 | healthy control | - | <10 | <7 | 21 | 13.7 |
| HC 4 | female | 43 | healthy control | - | <10 | <7 | 19 | 0 |
| HC 5 | female | 42 | healthy control | - | <10 | <7 | 8 | 6.2 |
| HC 6 | female | 47 | healthy control | - | <10 | <7 | 15 | 1.7 |
| HC 7 | female | 55 | healthy control | - | 11 | <7 | 40 | 2.1 |
| HC 8 | female | 46 | healthy control | - | <10 | <7 | 55 | 3.3 |
| HC 9 | female | 34 | healthy control | - | <10 | <7 | 41 | 2.2 |
| HC 10 | male | 57 | healthy control | - | <10 | <7 | 9 | 0.9 |
| HC 11 | female | 48 | healthy control | - | 304 | <7 | 4 | 0.7 |
| HC 12 | female | 28 | healthy control | - | <10 | <7 | 10 | 0 |
| HC 13 | female | 43 | healthy control | - | <10 | <7 | 9 | 2.7 |
| HC 14 | female | 42 | healthy control | - | <10 | <7 | 9 | 0 |
| HC 15 | male | 44 | healthy control | - | <10 | <7 | 33 | 4.2 |
| HC 16 | female | 35 | healthy control | - | <10 | <7 | 8 | 0 |
| HC 17 | female | 39 | healthy control | - | <10 | <7 | 22 | 10.1 |
| HC 18 | female | 26 | healthy control | - | <10 | <7 | 10 | 0 |
| HC 19 | female | 34 | healthy control | - | <10 | <7 | 4 | 3.3 |
| HC 20 | female | 26 | healthy control | - | <10 | <7 | 2 | 0 |
| Primer Name | Sequence | Number of Nucleotides | Target Gene |
|---|---|---|---|
| Internal control, F | TTCTTAAGTCTGATGTGAAAAGC | 22 | 16S rRNA |
| Internal control, R | TGGACTACCAGGGTATCTAATC | 22 | |
| S. copri genome-specific, F | TTTTGCTGTAGGAGGGGTTG | 20 | Glycosyl transferase, group 1 PREVCOP_06806 |
| S. copri genome-specific, R | GGGCTGCATAAAGCAAAGAC | 20 | |
| P. gingivalis genome-specific, F | TCCACACCCGAAGCAGTAAC | 20 | hmuY gene |
| P. gingivalis genome-specific, R | TGCCACTTTCGCCACAATTG | 20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Korzeniowska, A.; Daca, A.; Szarecka, M.; Bykowska, M.; Witkowski, J.; Bryl, E. Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients. Int. J. Mol. Sci. 2025, 26, 197. https://doi.org/10.3390/ijms26010197
Korzeniowska A, Daca A, Szarecka M, Bykowska M, Witkowski J, Bryl E. Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients. International Journal of Molecular Sciences. 2025; 26(1):197. https://doi.org/10.3390/ijms26010197
Chicago/Turabian StyleKorzeniowska, Aleksandra, Agnieszka Daca, Maria Szarecka, Małgorzata Bykowska, Jacek Witkowski, and Ewa Bryl. 2025. "Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients" International Journal of Molecular Sciences 26, no. 1: 197. https://doi.org/10.3390/ijms26010197
APA StyleKorzeniowska, A., Daca, A., Szarecka, M., Bykowska, M., Witkowski, J., & Bryl, E. (2025). Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients. International Journal of Molecular Sciences, 26(1), 197. https://doi.org/10.3390/ijms26010197

