Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium
Abstract
1. Introduction
2. Results
2.1. Phenotypic Analysis
2.2. Effect of SNP and c-PTIO on Endogenous NO Content
2.3. Analysis of H2O2 and Antioxidant Activity
2.4. Changes in Endogenous Hormones During Dormancy Release
2.5. Influence of Carbohydrate Metabolism
3. Discussion
4. Materials and Methods
4.1. Plant Material and Applied Treatment
4.2. Germination Tests
4.3. Measurement of Enzyme Activities
4.4. Determination of NO and H2O2 Contents
4.5. Phytohormones Measurements
4.6. Carbohydrate Assay
4.7. RNA Extraction and Quantitative Reverse Transcriptase-Polymerase Chain Reaction
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, W.; Yong, Y.; Zhang, Y.; Lyu, Y. Transcriptional Regulatory Network of GA Floral Induction Pathway in LA Hybrid Lily. Int. J. Mol. Sci. 2019, 20, 2694. [Google Scholar] [CrossRef] [PubMed]
- Fang, S.; Lin, M.; Ali, M.M.; Zheng, Y.; Yi, X.; Wang, S.; Chen, F.; Lin, Z. LhANS-rr1, LhDFR, and LhMYB114 Regulate Anthocyanin Biosynthesis in Flower Buds of Lilium ‘Siberia’. Genes 2023, 14, 559. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.-Q.; Li, Q.-H.; Jiang, X.-Q.; Fan, Y.-W.; Gao, J.-P.; Zhang, C.-Q. Dynamic changes in α- and β-amylase activities and gene expression in bulbs of the Oriental hybrid lily ‘Siberia’ during dormancy release. J. Hortic. Sci. Biotechnol. 2015, 90, 753–759. [Google Scholar] [CrossRef]
- Fang, S.; Yang, C.; Ali, M.M.; Lin, M.; Tian, S.; Zhang, L.; Chen, F.; Lin, Z. Transcriptome Analysis Reveals the Molecular Regularity Mechanism Underlying Stem Bulblet Formation in Oriental Lily ‘Siberia’; Functional Characterization of the LoLOB18 Gene. Int. J. Mol. Sci. 2022, 23, 15246. [Google Scholar] [CrossRef]
- Kim, H.T.; Lim, K.-B.; Kim, J.S. New Insights on Lilium Phylogeny Based on a Comparative Phylogenomic Study Using Complete Plastome Sequences. Plants 2019, 8, 547. [Google Scholar] [CrossRef]
- Mojtahedi, N.; Masuda, J.-I.; Hiramatsu, M.; Hai, N.T.L.; Okubo, H. Role of Temperature in Dormancy Induction and Release in One-year-old Seedlings of Lilium longiflorum Populations. J. Jpn. Soc. Hortic. Sci. 2013, 82, 63–68. [Google Scholar] [CrossRef][Green Version]
- Wang, S.; Yi, X.; Zhang, L.; Ali, M.M.; Ke, M.; Lu, Y.; Zheng, Y.; Cai, X.; Fang, S.; Wu, J.; et al. Characterisation and Expression Analysis of LdSERK1, a Somatic Embryogenesis Gene in Lilium davidii var. unicolor. Plants 2024, 13, 1495. [Google Scholar] [CrossRef] [PubMed]
- Ben Mohamed, H.; Vadel, A.M.; Geuns, J.M.; Khemira, H. Biochemical changes in dormant grapevine shoot tissues in response to chilling: Possible role in dormancy release. Sci. Hortic. 2010, 124, 440–447. [Google Scholar] [CrossRef]
- Erez, A. Means to compensate for insufficient chilling to improve bloom and leafing. Acta Hortic. 1995, 395, 81–96. [Google Scholar] [CrossRef]
- Langens-Gerrits, M.M.; Miller, W.B.M.; Croes, A.F.; De Klerk, G.-J. Effect of low temperature on dormancy breaking and growth after planting in lily bulblets regenerated in vitro. Plant Growth Regul. 2003, 40, 267–275. [Google Scholar] [CrossRef]
- Lazare, S.; Bechar, D.; Fernie, A.R.; Brotman, Y.; Zaccai, M. The proof is in the bulb: Glycerol influences key stages of lily development. Plant J. 2018, 97, 321–340. [Google Scholar] [CrossRef]
- Hongmei, S.; Tianlai, L.; Yunfei, L. Physiological Mechanism of Metabolism of Carbohydrate, Phenols, Free Amino Acid and Endogenous Hormones in Middle Scales of Lilium davidii var. unicolor Bulbs Stored at Low Temperature for Dormancy Release. Sci. Agric. Sin. 2005, 38, 376. [Google Scholar]
- Wang, W.; Su, X.; Tian, Z.; Liu, Y.; Zhou, Y.; He, M. Transcriptome profiling provides insights into dormancy release during cold storage of Lilium pumilum. BMC Genom. 2018, 19, 196. [Google Scholar] [CrossRef]
- Zhao, Y.; Liu, C.; Sui, J.; Liang, J.; Ge, J.; Li, J.; Pan, W.; Yi, M.; Du, Y.; Wu, J. A wake-up call: Signaling in regulating ornamental geophytes dormancy. Ornam. Plant Res. 2022, 2, 1–10. [Google Scholar] [CrossRef]
- Shim, D.; Ko, J.-H.; Kim, W.-C.; Wang, Q.; Keathley, D.E.; Han, K.-H. A molecular framework for seasonal growth-dormancy regulation in perennial plants. Hortic. Res. 2014, 1, 14059. [Google Scholar] [CrossRef]
- Langens-Gerrits, M.; Nashimoto, S.; Croes, A.; De Klerk, G. Development of dormancy in different lily genotypes regenerated in vitro. Plant Growth Regul. 2001, 34, 215–222. [Google Scholar] [CrossRef]
- Jásik, J.; de Klerk, G.-J. Effect of Methyl Jasmonate on Morphology and Dormancy Development in Lily Bulblets Regenerated In Vitro. J. Plant Growth Regul. 2006, 25, 45–51. [Google Scholar] [CrossRef]
- Delvallée, I.; Paffen, A.; De Klerk, G. The development of dormancy in bulblets of Lilium speciosum generated in vitro. II. The effect of temperature. Physiol. Plant. 1990, 80, 431–436. [Google Scholar] [CrossRef]
- Mojtahedi, N.; Koobaz, P.; Fathi, M.; Dabirashrafi, O.; Azadi, P.; Khosravi, S. Maturating, Enlarging and Breaking Dormancy of In Vitro Lilium Bulblets. Int. J. Hortic. Sci. Technol. 2014, 1, 101–109. [Google Scholar] [CrossRef]
- Pan, W.; Liang, J.; Sui, J.; Li, J.; Liu, C.; Xin, Y.; Zhang, Y.; Wang, S.; Zhao, Y.; Zhang, J.; et al. ABA and Bud Dormancy in Perennials: Current Knowledge and Future Perspective. Genes 2021, 12, 1635. [Google Scholar] [CrossRef]
- Fan, X.; Zou, X.; Fu, L.; Yang, Y.; Li, M.; Wang, C.; Sun, H. The RING-H2 gene LdXERICO plays a negative role in dormancy release regulated by low temperature in Lilium davidii var. unicolor. Hortic. Res. 2023, 10, uhad030. [Google Scholar] [CrossRef] [PubMed]
- Habu, T.; Yamane, H.; Igarashi, K.; Hamada, K.; Yano, K.; Tao, R. 454-Pyrosequencing of the Transcriptome in Leaf and Flower Buds of Japanese Apricot (Prunus mume Sieb. et Zucc.) at Different Dormant Stages. J. Jpn. Soc. Hortic. Sci. 2012, 81, 239–250. [Google Scholar] [CrossRef][Green Version]
- Ranwala, A.P.; Miller, W.B. Analysis of nonstructural carbohydrates in storage organs of 30 ornamental geophytes by high-performance anion-exchange chromatography with pulsed amperometric detection. New Phytol. 2008, 180, 421–433. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.-S.; Wu, J.-D.; Jiao, X.-H.; Zhang, Q.-X.; Lv, Y.-M. The Dynamics of Changes in Starch and Lipid Droplets and Sub-Cellular Localization of β-Amylase During the Growth of Lily Bulbs. J. Integr. Agric. 2012, 11, 585–592. [Google Scholar] [CrossRef]
- Shin, K.; Chakrabarty, D.; Paek, K. Sprouting rate, change of carbohydrate contents and related enzymes during cold treatment of lily bulblets regenerated in vitro. Sci. Hortic. 2002, 96, 195–204. [Google Scholar] [CrossRef]
- Zhou, Y.; Wang, W.; Yang, L.; Su, X.; He, M. Identification and Expression Analysis of microRNAs in Response to Dormancy Release During Cold Storage of Lilium pumilum Bulbs. J. Plant Growth Regul. 2020, 40, 388–404. [Google Scholar] [CrossRef]
- Su, L.; Lan, Q.; Pritchard, H.W.; Xue, H.; Wang, X. Reactive oxygen species induced by cold stratification promote germination of Hedysarum scoparium seeds. Plant Physiol. Biochem. 2016, 109, 406–415. [Google Scholar] [CrossRef] [PubMed]
- Niu, L.; Li, B.; Liao, W.; Zhu, Y.; Wang, M.; Jin, X.; Xu, Q. Effect of nitric oxide on dormancy release in bulbs of Oriental lily (Lilium orientalis) ‘Siberia’. J. Hortic. Sci. Biotechnol. 2015, 90, 594–598. [Google Scholar] [CrossRef]
- Pan, W.; Li, J.; Du, Y.; Zhao, Y.; Xin, Y.; Wang, S.; Liu, C.; Lin, Z.; Fang, S.; Yang, Y.; et al. Epigenetic silencing of callose synthase by VIL1 promotes bud-growth transition in lily bulbs. Nat. Plants 2023, 9, 1451–1467. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Pan, W.; Xin, Y.; Wu, J.; Li, R.; Shi, J.; Long, S.; Qu, L.; Yang, Y.; Yi, M.; et al. Regulating bulb dormancy release and flowering in lily through chemical modulation of intercellular communication. Plant Methods 2023, 19, 136. [Google Scholar] [CrossRef] [PubMed]
- Reed, R.C.; Bradford, K.J.; Khanday, I. Seed germination and vigor: Ensuring crop sustainability in a changing climate. Heredity 2022, 128, 450–459. [Google Scholar] [CrossRef]
- Weitbrecht, K.; Müller, K.; Leubner-Metzger, G. First off the mark: Early seed germination. J. Exp. Bot. 2011, 62, 3289–3309. [Google Scholar] [CrossRef]
- Shu, K.; Liu, X.-D.; Xie, Q.; He, Z.-H. Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination. Mol. Plant 2015, 9, 34–45. [Google Scholar] [CrossRef] [PubMed]
- Astier, J.; Gross, I.; Durner, J. Nitric oxide production in plants: An update. J. Exp. Bot. 2017, 69, 3401–3411. [Google Scholar] [CrossRef]
- León, J.; Costa-Broseta, Á. Present knowledge and controversies, deficiencies, and misconceptions on nitric oxide synthesis, sensing, and signaling in plants. Plant Cell Environ. 2019, 43, 1–15. [Google Scholar] [CrossRef]
- Yu, M.; Lamattina, L.; Spoel, S.H.; Loake, G.J. Nitric oxide function in plant biology: A redox cue in deconvolution. New Phytol. 2014, 202, 1142–1156. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Ma, R.; Zhao, M.; Wang, F.; Zhang, N.; Si, H. NO and ABA Interaction Regulates Tuber Dormancy and Sprouting in Potato. Front. Plant Sci. 2020, 11, 311. [Google Scholar] [CrossRef] [PubMed]
- Krasuska, U.; Ciacka, K.; Orzechowski, S.; Fettke, J.; Bogatek, R.; Gniazdowska, A. Modification of the endogenous NO level influences apple embryos dormancy by alterations of nitrated and biotinylated protein patterns. Planta 2016, 244, 877–891. [Google Scholar] [CrossRef]
- Rather, B.A.; Mir, I.R.; Masood, A.; Anjum, N.A.; Khan, N.A. Nitric Oxide Pre-Treatment Advances Seed Germination and Alleviates Copper-Induced Photosynthetic Inhibition in Indian Mustard. Plants 2020, 9, 776. [Google Scholar] [CrossRef]
- Bethke, P.C.; Libourel, I.G.; Jones, R.L. Nitric oxide reduces seed dormancy in Arabidopsis. J. Exp. Bot. 2005, 57, 517–526. [Google Scholar] [CrossRef]
- Liu, H.-Y.; Yu, X.; Cui, D.-Y.; Sun, M.-H.; Sun, W.-N.; Tang, Z.-C.; Kwak, S.-S.; Su, W.-A. The role of water channel proteins and nitric oxide signaling in rice seed germination. Cell Res. 2007, 17, 638–649. [Google Scholar] [CrossRef]
- Lozano-Juste, J.; León, J. Nitric Oxide Regulates DELLA Content and PIF Expression to Promote Photomorphogenesis in Arabidopsis. Plant Physiol. 2011, 156, 1410–1423. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Tang, S.; Wang, J.; Shen, H.; Yang, L. Interaction between reactive oxygen species and hormones during the breaking of embryo dormancy in Sorbus pohuashanensis by exogenous nitric oxide. J. For. Res. 2021, 33, 435–444. [Google Scholar] [CrossRef]
- El-Maarouf-Bouteau, H.; Sajjad, Y.; Bazin, J.; Langlade, N.; Cristescu, S.M.; Balzergue, S.; Baudouin, E.; Bailly, C. Reactive oxygen species, abscisic acid and ethylene interact to regulate sunflower seed germination. Plant Cell Environ. 2014, 38, 364–374. [Google Scholar] [CrossRef]
- Gniazdowska, A.; Krasuska, U.; Czajkowska, K.; Bogatek, R. Nitric oxide, hydrogen cyanide and ethylene are required in the control of germination and undisturbed development of young apple seedlings. Plant Growth Regul. 2010, 61, 75–84. [Google Scholar] [CrossRef]
- Bailly, C.; El-Maarouf-Bouteau, H.; Corbineau, F. From intracellular signaling networks to cell death: The dual role of reactive oxygen species in seed physiology. Comptes Rendus Biol. 2008, 331, 806–814. [Google Scholar] [CrossRef]
- Oracz, K.; El-Maarouf-Bouteau, H.; Kranner, I.; Bogatek, R.; Corbineau, F.; Bailly, C. The Mechanisms Involved in Seed Dormancy Alleviation by Hydrogen Cyanide Unravel the Role of Reactive Oxygen Species as Key Factors of Cellular Signaling during Germination. Plant Physiol. 2009, 150, 494–505. [Google Scholar] [CrossRef]
- Beligni, M.V.; Lamattina, L. Nitric oxide stimulates seed germination and de-etiolation, and inhibits hypocotyl elongation, three light-inducible responses in plants. Planta 2000, 210, 215–221. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, R.; Wang, X.; Zhao, C.; Shen, H.; Yang, L. Nitric Oxide Regulates Seed Germination by Integrating Multiple Signalling Pathways. Int. J. Mol. Sci. 2023, 24, 9052. [Google Scholar] [CrossRef] [PubMed]
- Ma, Z.; Marsolais, F.; Bykova, N.V.; Igamberdiev, A.U. Nitric Oxide and Reactive Oxygen Species Mediate Metabolic Changes in Barley Seed Embryo during Germination. Front. Plant Sci. 2016, 7, 138. [Google Scholar] [CrossRef] [PubMed]
- Caro, A.; Puntarulo, S. Nitric Oxide Generation by Soybean Embryonic Axes. Possible Effect on Mitochondrial Function. Free Radic. Res. 1999, 31, 205–212. [Google Scholar] [CrossRef]
- Leymarie, J.; Vitkauskaité, G.; Hoang, H.H.; Gendreau, E.; Chazoule, V.; Meimoun, P.; Corbineau, F.; El-Maarouf-Bouteau, H.; Bailly, C. Role of Reactive Oxygen Species in the Regulation of Arabidopsis Seed Dormancy. Plant Cell Physiol. 2011, 53, 96–106. [Google Scholar] [CrossRef]
- Van Camp, W.; Van Montagu, M.; Inzé, D. H2O2 and NO: Redox signals in disease resistance. Trends Plant Sci. 1998, 3, 330–334. [Google Scholar] [CrossRef]
- Clark, D.; Durner, J.; Navarre, D.A.; Klessig, D.F. Nitric Oxide Inhibition of Tobacco Catalase and Ascorbate Peroxidase. Mol. Plant-Microbe Interact. 2000, 13, 1380–1384. [Google Scholar] [CrossRef]
- Freschi, L. Nitric oxide and phytohormone interactions: Current status and perspectives. Front. Plant Sci. 2013, 4, 398. [Google Scholar] [CrossRef]
- Zhao, M.-G.; Chen, L.; Zhang, L.-L.; Zhang, W.-H. Nitric Reductase-Dependent Nitric Oxide Production Is Involved in Cold Acclimation and Freezing Tolerance in Arabidopsis. Plant Physiol. 2009, 151, 755–767. [Google Scholar] [CrossRef]
- Sarath, G.; Hou, G.; Baird, L.M.; Mitchell, R.B. Reactive oxygen species, ABA and nitric oxide interactions on the germination of warm-season C4-grasses. Planta 2007, 226, 697–708. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Yang, Y.; Li, M.; Fu, L.; Zang, Y.; Wang, C.; Hao, T.; Sun, H. Transcriptomics and targeted metabolomics reveal the regulatory network of Lilium davidii var. unicolor during bulb dormancy release. Planta 2021, 254, 59. [Google Scholar] [CrossRef]
- Gu, J.; Zeng, Z.; Wang, Y.; Lyu, Y. Transcriptome Analysis of Carbohydrate Metabolism Genes and Molecular Regulation of Sucrose Transport Gene LoSUT on the Flowering Process of Developing Oriental Hybrid Lily ‘Sorbonne’ Bulb. Int. J. Mol. Sci. 2020, 21, 3092. [Google Scholar] [CrossRef]
- Lazare, S.; Burgos, A.; Brotman, Y.; Zaccai, M. The metabolic (under)groundwork of the lily bulb toward sprouting. Physiol. Plant 2017, 163, 436–449. [Google Scholar] [CrossRef]
- Lu, S.; Zhuo, C.; Wang, X.; Guo, Z. Nitrate reductase (NR)-dependent NO production mediates ABA- and H2O2-induced antioxidant enzymes. Plant Physiol. Biochem. 2014, 74, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Diao, Q.; Song, Y.; Shi, D.; Qi, H. Interaction of Polyamines, Abscisic Acid, Nitric Oxide, and Hydrogen Peroxide under Chilling Stress in Tomato (Lycopersicon esculentum Mill.) Seedlings. Front. Plant Sci. 2017, 8, 203. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Lv, S.; Xu, H.; Hou, D.; Li, Y.; Wang, F. H2O2 Is Involved in the Metallothionein-Mediated Rice Tolerance to Copper and Cadmium Toxicity. Int. J. Mol. Sci. 2017, 18, 2083. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Wang, C.; Liao, W. Hydrogen Sulfide Improves the Vase Life and Quality of Cut Roses and Chrysanthemums. J. Plant Growth Regul. 2021, 40, 2532–2547. [Google Scholar] [CrossRef]
- Zhang, Y.; Yong, Y.B.; Wang, Q.; Lu, Y.M. Physiological and Molecular Changes during Lily Underground Stem Axillary Bulbils Formation. Russ. J. Plant Physiol. 2018, 65, 372–383. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]






| Gene Name | Protein Description | Primer Sequence | Length (bp) |
|---|---|---|---|
| LoNOS-IP | Nitric oxide synthase-interacting protein | F: CCCTCAACCCTTTCACAG R: CACTTTGTCCTTGTCCTTAC | 101 |
| LoNR | Nitrate reductase | F: TGTTCGTCTCGCAGTAAG R: TGTTCGTCTCGCAGTAAG | 100 |
| LoARR | Two-component response regulator ARR-A family | F: ATATGCTGATGCTGCTCTC R: CTCAACTCGGAATGGTGAT | 145 |
| LoCYP707A1 | Cytochrome P450, family 707, subfamily A, polypeptide 1 | F: GAAGAAGCAGAAGAAGTATGG R: GCACCTGAGACAAGAACA | 108 |
| LoDELLA | DELLA protein | F: GAAGCACTCCACTACTACTC R: CCTCGCATCCAATAACATTC | 142 |
| LoGA20x | Gibberellin 20 oxidase | F: TGGTTATCACGGTGTAGGA R: GGAAGCGAAGTTGGAGTT | 139 |
| LoGH3.1 | Auxin-responsive GH3 family protein | F: ACACTGCTGCCGAATATG R: CACCTCTACCTCCACCAA | 150 |
| LoNCED1 | 9-cis-epoxycarotenoid dioxygenase | F: TTCGTTCATCGGAGATTGT R: CGGATTGTGTTAGGTTAGTG | 118 |
| LoVIL1 | Vernalization insensitive like1 | F: TCATCCTCAACCTCCTCTTA R: CAAGTTCAGGCAGTATTCG | 130 |
| LoXERICO | RING/U-box superfamily protein | F: GACAAGCGAGGTAGTGAG R: TTAGTTGAGAGCCGATCTG | 112 |
| LoAMY | Alpha-amylase | F: ATGGAATGGAAGTTCTCTGA R: CTGAAGTGTGGACTGGTT | 122 |
| LoBMY | Beta-amylase | F: ACGGTAAGCAGGTGATTG R: GATGACGCCAAGAGGAAG | 101 |
| LoSPS | Sucrose phosphate synthase | F: GGAGGACATCAATGCTACA R: CCACTGCTCTTCAATCTCT | 115 |
| LoSUS | Sucrose synthase | F: CAAGAAGGTCAAGGAGCAGATG R: CCGCACTAAGGAAAGCAGAG | 159 |
| LoSUT | Sucrose transport protein | F: TTATGGCTCTCTGCTTTGTA R: TGTGCGAGTAGAAATCATTG | 182 |
| LoTMT | Tonoplast Monosaccharide Transporter | F: TTGGCTCTGGATCGCTATCG R: CTCGCTCTCACTGTCACTCTC | 94 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.; Xu, X.; Ali, M.M.; He, X.; Guo, W.; Chen, F.; Fang, S. Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium. Int. J. Mol. Sci. 2025, 26, 156. https://doi.org/10.3390/ijms26010156
Yang C, Xu X, Ali MM, He X, Guo W, Chen F, Fang S. Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium. International Journal of Molecular Sciences. 2025; 26(1):156. https://doi.org/10.3390/ijms26010156
Chicago/Turabian StyleYang, Chenglong, Xiaoping Xu, Muhammad Moaaz Ali, Xing He, Wenjie Guo, Faxing Chen, and Shaozhong Fang. 2025. "Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium" International Journal of Molecular Sciences 26, no. 1: 156. https://doi.org/10.3390/ijms26010156
APA StyleYang, C., Xu, X., Ali, M. M., He, X., Guo, W., Chen, F., & Fang, S. (2025). Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium. International Journal of Molecular Sciences, 26(1), 156. https://doi.org/10.3390/ijms26010156

