Next Article in Journal
Recent Advances in the Search for Effective Anti-Alzheimer’s Drugs
Next Article in Special Issue
Enhancing Soybean Salt Tolerance with GSNO and Silicon: A Comprehensive Physiological, Biochemical, and Genetic Study
Previous Article in Journal
Optimised Workflows for Profiling the Metabolic Fluxes in Suspension vs. Adherent Cancer Cells via Seahorse Technology
Previous Article in Special Issue
The Response of Hormones, Reactive Oxygen Species and Nitric Oxide in the Polyethylene-Glycol-Promoted, Salt–Alkali-Stress-Induced Embryo Germination of Sorbus pohuashanensis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium

1
Institute of Biotechnology, Fujian Academy of Agricultural Sciences, Fuzhou 350003, China
2
The School of Tropical Agriculture and Forestry, Hainan University, Danzhou 571700, China
3
College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 156; https://doi.org/10.3390/ijms26010156
Submission received: 25 November 2024 / Revised: 23 December 2024 / Accepted: 25 December 2024 / Published: 27 December 2024
(This article belongs to the Special Issue Nitric Oxide Signalling in Plants)

Abstract

The lily is a globally popular cut flower, and managing dormancy in lily bulblets is essential for continuous, year-round production. While nitric oxide (NO) has been shown to influence seed dormancy and germination, its role in dormancy release in lilies was previously unconfirmed. In this study, we investigated the effects of NO on dormancy release in lily bulblets using SNP and c-PTIO. Results showed that SNP treatment promoted dormancy release, while c-PTIO inhibited it. Measurement of endogenous NO levels in the bulbs, along with enzyme activities of NOS-like and NR and gene expression levels of LoNOS-IP and LoNR, confirmed that NO plays a role in promoting dormancy release in lilies. To further elucidate the physiological mechanisms involved, we analyzed H2O2 levels, antioxidant enzyme activities, endogenous hormone levels, and carbohydrate metabolism in the bulbs. Findings demonstrated that NO facilitated dormancy release by increasing H2O2, gibberellins (GAs), indole-3-acetic acid (IAA), zeatin riboside (ZR), reducing sugars, and by accelerating the metabolism of abscisic acid (ABA) and starch. This study provides a foundation for deeper investigation into the mechanisms underlying dormancy release in lily bulbs.

1. Introduction

Lilies (Lilium spp.) are widely cherished geophytes in the field of horticulture, serving as popular choices for cut flowers, potted plants, and garden adornments [1,2]. Dormancy, a crucial adaptive mechanism, plays a key role in the survival of lilies in adverse conditions [3,4]. Belonging to the family Liliaceae, the genus Lilium consists of over 100 species distributed across cold and temperate regions of the northern hemisphere [5]. Various populations and varieties exhibit distinct dormancy traits as they adapt to their respective habitats [6,7]. In their natural cycle, lilies sprout in spring and blossom in summer. Failure to meet the chilling requirements of lilies, particularly in regions with mild winters, can result in erratic budbreak and asynchronous growth, ultimately leading to reduced vegetative development and sporadic flowering [8,9].
Cold storage treatment is widely recognized as the most effective method for inducing dormancy release [10]. Consequently, the year-round demand for flowers has prompted farmers to manipulate flowering times by subjecting lily bulbs to cold storage post-harvest, effectively mimicking winter conditions [11]. However, the increased commercial costs associated with low-temperature treatment pose a barrier to commercial production, and the extensive use of cold storage facilities is anticipated to contribute to the issue of global warming. As a result, alternative methods for low-temperature treatment have emerged as a significant area of focus in lily research.
Dormancy is a complex physiological process, involving various morphological, physiological, biochemical, and transcriptional events [12,13]. Phytohormones play a crucial role in regulating dormancy release [14,15]. The antagonistic relationship between abscisic acid (ABA) and gibberellin (GA) is considered a key factor in dormancy. Cold treatment over a long period contributes to reducing ABA levels in dormant organs and increasing GA content, aiding in dormancy release. Numerous studies have demonstrated the significant positive impact of GA3 treatment on breaking dormancy in Lilium cultivars [1,16,17,18,19]. ABA is recognized as a vital phytohormone in dormancy regulation, particularly as a central hub in seed dormancy [20]. It is known to be involved in dormancy regulation by interpreting temperature signals, and external ABA treatment can enhance bulb dormancy and suppress bulb germination in lilies [21].
Energy metabolism also plays a role in dormancy regulation [22]. Lily bulbs primarily contain starch and glucomannan, which are broken down into monosaccharides after exposure to cold, providing fuel for the sprouting process [23]. The activities of enzymes like α- and β-amylase are linked to dormancy release, with low-temperature storage resulting in increased activities of various starch-degrading enzymes [24,25].
Reactive oxygen species (ROS), particularly hydrogen peroxide (H2O2), play a central role in the signal transduction pathways that enable plants to adapt to environmental changes. In conditions of oxidative eustress, a physiological steady-state of H2O2 is maintained at low, nanomolar levels. Optimal levels of ROS have been found to facilitate bulblet dormancy release. Conversely, elevated ROS levels in bulbs can trigger an increase in antioxidant enzyme activity, safeguarding cells from oxidative damage caused by oxygen radicals. Thus, appropriate ROS concentrations are crucial for promoting plant dormancy release [26,27]. During long-term cold treatment, key antioxidants like superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) exhibited varying activity changes, impacting the levels of H2O2 and ultimately accelerating dormancy release [28]. A recent study revealed that the LoNFYA7–LoVIL1 module plays a crucial role in orchestrating the transition from slow to fast growth in lily bulbs, suggesting that LoVIL1 can serve as a reliable marker for the bud-growth-transition trait post-dormancy release in lily cultivars [29]. Additionally, chemical treatments like 2,3-Butanedione oxime (BDM), N-Ethyl maleimide (NEM), and 2-Deoxy-D-glucose (DDG) have shown promise in regulating bulblet dormancy [30]. These findings highlight the strong correlations between physiological metabolism and dormancy release in lily bulbs during cold treatment.
Nitric oxide (NO) is known to play a crucial role in dormancy release and the seed germination process [31,32]. NO acts as a key gaseous molecule in promoting seed germination by regulating ABA metabolism and the GA synthesis pathway [33]. There are two pathways for NO synthesis in plants: one through a nitrate/nitrite-dependent pathway, and the other through an NO synthase (NOS)-mediated oxidation pathway [34]. Nitrate reductase (NR) is a multifunctional cytoplasmic enzyme that plays a critical role in nitrogen assimilation and metabolism. It catalyzes the rate-limiting step of nitrate assimilation by reducing nitrate to nitrite, using NADH as an electron donor. The production of NO by NR in plant physiology has been extensively demonstrated through both pharmacological and genetic approaches. In contrast, in animal systems, the majority of NO production is mediated by NOS, which catalyzes the oxygen- and NADPH-dependent oxidation of L-arginine to NO and citrulline [35,36].
Sodium nitroprusside (SNP) is an NO donor widely used to demonstrate the positive regulation of NO during dormancy release. Conversely, 2-(4-carboxphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (c-PTIO) is used as an NO scavenger to inhibit dormancy release. In potato, a 40 uM SNP treatment promoted tuber sprouting, while c-PTIO repressed the influence of NO on tuber sprouting [37]. A 3 mM SNP treatment promoted Apple (Malus domestica Borkh.) embryo germination, whereas a 0.3 mM c-PTIO treatment significantly inhibited germination [38]. Exogenous SNP treatment also promoted seed germination in Indian mustard (Brassica juncea L.), Arabidopsis, and Oryza sativa [39,40,41]. Recent studies have shown that exogenous NO promotes dormancy release by interacting with phytohormone signaling pathways, such as GA catabolism, ABA catabolism, and affecting the accumulation of ROS and the synthesis of enzymes related to the antioxidant system [42,43,44]. While there have been extensive studies on the effects of NO on the physiological progress of dormancy release, the mechanisms of dormancy release in different plants vary. Whether NO regulates dormancy release in lily remains an open question.
Here, in this study, the lily bulblets responded to SNP treatment with accelerated dormancy release and earlier sprouting through the modulation of enzyme activities, NO and H2O2 levels, and changes in carbohydrate metabolism and phytohormone content. These physiological shifts were accompanied by altered expression of specific genes related to dormancy and growth regulation. Conversely, treatment with c-PTIO, an NO scavenger, inhibited these responses, reinforcing the role of nitric oxide in regulating dormancy release and promoting sprouting in lily bulblets. These findings indicate that NO treatment has the potential to partially substitute for low-temperature storage, offering practical applications in the cut-flower industry by reducing cold storage electricity usage, lowering enterprise costs, and minimizing greenhouse gas emissions.

2. Results

2.1. Phenotypic Analysis

SNP and c-PTIO are commonly used to assess the functional effects of NO on plant physiology. To determine if NO is involved in bulb dormancy release, harvested lily bulbs were treated with varying concentrations of SNP and c-PTIO. In prior studies, bud length of lily bulbs has been a standard indicator of dormancy release timing, where longer buds signify an earlier dormancy release [21,45]. As shown in Figure 1, SNP treatments at 5 mM, 10 mM, and 20 mM promoted bulb dormancy release. Compared to the control (CK), SNP-treated bulbs showed significant increases in bud length, with the 20 mM treatment group exhibiting the longest buds and the 5 mM group the shortest. Conversely, treatment with 1 mM c-PTIO significantly inhibited dormancy release. When applied alongside SNP, c-PTIO’s inhibitory effect was notably reduced. These findings suggest that SNP treatment facilitates bulb dormancy release, while c-PTIO suppresses it.

2.2. Effect of SNP and c-PTIO on Endogenous NO Content

To explore whether SNP and c-PTIO influence bulb dormancy release by modulating endogenous NO content, we measured NO content, enzyme activities, and the expression levels of related genes in samples under different treatments. Figure 2 illustrates a distinct trend in NO content for SNP-treated samples, showing an initial increase followed by a decline. NO content significantly rose within 4 h of SNP treatment, peaking at 8 h. In contrast, c-PTIO treatment significantly reduced the NO increase. Additionally, co-treatment with SNP and c-PTIO partially offset the rise in NO levels. SNP treatment also led to a marked increase in the activities of NOS-like enzymes and Nitrate Reductase (NR), whereas c-PTIO notably suppressed these activities. qRT-PCR analysis showed that expression levels of LoNOS-IP and LoNR genes were significantly upregulated after 4 h of SNP treatment compared to the control group. These results indicate that SNP and c-PTIO regulate dormancy release by influencing endogenous NO content.

2.3. Analysis of H2O2 and Antioxidant Activity

The interaction between NO and ROS formation is crucial during dormancy release. Studies have linked dormancy alleviation with increased H2O2 accumulation [46,47]. Throughout lily dormancy release, H2O2 levels in the SNP treatment group consistently exceeded those in other groups, indicating that SNP treatment elevates H2O2 in dormant buds. Conversely, c-PTIO, acting as an NO scavenger, reduced H2O2 levels. Figure 3 shows that the peak H2O2 content in dormant buds following SNP treatment occurred 10 days earlier than in other groups, correlating with the earlier dormancy release shown in Figure 1. These findings suggest that SNP’s dormancy release effect is linked to changes in H2O2 content within dormant buds.
Superoxide dismutase (SOD), a primary enzyme for scavenging superoxide anions (O2⁻), catalyzes their dismutation into H2O2. The pattern of SOD activity during dormancy release in Figure 3C aligns with H2O2 variations. During early dormancy, SNP significantly increased peroxidase (POD) activity in dormant buds, while c-PTIO reduced it relative to the control group. Figure 3D illustrates that while POD scavenges H2O2, H2O2 levels continued to rise, suggesting that POD is not the primary enzyme regulating H2O2 content. After SNP treatment, the sharp decline in H2O2 content coincided with reduced POD activity, implying that changes in POD activity are driven by H2O2 variations.
In early dormancy stages, SNP treatment also enhanced catalase (CAT) activity, while c-PTIO suppressed it (Figure 3A). However, by late dormancy, neither treatment significantly affected CAT activity, suggesting that NO facilitates H2O2 accumulation through mechanisms other than CAT inhibition. This suggests that NO may enhance H2O2 accumulation through alternative pathways.

2.4. Changes in Endogenous Hormones During Dormancy Release

In the early stages of dormancy, SNP treatment significantly reduced endogenous ABA content in the bulbs, with levels progressively decreasing throughout the dormancy period and reaching a minimum at 40 days post-treatment. While both the control and c-PTIO-treated groups exhibited a similar trend in ABA reduction, their lowest levels occurred later than those in the SNP group. As shown in Figure 4, SNP treatment markedly upregulated LoCYP707A1 expression while downregulating LoNCED1 expression. Conversely, SNP treatment significantly elevated endogenous GA content in early dormancy stages, with a rapid increase between 30 and 40 days, earlier than in other treatment groups. This was accompanied by increased LoGA20ox expression and suppressed LoDELLA gene expression.
In the case of endogenous IAA, SNP treatment initially reduced its content in early dormancy, but IAA levels rapidly rose after 20 days, surpassing other groups by day 40. The expression pattern of the auxin-related gene LoGH3.1 aligned with the changes in IAA levels. Endogenous ZR levels across treatments followed a similar trend to endogenous GA, but there were no significant differences in ZR content among groups during early dormancy.

2.5. Influence of Carbohydrate Metabolism

During dormancy release, the starch content in lily buds gradually declined across all treatment groups, while reducing sugar content steadily increased. SNP treatment promoted an earlier increase in reducing sugars and accelerated the decrease in starch content, with the highest level of reducing sugars reached 40 days post-treatment—10 days earlier than in the control group. Concurrently, starch content in the SNP group hit its lowest point. These findings suggest that NO facilitates earlier dormancy release by accelerating starch breakdown and enhancing reducing sugar accumulation.
Throughout the experiment, the expression of genes LoAMY, LoBMY, LoSPS, LoTMT, and LoSUS generally increased in early dormancy, peaking before declining in later stages. Peak expression in the SNP-treated group occurred 10 days earlier than in the control, while in the c-PTIO group, the peak was delayed by 10 days. For the LoSUT gene, expression decreased initially in early dormancy and increased in later stages. The lowest expression value for LoSUT in the SNP-treated group appeared 10 days earlier than in the control, whereas in the c-PTIO group, it was delayed by 10 days (Figure 5).

3. Discussion

Nitric oxide (NO) has been shown to effectively promote dormancy release or germination in various plant species [48,49,50]. Previous studies suggest that the improvement in germination of dormant seeds through exogenous treatments, such as nitrogen compounds like nitrates and nitrites, is likely facilitated by NO production [51]. The role of NO in plant physiology has mainly been demonstrated through pharmacological experiments using NO donors and/or NO scavengers. Due to NO’s toxicity, reactivity, and gaseous nature, its direct application in the lab is challenging. Therefore, compounds like sodium nitroprusside (SNP) are commonly used to generate NO. However, the photolysis of SNP can release more cyanide than NO, indicating that cyanide might be the active compound when SNP is applied to seeds.
In the present study, to account for the potential side effects of SNP, we also employed c-PTIO in our experiments. The contrasting effects of NO donors and NO scavengers in a specific physiological process often provide strong evidence for NO’s involvement. SNP treatment promoted dormancy release by increasing radicle length in seed bulbs, whereas c-PTIO inhibited this effect, with no significant difference observed in the SNP + c-PTIO treatment group (Figure 1). However, dormancy release in bulbous plants differs from seed dormancy release and germination. To further explore the relationship between NO and dormancy release in lilies, we measured the endogenous NO content in the treated bulbs. SNP treatment significantly increased endogenous NO content, while c-PTIO had the opposite effect (Figure 2). These results provide compelling evidence for the regulatory role of NO in dormancy release.
It is widely acknowledged that ROS have emerged as pivotal regulators in the dormancy and germination of seeds. Depending on their concentrations, ROS can serve as positive signaling agents, including the promotion of dormancy release and germination, or they may lead to detrimental outcomes [52]. Under cold stress, plant cells rapidly produce certain reactive oxygen molecules, such as superoxide O2 and H2O2. NO can react with O2 to form the highly destructive peroxynitrite anion (ONOO) [53]. Furthermore, NO can modulate the levels of H2O2 by affecting the activity of antioxidant enzymes. In this study, treatment with SNP enhanced the activities of SOD and POD, and promoted the endogenous content of H2O2 [54]. This result suggests that the key role of NO in dormancy release may be attributed to its crosstalk with reactive oxygen species.
It is well known that the phytohormone ABA often plays a key role in the induction of seed dormancy [55]. It has been reported that the interaction of NO and ABA in the regulation of seed germination has been demonstrated in plants such as Arabidopsis, switchgrass and warm-season C4 grasses [56,57]. NO acts upstream of ABA and GA biosynthesis, enhancing GA production while inhibiting ABA biosynthesis to promote seed germination. Recent studies have shown that in potato tubers, NO generated by NOS or NR triggers the expression of the ABA catabolic gene StCYP707A1 and suppresses the ABA biosynthesis-related gene StNCED1, leading to decreased ABA levels and a shift in the ABA-GA balance that induces tuber sprouting [37]. Our study similarly found that NO upregulated the ABA catabolic gene LoCYP707A1 (Figure 4F) and downregulated the ABA biosynthesis gene LoNCED1 (Figure 4J), resulting in reduced endogenous ABA levels (Figure 4A).
Additionally, NO increased the expression of the GA biosynthesis gene LoGA20ox (Figure 4H) and decreased the expression of the GA signaling repressor gene LoDELLA (Figure 4I), leading to higher endogenous GA levels (Figure 4B), thus accelerating the dormancy release. Typically, auxins and cytokinin play a crucial role in the dormancy process of lily bulblets [58]. It is evident from this study that we observed a rapid increase in the endogenous levels of IAA (Figure 4C) and ZR (Figure 4D) promoted by NO, thereby accelerating the release from dormancy. The expression of the gene LoVIL, a marker for lily dormancy, is commonly used to assess the bulblet dormancy process [29]. The promotion of LoVIL expression by NO (Figure 4K) is consistent with the observed phenotype. However, the interaction between NO and plant hormones during the release from dormancy in lily bulblets is highly complex, and the underlying mechanisms warrant further investigation.
Changes in carbohydrate metabolism have been reported to be associated with dormancy release during the cold storage of lily bulbs. Bulbs exposed to low temperatures induced a net breakdown of starch and the accumulation of soluble sugars in the bulb scales [3]. In the present study, the starch content in the bulblets gradually decreased during low-temperature storage (Figure 5A), while the content of reducing sugars gradually increased (Figure 5B). Interestingly, treatment with NO accelerated the degradation of starch and the increase in reducing sugars. Furthermore, the expression levels of the LoAMY and LoBMY genes significantly increased after NO treatment (Figure 5C,D). The LoSUT gene, responsible for the long-distance transport of major carbohydrates, has been shown to regulate the dormancy and vernalization processes in lilies [59]. The LoTMT gene, acting upstream of LoSUT and involved in the loading and unloading of sugars in the phloem, was also observed to have its expression promoted by NO in this study, with LoTMT exhibiting an expression pattern that precedes LoSUT by one cycle. These results suggest that NO treatment can regulate carbohydrate metabolism in lily bulblets, thereby accelerating the process of dormancy release (Figure 6). However, how sugars participate in the perception process and signal transduction remains largely unknown, and the specific regulatory mechanisms of NO on carbohydrate metabolism warrant further investigation in subsequent studies.

4. Materials and Methods

4.1. Plant Material and Applied Treatment

The oriental hybrid lily cultivar ‘Siberia’ was used as the plant material in this study. Lily bulblets were harvested from a greenhouse at the Institute of Biotechnology, Fujian Academy of Science, Fuzhou, China. Only bulblets that were externally undamaged, uniform in size, and with a circumference of 10–12 cm were selected. These bulblets were disinfected by soaking in a 500-fold dilution of 50% thiophanate-methyl wettable powder for 30 min, then placed in a shaded area to air-dry for experimental use.
The pretreatment experiment with SNP and c-PTIO followed the method described by Gniazdowska et al. [45]. The appropriate concentrations of SNP and c-PTIO were selected based on a preliminary experiment, with the details provided in Table S1. Bulblets were placed into glass beakers containing SNP solutions at concentrations of 5 mM, 10 mM, and 20 mM, as well as a 1 mM solution of c-PTIO. Control samples were treated with distilled water instead. After 3 h of treatment in darkness at 25 °C, the beakers were opened to release any gaseous products. The bulbs were then rinsed 3–4 times with distilled water and transferred to plastic baskets filled with peat soil. They were wrapped in plastic film and stored at 4 °C in cold storage.

4.2. Germination Tests

Previous studies [21,60] have shown that smaller bulblets of Oriental lilies can effectively exit dormancy and produce visible buds after 60 days of cold storage. Following this period, 30 lily bulblets were randomly selected from each SNP treatment group, the c-PTIO treatment group, and the control group for statistical analysis. Dormancy release timing was determined by measuring the length of the lily buds (from the basal plate to the tip of the visible buds); longer sprouts indicated an earlier dormancy release among the different treatment groups.

4.3. Measurement of Enzyme Activities

The method for measuring NR activity followed Lu et al. [61]. Approximately 1.0 g of buds was ground in a mortar, and 10 mL of 50 mM phosphate buffer (pH 7.8) was added. The homogenate was then centrifuged at 12,000 rpm for 20 min, and the supernatant was transferred to a fresh centrifuge tube. Nitrite content was determined by measuring absorbance at 540 nm using a UV–visible spectrophotometer (Shanghai Metash Instruments Co., Ltd., Shanghai, China). NOS-like activity was measured using a plant NOS ELISA kit (Beijing Haolesi Biotechnology Co., Ltd., Beijing, China) according to Diao et al. [62].

4.4. Determination of NO and H2O2 Contents

The NO content was measured using a plant nitric oxide enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Hanhong Biotechnology Co., Ltd., Shanghai, China, FT-P5118Z) following the manufacturer’s instructions. H2O2 content determination followed the method from a previous study [63]. Buds were rinsed with deionized water, surface moisture was absorbed with filter paper, and the buds were weighed. Fresh buds (0.5–0.6 g) were homogenized in 5 mL of propanone. The mixture was adjusted to a final volume of 10 mL, allowed to stand for 5 min, and centrifuged at 5000 rpm for 10 min. The resulting supernatant was combined with 0.1 mL of 5% Ti(SO4)2 (titanium sulfate) and 0.2 mL of NH3 (ammonia), then centrifuged at 10,000 rpm for 10 min at 4 °C. The absorbance of the resulting solution was measured at 415 nm (OD415).

4.5. Phytohormones Measurements

Approximately 1 g of buds was collected at each sampling time, quickly frozen in liquid nitrogen, and stored at −80 °C. Endogenous hormone content was measured using plant hormone (GA, ABA, IAA, ZR) enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Chaorui Biotechnology Co., Ltd., Shanghai, China, HP-E21782, HP-E21768, HP-E21773, HP-E21752) following the manufacturer’s instructions.

4.6. Carbohydrate Assay

Starch content was determined using the iodine colorimetric method [64]. Lily buds (0.5 g) were thoroughly ground in 2 mL of distilled water, followed by the addition of 3.2 mL of 60% perchloric acid, and ground for an additional 10 min. The mixture was then centrifuged at 5000× g for 5 min at room temperature, and the supernatant was filtered to obtain the starch extract. For analysis, 0.5 mL of the extract solution was combined with 3 mL of distilled water and 2 mL of iodine reagent, allowed to stand for 5 min, and then diluted to 10 mL with distilled water. Absorbance was measured at 660 nm.
Soluble sugar content was measured following the method described by Wei et al. [64]. Buds were ground into a fine powder and transferred into a test tube. After a 30-min hydrolysis in a boiling water bath, the mixture was filtered and diluted. A 0.5 mL aliquot of the extract solution was added to a tube containing 1.5 mL of distilled water, 0.5 mL of anthraquinone-ethyl acetate reagent, and 5 mL of concentrated H2SO4. The tubes were shaken in a boiling water bath for 1 min, and absorbance was measured at 630 nm.

4.7. RNA Extraction and Quantitative Reverse Transcriptase-Polymerase Chain Reaction

Total RNA from the middle of the underground stem node was isolated at different growth stages of lily using an RNAprep Pure Plant Kit (TianGen Biotech, Beijing, China), following the kit protocol. RNA degradation and contamination was monitored on 1% agarose gel. RNA quantification and purity assessment were performed spectroscopically using the NanoPhotometer® spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA synthesis was performed using a ReverAid First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. Gene-specific primers for qRT-PCR were designed with Primer 6.0 (Table 1). A single peak of the melting curve in qRT-PCR was used to ensure the specificity of the primers (Figure S1). The reaction mixture utilized Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China) as per the manufacturer’s instructions. All qRT-PCR reactions were carried out using the QuantStudio™ Real-Time PCR system under the following conditions: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 56 °C for 15 s, and 72 °C for 15 s. Melting curves were recorded after the 40th cycle by incrementally increasing the temperature by 0.5 °C every 5 s from 65 °C to 95 °C. The EF-1α gene was used as the internal control for normalization [65]. Relative gene expression levels were calculated using the 2−ΔΔCT method [66].

4.8. Statistical Analysis

All data were first analyzed for normality of distribution using the Kolmogorov–Smirnov test of normality, and homogeneity of variance using the Levene homogeneity of variance test. The data are presented as the mean ± standard deviation (SD) from at least three independent replicates. Statistical analyses were conducted using Tukey’s HSD test at p ≤ 0.05, performed with the SPSS statistical package (version 17.0, Chicago, IL, USA). Charts were created using GraphPad Prism 8 (San Diego, CA, USA).

5. Conclusions

This study demonstrated that nitric oxide (NO) pretreatment effectively promoted the release of dormancy in lily bulblets by modulating the antioxidant system, endogenous hormone levels, and carbohydrate metabolism. The findings confirmed that SNP treatment enhanced the enzymatic activity of endogenous NOS-like enzymes and nitrate reductase (NR), thereby increasing the production of endogenous NO, while c-PTIO treatment had the opposite effect. The 10 mM SNP treatment reduced the dormancy time by 16%. The effect of 1 mM of c-PTIO treatment is consistent with providing an additional 20% cold storage time. This approach for pre-treating lily bulblets not only regulated the flowering period but also reduced the cold storage time required, which was particularly important for minimizing greenhouse gas emissions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26010156/s1.

Author Contributions

Conceptualization, F.C. and S.F.; Data curation, C.Y.; Funding acquisition, F.C.; Investigation, C.Y.; Methodology, X.X. and M.M.A.; Resources, S.F.; Supervision, C.Y.; Validation, S.F.; Visualization, X.H. and W.G.; Writing—original draft, C.Y. and M.M.A.; Writing—review and editing, X.H., W.G., F.C., and S.F. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Fujian Public Welfare Project (NO. 2023R1025003); Forestry Science and Technology Project of Fujian province, China (No. ZMGG-0711); Fujian Academy of Agricultural Sciences-Free Exploration of Scientific and Technological Innovation Project (No. ZYTS2023011).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data, tables, and figures in this manuscript are original.

Acknowledgments

The authors would like to express their appreciation to Ziyi Wu from Fujian Zhanglong Group Co., Ltd., Zhangzhou 363000, China, for assisting with data analysis and contributing to the revision of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Li, W.; Yong, Y.; Zhang, Y.; Lyu, Y. Transcriptional Regulatory Network of GA Floral Induction Pathway in LA Hybrid Lily. Int. J. Mol. Sci. 2019, 20, 2694. [Google Scholar] [CrossRef] [PubMed]
  2. Fang, S.; Lin, M.; Ali, M.M.; Zheng, Y.; Yi, X.; Wang, S.; Chen, F.; Lin, Z. LhANS-rr1, LhDFR, and LhMYB114 Regulate Anthocyanin Biosynthesis in Flower Buds of Lilium ‘Siberia’. Genes 2023, 14, 559. [Google Scholar] [CrossRef] [PubMed]
  3. Yang, C.-Q.; Li, Q.-H.; Jiang, X.-Q.; Fan, Y.-W.; Gao, J.-P.; Zhang, C.-Q. Dynamic changes in α- and β-amylase activities and gene expression in bulbs of the Oriental hybrid lily ‘Siberia’ during dormancy release. J. Hortic. Sci. Biotechnol. 2015, 90, 753–759. [Google Scholar] [CrossRef]
  4. Fang, S.; Yang, C.; Ali, M.M.; Lin, M.; Tian, S.; Zhang, L.; Chen, F.; Lin, Z. Transcriptome Analysis Reveals the Molecular Regularity Mechanism Underlying Stem Bulblet Formation in Oriental Lily ‘Siberia’; Functional Characterization of the LoLOB18 Gene. Int. J. Mol. Sci. 2022, 23, 15246. [Google Scholar] [CrossRef]
  5. Kim, H.T.; Lim, K.-B.; Kim, J.S. New Insights on Lilium Phylogeny Based on a Comparative Phylogenomic Study Using Complete Plastome Sequences. Plants 2019, 8, 547. [Google Scholar] [CrossRef]
  6. Mojtahedi, N.; Masuda, J.-I.; Hiramatsu, M.; Hai, N.T.L.; Okubo, H. Role of Temperature in Dormancy Induction and Release in One-year-old Seedlings of Lilium longiflorum Populations. J. Jpn. Soc. Hortic. Sci. 2013, 82, 63–68. [Google Scholar] [CrossRef][Green Version]
  7. Wang, S.; Yi, X.; Zhang, L.; Ali, M.M.; Ke, M.; Lu, Y.; Zheng, Y.; Cai, X.; Fang, S.; Wu, J.; et al. Characterisation and Expression Analysis of LdSERK1, a Somatic Embryogenesis Gene in Lilium davidii var. unicolor. Plants 2024, 13, 1495. [Google Scholar] [CrossRef] [PubMed]
  8. Ben Mohamed, H.; Vadel, A.M.; Geuns, J.M.; Khemira, H. Biochemical changes in dormant grapevine shoot tissues in response to chilling: Possible role in dormancy release. Sci. Hortic. 2010, 124, 440–447. [Google Scholar] [CrossRef]
  9. Erez, A. Means to compensate for insufficient chilling to improve bloom and leafing. Acta Hortic. 1995, 395, 81–96. [Google Scholar] [CrossRef]
  10. Langens-Gerrits, M.M.; Miller, W.B.M.; Croes, A.F.; De Klerk, G.-J. Effect of low temperature on dormancy breaking and growth after planting in lily bulblets regenerated in vitro. Plant Growth Regul. 2003, 40, 267–275. [Google Scholar] [CrossRef]
  11. Lazare, S.; Bechar, D.; Fernie, A.R.; Brotman, Y.; Zaccai, M. The proof is in the bulb: Glycerol influences key stages of lily development. Plant J. 2018, 97, 321–340. [Google Scholar] [CrossRef]
  12. Hongmei, S.; Tianlai, L.; Yunfei, L. Physiological Mechanism of Metabolism of Carbohydrate, Phenols, Free Amino Acid and Endogenous Hormones in Middle Scales of Lilium davidii var. unicolor Bulbs Stored at Low Temperature for Dormancy Release. Sci. Agric. Sin. 2005, 38, 376. [Google Scholar]
  13. Wang, W.; Su, X.; Tian, Z.; Liu, Y.; Zhou, Y.; He, M. Transcriptome profiling provides insights into dormancy release during cold storage of Lilium pumilum. BMC Genom. 2018, 19, 196. [Google Scholar] [CrossRef]
  14. Zhao, Y.; Liu, C.; Sui, J.; Liang, J.; Ge, J.; Li, J.; Pan, W.; Yi, M.; Du, Y.; Wu, J. A wake-up call: Signaling in regulating ornamental geophytes dormancy. Ornam. Plant Res. 2022, 2, 1–10. [Google Scholar] [CrossRef]
  15. Shim, D.; Ko, J.-H.; Kim, W.-C.; Wang, Q.; Keathley, D.E.; Han, K.-H. A molecular framework for seasonal growth-dormancy regulation in perennial plants. Hortic. Res. 2014, 1, 14059. [Google Scholar] [CrossRef]
  16. Langens-Gerrits, M.; Nashimoto, S.; Croes, A.; De Klerk, G. Development of dormancy in different lily genotypes regenerated in vitro. Plant Growth Regul. 2001, 34, 215–222. [Google Scholar] [CrossRef]
  17. Jásik, J.; de Klerk, G.-J. Effect of Methyl Jasmonate on Morphology and Dormancy Development in Lily Bulblets Regenerated In Vitro. J. Plant Growth Regul. 2006, 25, 45–51. [Google Scholar] [CrossRef]
  18. Delvallée, I.; Paffen, A.; De Klerk, G. The development of dormancy in bulblets of Lilium speciosum generated in vitro. II. The effect of temperature. Physiol. Plant. 1990, 80, 431–436. [Google Scholar] [CrossRef]
  19. Mojtahedi, N.; Koobaz, P.; Fathi, M.; Dabirashrafi, O.; Azadi, P.; Khosravi, S. Maturating, Enlarging and Breaking Dormancy of In Vitro Lilium Bulblets. Int. J. Hortic. Sci. Technol. 2014, 1, 101–109. [Google Scholar] [CrossRef]
  20. Pan, W.; Liang, J.; Sui, J.; Li, J.; Liu, C.; Xin, Y.; Zhang, Y.; Wang, S.; Zhao, Y.; Zhang, J.; et al. ABA and Bud Dormancy in Perennials: Current Knowledge and Future Perspective. Genes 2021, 12, 1635. [Google Scholar] [CrossRef]
  21. Fan, X.; Zou, X.; Fu, L.; Yang, Y.; Li, M.; Wang, C.; Sun, H. The RING-H2 gene LdXERICO plays a negative role in dormancy release regulated by low temperature in Lilium davidii var. unicolor. Hortic. Res. 2023, 10, uhad030. [Google Scholar] [CrossRef] [PubMed]
  22. Habu, T.; Yamane, H.; Igarashi, K.; Hamada, K.; Yano, K.; Tao, R. 454-Pyrosequencing of the Transcriptome in Leaf and Flower Buds of Japanese Apricot (Prunus mume Sieb. et Zucc.) at Different Dormant Stages. J. Jpn. Soc. Hortic. Sci. 2012, 81, 239–250. [Google Scholar] [CrossRef][Green Version]
  23. Ranwala, A.P.; Miller, W.B. Analysis of nonstructural carbohydrates in storage organs of 30 ornamental geophytes by high-performance anion-exchange chromatography with pulsed amperometric detection. New Phytol. 2008, 180, 421–433. [Google Scholar] [CrossRef] [PubMed]
  24. Wu, S.-S.; Wu, J.-D.; Jiao, X.-H.; Zhang, Q.-X.; Lv, Y.-M. The Dynamics of Changes in Starch and Lipid Droplets and Sub-Cellular Localization of β-Amylase During the Growth of Lily Bulbs. J. Integr. Agric. 2012, 11, 585–592. [Google Scholar] [CrossRef]
  25. Shin, K.; Chakrabarty, D.; Paek, K. Sprouting rate, change of carbohydrate contents and related enzymes during cold treatment of lily bulblets regenerated in vitro. Sci. Hortic. 2002, 96, 195–204. [Google Scholar] [CrossRef]
  26. Zhou, Y.; Wang, W.; Yang, L.; Su, X.; He, M. Identification and Expression Analysis of microRNAs in Response to Dormancy Release During Cold Storage of Lilium pumilum Bulbs. J. Plant Growth Regul. 2020, 40, 388–404. [Google Scholar] [CrossRef]
  27. Su, L.; Lan, Q.; Pritchard, H.W.; Xue, H.; Wang, X. Reactive oxygen species induced by cold stratification promote germination of Hedysarum scoparium seeds. Plant Physiol. Biochem. 2016, 109, 406–415. [Google Scholar] [CrossRef] [PubMed]
  28. Niu, L.; Li, B.; Liao, W.; Zhu, Y.; Wang, M.; Jin, X.; Xu, Q. Effect of nitric oxide on dormancy release in bulbs of Oriental lily (Lilium orientalis) ‘Siberia’. J. Hortic. Sci. Biotechnol. 2015, 90, 594–598. [Google Scholar] [CrossRef]
  29. Pan, W.; Li, J.; Du, Y.; Zhao, Y.; Xin, Y.; Wang, S.; Liu, C.; Lin, Z.; Fang, S.; Yang, Y.; et al. Epigenetic silencing of callose synthase by VIL1 promotes bud-growth transition in lily bulbs. Nat. Plants 2023, 9, 1451–1467. [Google Scholar] [CrossRef] [PubMed]
  30. Zhao, Y.; Pan, W.; Xin, Y.; Wu, J.; Li, R.; Shi, J.; Long, S.; Qu, L.; Yang, Y.; Yi, M.; et al. Regulating bulb dormancy release and flowering in lily through chemical modulation of intercellular communication. Plant Methods 2023, 19, 136. [Google Scholar] [CrossRef] [PubMed]
  31. Reed, R.C.; Bradford, K.J.; Khanday, I. Seed germination and vigor: Ensuring crop sustainability in a changing climate. Heredity 2022, 128, 450–459. [Google Scholar] [CrossRef]
  32. Weitbrecht, K.; Müller, K.; Leubner-Metzger, G. First off the mark: Early seed germination. J. Exp. Bot. 2011, 62, 3289–3309. [Google Scholar] [CrossRef]
  33. Shu, K.; Liu, X.-D.; Xie, Q.; He, Z.-H. Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination. Mol. Plant 2015, 9, 34–45. [Google Scholar] [CrossRef] [PubMed]
  34. Astier, J.; Gross, I.; Durner, J. Nitric oxide production in plants: An update. J. Exp. Bot. 2017, 69, 3401–3411. [Google Scholar] [CrossRef]
  35. León, J.; Costa-Broseta, Á. Present knowledge and controversies, deficiencies, and misconceptions on nitric oxide synthesis, sensing, and signaling in plants. Plant Cell Environ. 2019, 43, 1–15. [Google Scholar] [CrossRef]
  36. Yu, M.; Lamattina, L.; Spoel, S.H.; Loake, G.J. Nitric oxide function in plant biology: A redox cue in deconvolution. New Phytol. 2014, 202, 1142–1156. [Google Scholar] [CrossRef] [PubMed]
  37. Wang, Z.; Ma, R.; Zhao, M.; Wang, F.; Zhang, N.; Si, H. NO and ABA Interaction Regulates Tuber Dormancy and Sprouting in Potato. Front. Plant Sci. 2020, 11, 311. [Google Scholar] [CrossRef] [PubMed]
  38. Krasuska, U.; Ciacka, K.; Orzechowski, S.; Fettke, J.; Bogatek, R.; Gniazdowska, A. Modification of the endogenous NO level influences apple embryos dormancy by alterations of nitrated and biotinylated protein patterns. Planta 2016, 244, 877–891. [Google Scholar] [CrossRef]
  39. Rather, B.A.; Mir, I.R.; Masood, A.; Anjum, N.A.; Khan, N.A. Nitric Oxide Pre-Treatment Advances Seed Germination and Alleviates Copper-Induced Photosynthetic Inhibition in Indian Mustard. Plants 2020, 9, 776. [Google Scholar] [CrossRef]
  40. Bethke, P.C.; Libourel, I.G.; Jones, R.L. Nitric oxide reduces seed dormancy in Arabidopsis. J. Exp. Bot. 2005, 57, 517–526. [Google Scholar] [CrossRef]
  41. Liu, H.-Y.; Yu, X.; Cui, D.-Y.; Sun, M.-H.; Sun, W.-N.; Tang, Z.-C.; Kwak, S.-S.; Su, W.-A. The role of water channel proteins and nitric oxide signaling in rice seed germination. Cell Res. 2007, 17, 638–649. [Google Scholar] [CrossRef]
  42. Lozano-Juste, J.; León, J. Nitric Oxide Regulates DELLA Content and PIF Expression to Promote Photomorphogenesis in Arabidopsis. Plant Physiol. 2011, 156, 1410–1423. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, H.; Tang, S.; Wang, J.; Shen, H.; Yang, L. Interaction between reactive oxygen species and hormones during the breaking of embryo dormancy in Sorbus pohuashanensis by exogenous nitric oxide. J. For. Res. 2021, 33, 435–444. [Google Scholar] [CrossRef]
  44. El-Maarouf-Bouteau, H.; Sajjad, Y.; Bazin, J.; Langlade, N.; Cristescu, S.M.; Balzergue, S.; Baudouin, E.; Bailly, C. Reactive oxygen species, abscisic acid and ethylene interact to regulate sunflower seed germination. Plant Cell Environ. 2014, 38, 364–374. [Google Scholar] [CrossRef]
  45. Gniazdowska, A.; Krasuska, U.; Czajkowska, K.; Bogatek, R. Nitric oxide, hydrogen cyanide and ethylene are required in the control of germination and undisturbed development of young apple seedlings. Plant Growth Regul. 2010, 61, 75–84. [Google Scholar] [CrossRef]
  46. Bailly, C.; El-Maarouf-Bouteau, H.; Corbineau, F. From intracellular signaling networks to cell death: The dual role of reactive oxygen species in seed physiology. Comptes Rendus Biol. 2008, 331, 806–814. [Google Scholar] [CrossRef]
  47. Oracz, K.; El-Maarouf-Bouteau, H.; Kranner, I.; Bogatek, R.; Corbineau, F.; Bailly, C. The Mechanisms Involved in Seed Dormancy Alleviation by Hydrogen Cyanide Unravel the Role of Reactive Oxygen Species as Key Factors of Cellular Signaling during Germination. Plant Physiol. 2009, 150, 494–505. [Google Scholar] [CrossRef]
  48. Beligni, M.V.; Lamattina, L. Nitric oxide stimulates seed germination and de-etiolation, and inhibits hypocotyl elongation, three light-inducible responses in plants. Planta 2000, 210, 215–221. [Google Scholar] [CrossRef]
  49. Zhang, Y.; Wang, R.; Wang, X.; Zhao, C.; Shen, H.; Yang, L. Nitric Oxide Regulates Seed Germination by Integrating Multiple Signalling Pathways. Int. J. Mol. Sci. 2023, 24, 9052. [Google Scholar] [CrossRef] [PubMed]
  50. Ma, Z.; Marsolais, F.; Bykova, N.V.; Igamberdiev, A.U. Nitric Oxide and Reactive Oxygen Species Mediate Metabolic Changes in Barley Seed Embryo during Germination. Front. Plant Sci. 2016, 7, 138. [Google Scholar] [CrossRef] [PubMed]
  51. Caro, A.; Puntarulo, S. Nitric Oxide Generation by Soybean Embryonic Axes. Possible Effect on Mitochondrial Function. Free Radic. Res. 1999, 31, 205–212. [Google Scholar] [CrossRef]
  52. Leymarie, J.; Vitkauskaité, G.; Hoang, H.H.; Gendreau, E.; Chazoule, V.; Meimoun, P.; Corbineau, F.; El-Maarouf-Bouteau, H.; Bailly, C. Role of Reactive Oxygen Species in the Regulation of Arabidopsis Seed Dormancy. Plant Cell Physiol. 2011, 53, 96–106. [Google Scholar] [CrossRef]
  53. Van Camp, W.; Van Montagu, M.; Inzé, D. H2O2 and NO: Redox signals in disease resistance. Trends Plant Sci. 1998, 3, 330–334. [Google Scholar] [CrossRef]
  54. Clark, D.; Durner, J.; Navarre, D.A.; Klessig, D.F. Nitric Oxide Inhibition of Tobacco Catalase and Ascorbate Peroxidase. Mol. Plant-Microbe Interact. 2000, 13, 1380–1384. [Google Scholar] [CrossRef]
  55. Freschi, L. Nitric oxide and phytohormone interactions: Current status and perspectives. Front. Plant Sci. 2013, 4, 398. [Google Scholar] [CrossRef]
  56. Zhao, M.-G.; Chen, L.; Zhang, L.-L.; Zhang, W.-H. Nitric Reductase-Dependent Nitric Oxide Production Is Involved in Cold Acclimation and Freezing Tolerance in Arabidopsis. Plant Physiol. 2009, 151, 755–767. [Google Scholar] [CrossRef]
  57. Sarath, G.; Hou, G.; Baird, L.M.; Mitchell, R.B. Reactive oxygen species, ABA and nitric oxide interactions on the germination of warm-season C4-grasses. Planta 2007, 226, 697–708. [Google Scholar] [CrossRef] [PubMed]
  58. Fan, X.; Yang, Y.; Li, M.; Fu, L.; Zang, Y.; Wang, C.; Hao, T.; Sun, H. Transcriptomics and targeted metabolomics reveal the regulatory network of Lilium davidii var. unicolor during bulb dormancy release. Planta 2021, 254, 59. [Google Scholar] [CrossRef]
  59. Gu, J.; Zeng, Z.; Wang, Y.; Lyu, Y. Transcriptome Analysis of Carbohydrate Metabolism Genes and Molecular Regulation of Sucrose Transport Gene LoSUT on the Flowering Process of Developing Oriental Hybrid Lily ‘Sorbonne’ Bulb. Int. J. Mol. Sci. 2020, 21, 3092. [Google Scholar] [CrossRef]
  60. Lazare, S.; Burgos, A.; Brotman, Y.; Zaccai, M. The metabolic (under)groundwork of the lily bulb toward sprouting. Physiol. Plant 2017, 163, 436–449. [Google Scholar] [CrossRef]
  61. Lu, S.; Zhuo, C.; Wang, X.; Guo, Z. Nitrate reductase (NR)-dependent NO production mediates ABA- and H2O2-induced antioxidant enzymes. Plant Physiol. Biochem. 2014, 74, 9–15. [Google Scholar] [CrossRef] [PubMed]
  62. Diao, Q.; Song, Y.; Shi, D.; Qi, H. Interaction of Polyamines, Abscisic Acid, Nitric Oxide, and Hydrogen Peroxide under Chilling Stress in Tomato (Lycopersicon esculentum Mill.) Seedlings. Front. Plant Sci. 2017, 8, 203. [Google Scholar] [CrossRef] [PubMed]
  63. Zhang, H.; Lv, S.; Xu, H.; Hou, D.; Li, Y.; Wang, F. H2O2 Is Involved in the Metallothionein-Mediated Rice Tolerance to Copper and Cadmium Toxicity. Int. J. Mol. Sci. 2017, 18, 2083. [Google Scholar] [CrossRef] [PubMed]
  64. Wei, L.; Wang, C.; Liao, W. Hydrogen Sulfide Improves the Vase Life and Quality of Cut Roses and Chrysanthemums. J. Plant Growth Regul. 2021, 40, 2532–2547. [Google Scholar] [CrossRef]
  65. Zhang, Y.; Yong, Y.B.; Wang, Q.; Lu, Y.M. Physiological and Molecular Changes during Lily Underground Stem Axillary Bulbils Formation. Russ. J. Plant Physiol. 2018, 65, 372–383. [Google Scholar] [CrossRef]
  66. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Lily bulblet dormancy release was affected by SNP and c-PTIO. (A) Phenotypes of bulblets treated with exogenous SNP (5 mM, 10 mM, and 20 mM) and c-PTIO (1 mM) for 3 h and grown at room temperature (4 °C) for 60 days. (B) Bulb length statistics. The data are shown as three independent biological replicates and three technical replicates (n = 3). ****—p ≤ 0.0001, ns—not significant.
Figure 1. Lily bulblet dormancy release was affected by SNP and c-PTIO. (A) Phenotypes of bulblets treated with exogenous SNP (5 mM, 10 mM, and 20 mM) and c-PTIO (1 mM) for 3 h and grown at room temperature (4 °C) for 60 days. (B) Bulb length statistics. The data are shown as three independent biological replicates and three technical replicates (n = 3). ****—p ≤ 0.0001, ns—not significant.
Ijms 26 00156 g001
Figure 2. Effects of SNP and c-PTIO on NO contents (A), no enzyme activity (B,C), and NO-related genes expression (D,E). Values are means ± SDs (n = 3). The data are shown as three independent biological replicates and three technical replicates (n = 3). Different lowercase letters indicate statistically significant differences at p ≤ 0.05.
Figure 2. Effects of SNP and c-PTIO on NO contents (A), no enzyme activity (B,C), and NO-related genes expression (D,E). Values are means ± SDs (n = 3). The data are shown as three independent biological replicates and three technical replicates (n = 3). Different lowercase letters indicate statistically significant differences at p ≤ 0.05.
Ijms 26 00156 g002
Figure 3. Changes in antioxidant enzyme activity (BD) and H2O2 contents (A) of lily bubs treated with 10 mM SNP, 1 mM c-PTIO or SNP with c-PTIO during dormancy release at room temperature (4 °C) for 60 days. The data are shown as three independent biological replicates and three technical replicates (n = 3).
Figure 3. Changes in antioxidant enzyme activity (BD) and H2O2 contents (A) of lily bubs treated with 10 mM SNP, 1 mM c-PTIO or SNP with c-PTIO during dormancy release at room temperature (4 °C) for 60 days. The data are shown as three independent biological replicates and three technical replicates (n = 3).
Ijms 26 00156 g003
Figure 4. Changes in endogenous phytohormone contents and related genes expression of lily bubs treated with 10 mM SNP, 1 mM c-PTIO or SNP with c-PTIO during dormancy release at room temperature (4 °C) for 60 days. (A) ABA contents; (B) GA contents; (C) IAA contents; (D) ZR contents; (E) relative expression of LoARR; (F) relative expression of LoCYP707A1; (G) relative expression of LoDELLA; (H) relative expression of LoGA20x; (I) relative expression of LoGH3.1; (J) relative expression of LoNCED1; (K) relative expression of LoVIL1; (L) relative expression of LoXERICO. The data are shown as three independent biological replicates and three technical replicates (n = 3). Different lowercase letters indicate statistically significant differences at p ≤ 0.05.
Figure 4. Changes in endogenous phytohormone contents and related genes expression of lily bubs treated with 10 mM SNP, 1 mM c-PTIO or SNP with c-PTIO during dormancy release at room temperature (4 °C) for 60 days. (A) ABA contents; (B) GA contents; (C) IAA contents; (D) ZR contents; (E) relative expression of LoARR; (F) relative expression of LoCYP707A1; (G) relative expression of LoDELLA; (H) relative expression of LoGA20x; (I) relative expression of LoGH3.1; (J) relative expression of LoNCED1; (K) relative expression of LoVIL1; (L) relative expression of LoXERICO. The data are shown as three independent biological replicates and three technical replicates (n = 3). Different lowercase letters indicate statistically significant differences at p ≤ 0.05.
Ijms 26 00156 g004
Figure 5. Changes in soluble sugar contents, starch contents, and related genes expression of lily bulbs treated with 10 mM SNP, 1 mM c-PTIO or SNP with c-PTIO during dormancy release at room temperature (4 °C) for 60 days. (A) Soluble sugar contents; (B) starch contents; (C) relative expression of LoAMY; (D) relative expression of LoBMY; (E) relative expression of LoSPS; (F) relative expression of LoSUS; (G) relative expression of LoSUT; (H) relative expression of LoTMT. The data are shown as three independent biological replicates and three technical replicates (n = 3). Different lowercase letters indicate statistically significant differences at p ≤ 0.05.
Figure 5. Changes in soluble sugar contents, starch contents, and related genes expression of lily bulbs treated with 10 mM SNP, 1 mM c-PTIO or SNP with c-PTIO during dormancy release at room temperature (4 °C) for 60 days. (A) Soluble sugar contents; (B) starch contents; (C) relative expression of LoAMY; (D) relative expression of LoBMY; (E) relative expression of LoSPS; (F) relative expression of LoSUS; (G) relative expression of LoSUT; (H) relative expression of LoTMT. The data are shown as three independent biological replicates and three technical replicates (n = 3). Different lowercase letters indicate statistically significant differences at p ≤ 0.05.
Ijms 26 00156 g005
Figure 6. Model depicting how NO regulates bulblet dormancy release. Exogenous SNP treatment activates NOS-like or NR activity, which promotes NO production, while c-PTIO treatment has the opposite effect. NO promotes the contents of H2O2, GA, IAA, ZR for accelerating the progress of dormancy release. NO also promotes the catabolism of ABA and starch. The resulting decreased contents of ABA and starch ultimately lead to dormancy release.
Figure 6. Model depicting how NO regulates bulblet dormancy release. Exogenous SNP treatment activates NOS-like or NR activity, which promotes NO production, while c-PTIO treatment has the opposite effect. NO promotes the contents of H2O2, GA, IAA, ZR for accelerating the progress of dormancy release. NO also promotes the catabolism of ABA and starch. The resulting decreased contents of ABA and starch ultimately lead to dormancy release.
Ijms 26 00156 g006
Table 1. Genes and primer sets used for qRT-PCR analysis.
Table 1. Genes and primer sets used for qRT-PCR analysis.
Gene NameProtein DescriptionPrimer SequenceLength (bp)
LoNOS-IPNitric oxide synthase-interacting proteinF: CCCTCAACCCTTTCACAG
R: CACTTTGTCCTTGTCCTTAC
101
LoNRNitrate reductaseF: TGTTCGTCTCGCAGTAAG
R: TGTTCGTCTCGCAGTAAG
100
LoARRTwo-component response regulator ARR-A familyF: ATATGCTGATGCTGCTCTC
R: CTCAACTCGGAATGGTGAT
145
LoCYP707A1Cytochrome P450, family 707, subfamily A, polypeptide 1F: GAAGAAGCAGAAGAAGTATGG
R: GCACCTGAGACAAGAACA
108
LoDELLADELLA proteinF: GAAGCACTCCACTACTACTC
R: CCTCGCATCCAATAACATTC
142
LoGA20xGibberellin 20 oxidaseF: TGGTTATCACGGTGTAGGA
R: GGAAGCGAAGTTGGAGTT
139
LoGH3.1Auxin-responsive GH3 family proteinF: ACACTGCTGCCGAATATG
R: CACCTCTACCTCCACCAA
150
LoNCED19-cis-epoxycarotenoid dioxygenase F: TTCGTTCATCGGAGATTGT
R: CGGATTGTGTTAGGTTAGTG
118
LoVIL1Vernalization insensitive like1F: TCATCCTCAACCTCCTCTTA
R: CAAGTTCAGGCAGTATTCG
130
LoXERICORING/U-box superfamily proteinF: GACAAGCGAGGTAGTGAG
R: TTAGTTGAGAGCCGATCTG
112
LoAMYAlpha-amylaseF: ATGGAATGGAAGTTCTCTGA
R: CTGAAGTGTGGACTGGTT
122
LoBMYBeta-amylaseF: ACGGTAAGCAGGTGATTG
R: GATGACGCCAAGAGGAAG
101
LoSPSSucrose phosphate synthaseF: GGAGGACATCAATGCTACA
R: CCACTGCTCTTCAATCTCT
115
LoSUSSucrose synthaseF: CAAGAAGGTCAAGGAGCAGATG
R: CCGCACTAAGGAAAGCAGAG
159
LoSUTSucrose transport proteinF: TTATGGCTCTCTGCTTTGTA
R: TGTGCGAGTAGAAATCATTG
182
LoTMTTonoplast Monosaccharide TransporterF: TTGGCTCTGGATCGCTATCG
R: CTCGCTCTCACTGTCACTCTC
94
F means forward primer; R means reverse primer.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, C.; Xu, X.; Ali, M.M.; He, X.; Guo, W.; Chen, F.; Fang, S. Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium. Int. J. Mol. Sci. 2025, 26, 156. https://doi.org/10.3390/ijms26010156

AMA Style

Yang C, Xu X, Ali MM, He X, Guo W, Chen F, Fang S. Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium. International Journal of Molecular Sciences. 2025; 26(1):156. https://doi.org/10.3390/ijms26010156

Chicago/Turabian Style

Yang, Chenglong, Xiaoping Xu, Muhammad Moaaz Ali, Xing He, Wenjie Guo, Faxing Chen, and Shaozhong Fang. 2025. "Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium" International Journal of Molecular Sciences 26, no. 1: 156. https://doi.org/10.3390/ijms26010156

APA Style

Yang, C., Xu, X., Ali, M. M., He, X., Guo, W., Chen, F., & Fang, S. (2025). Nitric Oxide Pre-Treatment Advances Bulblet Dormancy Release by Mediating Metabolic Changes in Lilium. International Journal of Molecular Sciences, 26(1), 156. https://doi.org/10.3390/ijms26010156

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop