Synergistic Effect of Dietary Supplementation with Sodium Butyrate, β-Glucan and Vitamins on Growth Performance, Cortisol Level, Intestinal Microbiome and Expression of Immune-Related Genes in Juvenile African Catfish (Clarias gariepinus)
Abstract
1. Introduction
2. Results
2.1. Growth Parameters
2.2. Cortisol Level in Blood Plasma
2.3. Expression of Immune-Related Genes
2.4. Sequencing Data of Microbiome
2.5. Profile of Gut Microbiome
3. Discussion
4. Materials and Methods
4.1. The Origin of the Experimental Fish
4.2. Initial Rearing
4.3. Experimental Feed
4.4. Description of the Experiment
4.5. Cyclic Measurement of Fish Body Weight and Length
4.6. Sampling Procedure
4.7. Analysis of Cortisol Level in the Blood Plasma
4.8. RNA Extraction and Immune Related Genes Expression
4.9. DNA Extraction, Metagenomic Sequencing and Bioinformatic Analysis of the Intestinal Microbiome
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. FishStatJ v4.01.1 (October 2021); Food and Agriculture Organization of the United Nations: Rome, Italy, 2021. [Google Scholar]
- FAO. The State of World Fisheries and Aquaculture-Contributing to food security and nutrition for all. Fisheries and Aquaculture Department; Food and Agriculture Organization of the United Nations: Rome, Italy, 2016. [Google Scholar]
- Langi, S.; Maulu, S.; Hasimuna, O.J.; Kaleinasho Kapula, V.; Tjipute, M. Nutritional requirements and effect of culture conditions on the performance of the African catfish (Clarias gariepinus): A review. Cogent Food Agric. 2024, 10, 2302642. [Google Scholar] [CrossRef]
- FAO. Clarias gariepinus. In Cultured Aquatic Species Information Programme; Pouomogne, V., Ed.; Fisheries and Aquaculture Division (online); Food and Agriculture Organization of the United Nations: Rome, Italy, 2024. [Google Scholar]
- Abdel-Mobdy, H.E.; Abdel-Aal, H.A.; Souzan, S.L.; Nassar, A.G. Nutritional Value of African Catfish (Clarias gariepinus) Meat. Asian J. Appl. Chem. 2021, 8, 31–39. [Google Scholar] [CrossRef]
- Pasch, J.; Palm, H.W. Economic Analysis and Improvement Opportunities of African Catfish (Clarias gariepinus) Aquaculture in Northern Germany. Sustainability 2021, 13, 13569. [Google Scholar] [CrossRef]
- Phan, L.T.T.; Kals, J.; Masagounder, K.; Mas-Muñoz, J.; Schrama, J.W. Energy utilisation efficiencies of digestible protein, fat and carbohydrates for African catfish (Clarias gariepinus). Aquac. Rep. 2022, 23, 101051. [Google Scholar] [CrossRef]
- Nowosad, J.; Kucharczyk, D.; Targońska, K. Enrichment of Zebrafish Danio rerio (Hamilton, 1822) Diet with Polyunsaturated Fatty Acids Improves Fecundity and Larvae Quality. Zebrafish 2017, 14, 364–370. [Google Scholar] [CrossRef] [PubMed]
- Nowosad, J.; Jasiński, S.; Arciuch-Rutkowska, M.; Abdel-Latif, H.M.R.; Wróbel, M.; Mikiewicz, M.; Zielonka, Ł.; Kotsyumbas, I.Y.; Muzyka, V.P.; Brezvyn, O.M.; et al. Effects of Bee Pollen on Growth Performance, Intestinal Microbiota and Histomorphometry in African Catfish. Animals 2023, 13, 132. [Google Scholar] [CrossRef] [PubMed]
- Al-Khalaifah, H.S.; Khalil, A.A.; Amer, S.A.; Shalaby, S.I.; Badr, H.A.; Farag, M.F.M.; Altohamy, D.E.; Abdel Rahman, A.N. Effects of Dietary Doum Palm Fruit Powder on Growth, Antioxidant Capacity, Immune Response, and Disease Resistance of African Catfish, Clarias gariepinus (B.). Animals 2020, 10, 1407. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, F.Y.; Castillo, S.; de Cruz, C.R.; Chen, K.; Hume, M.E.; Gatlin, D.M. Synergistic effects of the β-1,3 glucan paramylon and vitamin C on immunological responses of hybrid striped bass (Morone chrysops × M. saxatilis) were pronounced in vitro but more moderate in vivo. Aquaculture 2020, 526, 735394. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Metwally, A.E.-S.; El-Sharawy, M.E.; Atta, A.M.; Elbialy, Z.I.; Abdel-Latif, H.M.R.; Paray, B.A. The role of β-glucan in the growth, intestinal morphometry, and immune-related gene and heat shock protein expressions of Nile tilapia (Oreochromis niloticus) under different stocking densities. Aquaculture 2020, 523, 735205. [Google Scholar] [CrossRef]
- Hoseinifar, S.H.; Sun, Y.-Z.; Caipang, C.M. Short-chain fatty acids as feed supplements for sustainable aquaculture: An updated view. Aquac. Res. 2017, 48, 1380–1391. [Google Scholar] [CrossRef]
- Wu, X.; Wang, L.; Xie, Q.; Tan, P. Effects of dietary sodium butyrate on growth, diet conversion, body chemical compositions and distal intestinal health in yellow drum (Nibea albiflora, Richardson). Aquac. Res. 2020, 51, 69–79. [Google Scholar] [CrossRef]
- Chen, W.; Gao, S.; Chang, K.; Zhao, X.; Niu, B. Dietary sodium butyrate supplementation improves fish growth, intestinal microbiota composition, and liver health in largemouth bass (Micropterus salmoides) fed high-fat diets. Aquaculture 2023, 564, 739040. [Google Scholar] [CrossRef]
- Abdel-Latif, H.M.R.; Abdel-Tawwab, M.; Dawood, M.A.O.; Menanteau-Ledouble, S.; El-Matbouli, M. Benefits of Dietary Butyric Acid, Sodium Butyrate, and Their Protected Forms in Aquafeeds: A Review. Rev. Fish Sci. Aquac. 2020, 28, 421–448. [Google Scholar] [CrossRef]
- Zhang, J.; Zhong, L.; Chi, S.; Chu, W.; Liu, Y.; Hu, Y. Sodium butyrate supplementation in high-soybean meal diets for juvenile rice field eel (Monopterus albus): Effects on growth, immune response and intestinal health. Aquaculture 2020, 520, 734952. [Google Scholar] [CrossRef]
- Omosowone, O.; Dada, A.; Adeparusi, E. Comparison of dietary butyric acid supplementation effect on growth performance and body composition of Clarias gariepinus and Oreochromis niloticus fingerlings. Iran. J. Fish Sci. 2018, 17, 403–412. [Google Scholar] [CrossRef]
- Abdel-Mohsen, H.H.; Wassef, E.A.; El-Bermawy, N.M.; Abdel-Meguid, N.E.; Saleh, N.E.; Barakat, K.M.; Shaltout, O.E. Advantageous effects of dietary butyrate on growth, immunity response, intestinal microbiota and histomorphology of European Seabass (Dicentrarchus labrax) fry. Egypt. J. Aquat. Biol. Fish 2018, 22, 93–110. [Google Scholar] [CrossRef]
- El-Sharkawy, E.A.; El-Razek, I.M.A.; Amer, A.A.; Soliman, A.A.; Shukry, M.; Gewaily, M.S.; Téllez-Isaías, G.; Kari, Z.A.; Dawood, M.A.O. Effects of sodium butyrate on the growth performance, digestive enzyme activity, intestinal health, and immune responses of Thinlip Grey Mullet (Liza ramada) juveniles. Aquac. Rep. 2023, 30, 101530. [Google Scholar] [CrossRef]
- Rimoldi, S.; Gliozheni, E.; Ascione, C.; Gini, E.; Terova, G. Effect of a specific composition of short-and medium-chain fatty acid 1-monoglycerides on growth performances and gut microbiota of gilthead sea bream (Sparus aurata). PeerJ 2018, 31, 5355. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Yang, Y.; Zhang, J.; Gatlin, D.M.; Ringø, E.; Zhou, Z. Effects of dietary microencapsulated sodium butyrate on growth, intestinal mucosal morphology, immune response and adhesive bacteria in juvenile common carp (Cyprinus carpio) pre-fed with or without oxidised oil. B J. Nutr. 2014, 112, 15–29. [Google Scholar] [CrossRef] [PubMed]
- Rimoldi, S.; Finzi, G.; Ceccotti, C.; Girardello, R.; Grimaldi, A.; Ascione, C.; Terova, G. Butyrate and taurine exert a mitigating effect on the inflamed distal intestine of European sea bass fed with a high percentage of soybean meal. Fish Aquat. Sci. 2016, 19, 40. [Google Scholar] [CrossRef]
- Terova, G.; Dıaz, N.; Rimoldi, S.; Ceccotti, C.; Gliozheni, E.; Piferrer, F. Effects of sodium butyrate treatment on histone modifications and the expression of genes related to epigenetic regulatory mechanisms and immune response in European Sea bass (Dicentrarchus labrax) fed a plant-based diet. PLoS ONE 2016, 11, e0160332. [Google Scholar] [CrossRef] [PubMed]
- Tian, L.; Zhou, X.-Q.; Jiang, W.D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. Sodium butyrate improved intestinal immune function associated with NF-jB and p38MAPK signalling pathways in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2017, 66, 548–563. [Google Scholar] [CrossRef]
- Yuan, C.; Hu, R.; He, L.; Hu, J.; Liu, H. Extraction and prebiotic potential of β-glucan from highland barley and its application in probiotic microcapsules. Food Hydrocoll. 2023, 139, 108520. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Eweedah, N.M.; Moustafa, E.M.; Shahin, M.G. Synbiotic Effects of Aspergillus oryzae and β-Glucan on growth and oxidative and immune responses of Nile Tilapia, Oreochromis niloticus. Probiotics Antimicrob. Proteins 2020, 12, 172–183. [Google Scholar] [CrossRef] [PubMed]
- Domenico, J.D.; Canova, R.; Soveral, L.; Nied, C.; Costa, M.; Frandoloso, R.; Kreutz, C. Immunomodulatory effects of dietary β-glucan in silver catfish (Rhamdia quelen). Pesqui. Vet. Bras. 2017, 37, 73–78. [Google Scholar] [CrossRef][Green Version]
- Dawood, M.A.O.; Moustafa, E.M.; Elbialy, Z.I.; Farrag, F.; Lolo, E.E.E.; Abdel-Daim, H.A.; Abdel-Daim, M.M.; Van Doan, H. Lactobacillus plantarum L-137 and/or β-glucan impacted the histopathological, antioxidant, immune-related genes and resistance of Nile tilapia (Oreochromis niloticus) against Aeromonas hydrophila. Res. Vet. Sci. 2020, 130, 212–221. [Google Scholar] [CrossRef] [PubMed]
- de Mello, M.M.; Pereira de Faria, C.F.; Zanuzzo, F.S.; Urbinati, E.C. β-glucan modulates cortisol levels in stressed pacu (Piaractus mesopotamicus) inoculated with heat-killed Aeromonas hydrophila. Fish Shellfish Immunol. 2019, 93, 1076–1083. [Google Scholar] [CrossRef] [PubMed]
- Lopes, L.M.F.; Marinho de Mello, M.M.; Urbinati, E.C. β-Glucan reduces cortisol plasma levels, enhances innate immune system after A. hydrophila inoculation, and has lipolytic effects on the pacu (Piaractus mesopotamicus). Aquaculture 2022, 546, 737411. [Google Scholar] [CrossRef]
- Geay, F.; Kestemont, P. Feeding and nutrition of percid fishes during ongrowing stages. In Biology and Culture of Percid Fishes; Kestemont, P., Dabrowski, K., Summerfelt, R.C., Eds.; Springer: Dordrecht, The Netherlands, 2015; pp. 587–622. [Google Scholar] [CrossRef]
- Hee, B.; Wells, J.M. Microbial Regulation of Host Physiology by Short-chain Fatty Acids. Trends Microbiol. 2021, 29, 700–712. [Google Scholar] [CrossRef] [PubMed]
- Martin-Gallausiaux, C.; Marinelli, L.; Blottière, H.M.; Larraufie, P.; Lapaque, N. SCFA: Mechanisms and functional importance in the gut. Proc. Nutr. Soc. 2021, 80, 37–49. [Google Scholar] [CrossRef]
- Arciuch-Rutkowska, M.; Nowosad, J.; Jasiński, S.; Łuczyński, M.; Kucharczyk, D. Effects of the diet enrichment with β-glucan, sodium salt of butyric acid and vitamins on growth parameters and the profile of the gut microbiome of juvenile African catfish (Clarias gariepinus). Anim. Feed Sci. Technol. 2024, 310, 115941. [Google Scholar] [CrossRef]
- Elnesr, S.S.; Alagawany, M.; Elwan, H.A.M.; Fathi, M.A.; Farag, M.R. Effect of Sodium Butyrate on Intestinal Health of Poultry—A Review. Ann. Anim. Sci. 2020, 20, 29–41. [Google Scholar] [CrossRef]
- Zhao, H.; Wang, G.; Wang, H.; Mo, W.; Huang, Y.; Cao, J.; Li, P. Effects of dietary sodium butyrate on growth, digestive enzymes, body composition and nutrient retention-related gene expression of juvenile yellow catfish (Pelteobagrus fulvidraco). Anim. Nutr. 2021, 7, 539–547. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Lin, H.; Huang, Z.; Wang, J.; Yun, W.; Wei, Y. Effect of dietary sodium butyrate on growth performance, enzyme activities and intestinal proliferation-related gene expression of juvenile golden pompano Trachinotus ovatus. Aquac. Nutr. 2019, 25, 1261–1271. [Google Scholar] [CrossRef]
- Fang, L.; Wang, Q.; Guo, X.; Pan, X.; Li, X. Effects of dietary sodium butyrate on growth performance, antioxidant capacity, intestinal histomorphology and immune response in juvenile Pengze crucian carp (Carassius auratus Pengze). Aquac. Rep. 2021, 21, 100828. [Google Scholar] [CrossRef]
- Shukry, M.; Farrag, F.; El-Shafai, N.; Dawood, M.A.O.; Abdel-Latif, H.M.R. Dietary sodium butyrate nanoparticles enhanced growth, digestive enzyme activities, intestinal histomorphometry, and transcription of growth-related genes in Nile tilapia juveniles. Aquaculture 2021, 536, 736467. [Google Scholar] [CrossRef]
- Monier, M.N.; El-Naby, A.A.S.; Samir, F.; Abdel-Tawwab, M. Positive effects of dietary nanosized sodium butyrate on growth performance, immune, antioxidant indices, and resistance of Nile tilapia to waterborne copper toxicity. Aquac. Rep. 2022, 26, 101323. [Google Scholar] [CrossRef]
- El-Naby, A.S.A.; Khattaby, A.E.A.; Samir, F.; Awad, S.M.M.; Abdel-Tawwab, M. Stimulatory effect of dietary butyrate on growth, immune response, and resistance of Nile tilapia, Oreochromis niloticus against Aeromonas hydrophila infection. Anim. Feed Sci. Technol. 2019, 254, 114212. [Google Scholar] [CrossRef]
- Aramli, M.S.; Kamangar, B.; Nazari, R.M. Effects of dietaryβ-glucan on the growth and innate immune response of juvenile Persian sturgeon, Acipenser persicus. Fish Shellfish Immunol. 2015, 47, 606–610. [Google Scholar] [CrossRef] [PubMed]
- Do Huu, H.; Sang, M.H.; Thuy, N.T. Dietary β-glucan improved growth performance, Vibrio counts, haematological parameters and stress resistance of pompano fish, Trachinotus ovatus Linnaeus, 1758. Fish Shellfish Immunol. 2016, 54, 402–410. [Google Scholar] [CrossRef] [PubMed]
- Khanjani, M.H.; Ghaedi, G.; Sharifinia, M. Effects of diets containing β-glucan on survival, growth performance, haematological, immunity and biochemical parameters of rainbow trout (Oncorhynchus mykiss) fingerlings. Aquac. Res. 2021, 53, 1842–1850. [Google Scholar] [CrossRef]
- Dou, X.; Huang, H.; Li, Y.; Deng, J.; Tan, B. Effects of dietary β-glucan on growth rate, antioxidant status, immune response, and resistance against Aeromonas hydrophila in genetic improvement of farmed tilapia (GIFT, Oreochromis niloticus). Aquac. Rep. 2023, 29, 101480. [Google Scholar] [CrossRef]
- Chotikachinda, R.; Lapjatupon, W.; Chaisilapasung, S.; Sangsue, D.; Chutima, T. Effect of inactive yeast cell wall on growth performance, survival rate and immune parameters in Pacific White Shrimp (Litopenaeus vannamei). Songklanakarin J. Sci. Technol. 2008, 30, 687–692. [Google Scholar]
- Machuca, C.; Méndez-Martínez, Y.; Reyes-Becerril, M.; Angulo, C. Yeast β-Glucans as Fish Immunomodulators: A Review. Animals 2022, 12, 2154. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Wang, M.; Fu, L.; Zhong, L.; Liu, G.; Zheng, Y.; Chen, X.; Bian, W. Liver transcriptome analysis and cortisol immune-response modulation in lipopolysaccharide-stimulated in channel catfish (Ictalurus punctatus). Fish Shellfish Immunol. 2020, 101, 19–50. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.-Z.; Tu, X.; Zha, J.W.; Huang, A.G.; Wang, G.X.; Ling, F. Immunosuppression-induced alterations in fish gut microbiota may increase the susceptibility to pathogens. Fish Shellfish Immunol. 2019, 88, 540–545. [Google Scholar] [CrossRef] [PubMed]
- Montoya, L.N.F.; Favero, G.C.; Zanuzzo, F.S.; Urbinati, E.C. Distinct β-glucan molecules modulates differently the circulating cortisol levels and innate immune responses in matrinxã (Brycon amazonicus). Fish Shellfish Immunol. 2018, 83, 314–320. [Google Scholar] [CrossRef] [PubMed]
- Okhionkpamwonyi, O.N.; Edema, C.U. Effects of supplemental vitamin C (ascorbic acid) on the growth and health of African catfish Clarias gariepinus. J. Appl. Sci. Environ. Manag. 2017, 21, 177–183. [Google Scholar] [CrossRef]
- Adewolu, M.A.; Aro, O.O. Growth, feed utilization and haematology of Clarias gariepinus (Burchell1822) fingerlings fed diets containing different levels of vitamin C. Am. J. Appl. Sci. 2009, 6, 1675–1681. [Google Scholar] [CrossRef][Green Version]
- Udo, I.U. Effects of Dietary Vitamin A level on Growth, Feed Utilization and Survival of Juvenile North African Catfish (Clarias gariepinus). Livest. Res. Rural. Dev. 2017, 29, 22. Available online: http://www.lrrd.cipav.org.co/lrrd29/2/udo29022.htm (accessed on 21 April 2024).
- Lock, E.J.; Waagbo, R.; Bonga, S.W.; Flik, G. The significance of vitamin D for fish: A review. Aquac. Nutr. 2010, 16, 100–116. [Google Scholar] [CrossRef]
- Dominguez, D.; Montero, D.; Zamorano, M.J.; Castro, P.; Fontanillas, R.; Prabhu, P.A.J.; Izquierdo, M. Effects of vitamin D3 supplementation in gilthead seabream (Sparus aurata) juveniles fed diets high in plant based feedstuffs. Aquaculture 2021, 543, 736991. [Google Scholar] [CrossRef]
- Saheli, M.; Islami, H.R.; Mohseni, M.; Soltani, M. Effects of dietary vitamin E on growth performance, body composition, antioxidant capacity, and some immune responses in Caspian trout (Salmo caspius). Aquac. Rep. 2021, 21, 100857. [Google Scholar] [CrossRef]
- Sivagurunathan, U.; Dominguez, D.; Tseng, Y.; Zamorano, M.J.; Prabhu, A.J.; Izquierdo, M. Deficiency and excess in dietary vitamin K3 negatively affect gilthead seabream (Sparus aurata) larvae performance and bone health. Aquaculture 2023, 574, 739646. [Google Scholar] [CrossRef]
- Markowiak-Kopeć, P.; Śliżewska, K. The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 2020, 12, 1107. [Google Scholar] [CrossRef] [PubMed]
- Luan, T.; Li, M.; Zhou, W.; Yao, Y.; Yang, Y.; Zhang, Z.; Ringø, E.; Olsen, R.E.; Clarke, J.L.; Xie, S.; et al. The Fish Microbiota: Research Progress and Potential Applications. Engineering 2023, in press. [Google Scholar] [CrossRef]
- Shan, C.; Li, M.; Liu, Z.; Xu, R.; Qiao, F.; Du, Z.-Y.; Zhang, M.-L. Pediococcus pentosaceus enhances host resistance against pathogen by increasing IL-1β production: Understanding probiotic effectiveness and administration duration. Front. Immunol. 2021, 12, 766401. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zhang, H.; Liu, M.; Lan, Y.; Sun, H.; Mai, K.; Wan, M. Short-Chain Fatty Acids Promote Intracellular Bactericidal Activity in Head Kidney Macrophages From Turbot (Scophthalmus maximus L.) via Hypoxia Inducible Factor-1α. Front. Immunol. 2020, 11, 615536. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.P.; Bhardwaj, A. β-glucans: A potential source for maintaining gut microbiota and the immune system. Front. Nutr. 2023, 10, 1143682. [Google Scholar] [CrossRef] [PubMed]
- Kim, P.S.; Shin, N.R.; Lee, J.B.; Kim, M.S.; Whon, T.W.; Hyun, D.W.; Yun, J.H.; Jung, M.J.; Kim, J.Y.; Bae, J.W. Host habitat is the major determinant of the gut microbiome of Fish. Microbiome 2021, 9, 166. [Google Scholar] [CrossRef] [PubMed]
- Wah-Suárez, M.I.; Vázquez, M.A.M.; Bosques-Padilla, F.J. Inflammatory bowel disease: The role of commensal microbiome in immune regulation. Gastroenterol. Ía Y. Hepatol. Ía (Engl. Ed.) 2022, 45, 626–636. [Google Scholar] [CrossRef]
- Li, P.; Ma, X.; Liu, D.; Wei, Y.; Li, P.; Hou, H.; Yao, J.; Chen, A.; Liang, Y.; Zhou, Z.; et al. A microbiome abundant environment remodels the intestinal microbiota and improves resistance to obesity induced by chlorpyrifos in mice. Environ. Pollut. 2022, 315, 120415. [Google Scholar] [CrossRef] [PubMed]
- Hitch, T.C.A.; Hall, L.J.; Walsh, S.K.; Leventhal, G.E.; Slack, E.; de Wouters, T.; Walter, J.; Clavel, T. Microbiome-based interventions to modulate gut ecology and the immune system. Mucosal Immunol. 2022, 15, 1095–1113. [Google Scholar] [CrossRef] [PubMed]
- Bozzi, D.; Rasmussen, J.A.; Carøe, C.; Sveier, H.; Nordøy, K.; Gilbert, M.T.P.; Limborg, M.T. Salmon gut microbiota correlates with disease infection status: Potential for monitoring health in farmed animals. Anim. Micro. 2021, 3, 30. [Google Scholar] [CrossRef] [PubMed]
- Larsen, A.M.; Mohammed, H.H.; Arias, C.R. Characterization of the gut microbiota of three commercially valuable warmwater fish species. J. Appl. Microbiol. 2014, 116, 1396–1404. [Google Scholar] [CrossRef] [PubMed]
- Kelly, D.; Yang, L.; Pei, Z. Gut Microbiota, Fusobacteria, and Colorectal Cancer. Diseases 2018, 6, 109. [Google Scholar] [CrossRef] [PubMed]
- Ramírez, C.; Coronado, J.; Silva, A.; Romero, J. Cetobacterium is a major component of the microbiome of Giant Amazonian Fish (Arapaima gigas) in Ecuador. Animals 2018, 8, 189. [Google Scholar] [CrossRef] [PubMed]
- Tsuchiya, C.; Sakata, T.; Sugita, H. Novel ecological niche of Cetobacterium somerae, an anaerobic bacterium in the intestinal tracts of freshwater Fish. Lett. Appl. Microbiol. 2008, 46, 43–48. [Google Scholar] [CrossRef] [PubMed]
- van Kessel, M.A.; Dutilh, B.E.; Neveling, K.; Kwint, M.P.; Veltman, J.A.; Flik, G.; Jetten, M.S.; Klaren, P.H.; Op den Camp, H.J. Pyrosequencing of 16s rRNA gene amplicons to study the microbiota in the gastrointestinal tract of carp (Cyprinus carpio L.). AMB Express 2011, 1, 41. [Google Scholar] [CrossRef] [PubMed]
- Sakai, M.; Hikima, J.; Kono, T. Fish cytokines: Current research and applications. Fish Sci. 2021, 87, 1–9. [Google Scholar] [CrossRef]
- Kono, T.; Fujiki, K.; Nakao, M.; Yano, T.; Endo, M.; Sakai, M. The immune responses of common carp, Cyprinus carpio L., injected with carp interleukin-1beta gene. J. Interferon Cytokine Res. 2022, 22, 413–419. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Secombes, C.J. The Function of Fish Cytokines. Biology 2016, 5, 23. [Google Scholar] [CrossRef] [PubMed]
- Dawood, M.A.O.; Koshio, S. Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture 2015, 454, 243–251. [Google Scholar] [CrossRef]
- Rodríguez, I.; Chamorro, R.; Novoa, B.; Figueras, A. β-Glucan administration enhances disease resistance and some innate immune responses in zebrafish (Danio rerio). Fish Shellfish Immunol. 2009, 27, 369–373. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, T.; Zhao, J.; Chen, X. Chrysene alters the expression pattern of HSP70 genes in mandarin Fish. Aquac. Fish 2023, in press. [Google Scholar] [CrossRef]
- Giri, S.S.; Sen, S.S.; Sukumaran, V. Role of HSP70 in cytoplasm protection against thermal stress in rohu, Labeo rohita. Fish Shellfish Immunol. 2014, 41, 294–299. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Xun, X.G.; Kong, Y.F.; Wang, S.; Yang, Z.; Li, Y.; Kong, D.; Wang, S.; Zhang, L.; Hu, X.; et al. Hsp70 gene expansions in the scallop Patinopecten yessoensis and their expression regulation after exposure to the toxic dinoflagellate Alexandrium catenella. Fish Shellfish Immunol. 2016, 58, 266–273. [Google Scholar] [CrossRef] [PubMed]
- Ran, C.; Huang, L.; Hu, J.; Tacon, P.; He, S.; Li, Z.; Wang, Y.; Liu, Z.; Xu, L.; Yang, Y.; et al. Effects of dietary live and heat-inactive baker’s yeast on growth, gut health, and disease resistance of Nile tilapia under high rearing density. Fish Shellfish Immunol. 2016, 56, 263–271. [Google Scholar] [CrossRef] [PubMed]
- Kucharczyk, D.; Kucharczyk, D.J.; Nowosad, J.; Omirzhanova, N. Optimization of artificial insemination outcomes of African catfish (Clarias gariepinus) with differing hatchery conditions. Anim. Reprod. Sci. 2019, 211, 106222. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Latif, H.M.R.; Shukry, M.; Saad, M.F.; Mohamed, N.A.; Nowosad, J.; Kucharczyk, D. Effects of GnRHa and hCG with or without dopamine receptor antagonists on the spawning efficiency of African catfish (Clarias gariepinus) reared in hatchery conditions. Anim. Reprod. Sci. 2021, 31, 106798. [Google Scholar] [CrossRef] [PubMed]
- Sikora, M.; Nowosad, J.; Biegaj, M.; Kucharczyk, D.; Dębowski, M. The possibility of application of agglomerate elastomers (EPP) as media for biological bed in aquaculture. Aquac. Res. 2018, 49, 2988–2994. [Google Scholar] [CrossRef]
- Prusińska, M.; Nowosad, J.; Jarmołowicz, S.; Mikiewicz, M.; Duda, A.; Wiszniewski, G.; Sikora, M.; Biegaj, M.; Samselska, A.; Arciuch-Rutkowska, M.; et al. Effect of feeding barbel larvae (Barbus barbus (L, 1758)) Artemia sp. nauplii enriched with PUFAs on their growth and survival rate, blood composition, alimentary tract histological structure and body chemical composition. Aquac. Rep. 2020, 18, 100492. [Google Scholar] [CrossRef]
- Suratip, N.; Charoenwattanasak, S.; Klahan, R.; Herault, M.; Yuangsoi, B. An investigation into the effects of using protein hydrolysate in low fish meal diets on growth performance, feed utilization and health status of snakehead fish (Channa striata) fingerling. Aquac. Rep. 2023, 30, 101623. [Google Scholar] [CrossRef]
- El-Asely, A.M.; Abbass, A.A.; Austin, B. Honey bee pollen improves growth, immunity and protection of Nile tilapia (Oreochromis niloticus) against infection with Aeromonas hydrophila. Fish Shellfish Immunol. 2014, 40, 500–506. [Google Scholar] [CrossRef] [PubMed]
- Sadoul, B.; Geffroy, B. Measuring cortisol, the major stress hormone in fishes. J. Fish Biol. 2019, 94, 540–555. [Google Scholar] [CrossRef] [PubMed]
- Dulski, T.; Kozłowski, K.; Ciesielski, S. Habitat and seasonality shape the structure of tench (Tinca tinca L.) gut microbiome. Sci. Rep. 2020, 10, 4460. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2016, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Buwono, I.D.; Grandiosa, R.; Mulyani, Y.; Pratiwy, F.M. GnRHr, LHr, and Vg gene expression levels and ovarian development of G5 transgenic mutiara female catfish (Clarias gariepinus) after exposure photoperiod induction. Discov. Appl. Sci. 2024, 6, 63. [Google Scholar] [CrossRef]
- Kari, Z.A.; Kabir, M.A.; Dawood, M.A.O.; Razab, M.K.A.A.; Ariff, N.S.N.A.; Sarkar, T.; Pati, S.; Edinur, H.A.; Mat, K.; Ismail, T.A.; et al. Effect of fish meal substitution with fermented soy pulp on growth performance, digestive enzyme, amino acid profile, and immune-related gene expression of African catfish (Clarias gariepinus). Aquaculture 2022, 546, 737418. [Google Scholar] [CrossRef]
- Nasrullah, H.; Yanti, D.H.; Faridah, N.I.; Hardiantho, D.; Nababan, Y.I.; Sukenda, S.; Alimunddin, A. Early immune gene development and expression in African catfish Clarias gariepinus after challenged with Aeromonas hydrophila. Aquac. Int. 2021, 29, 595–607. [Google Scholar] [CrossRef]
- Swaleh, S.B.; Banday, U.Z.; Asadi, M.-A.; Usmani, N. Biochemical profile and gene expression of Clarias gariepinus as a signature of heavy metal stress. Environ. Pollut. 2020, 264, 114693. [Google Scholar] [CrossRef] [PubMed]
- Chaube, R.; Rawat, A.; Inbaraj, R.M.; Bobe, J.; Guiguen, Y.; Fostier, A.; Joy, K.P. Identification and characterization of a catechol-o-methyltransferase cDNA in the catfish Heteropneustes fossilis: Tissue, sex and seasonal variations, and effects of gonadotropin and 2-hydroxyestradiol-17β on mRNA expression. Gen. Comp. Endocrinol. 2017, 246, 129–141. [Google Scholar] [CrossRef] [PubMed]
- Chaube, R.; Sharma, S.; Senthilkumaran, B.; Bhat, S.G.; Joy, K.P. Expression profile of kisspeptin2 and gonadotropin-releasing hormone2 mRNA during photo-thermal and melatonin treatments in the female air-breathing catfish Heteropneustes fossilis. Fish Physiol. Biochem. 2020, 46, 2403–2419. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Ali, S.E.; Soliman, W.; Abumourad, I.K.M.; Elgendy, M.Y.; Songe, M. Protective Effect of Leek Extract (Allium ampeloprasum L.) on Catfish (Clarias gariepinus) Experimentally Challenged with Aeromonas hydrophila. Pak. J. Biol. Sci. 2021, 24, 199–206. [Google Scholar] [CrossRef] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]









| Growth Parameters | Groups | |||
|---|---|---|---|---|
| C | W1 | W2 | W3 | |
| IW (g) | 258.37 ± 70.86 | |||
| IL (cm) | 30.72 ± 2.60 | |||
| FW (g) | c 674.88 ± 147.44 | b 751.21 ± 161.41 | a 846.29 ± 182.25 | a 840.24 ± 198.51 |
| FL (cm) | c 42.62 ± 2.64 | b 44.03 ± 2.49 | a 45.36 ± 2.81 | a 45.23 ± 2.88 |
| WG (g) | c 416. 51 ± 147.44 | b 492.84 ± 161.41 | a 587.92 ± 182.25 | a 581.87 ± 198.51 |
| LG (cm) | c 11.90 ± 2.64 | b 13.31 ± 2.49 | a 14.64 ± 2.81 | a 14.51 ± 2.88 |
| SGR (%/d) | c 1.88 ± 0.24 | b 1.99 ± 0.22 | a 2.11 ± 0.21 | a 2.10 ± 0.23 |
| K (g/cm3) | b 0.86 ± 0.08 | ab 0.87 ± 0.08 | a 0.90 ± 0.13 | a 0.89 ± 0.08 |
| SR (%) | 99.33 ± 1.15 | 99.33 ± 1.15 | 98.67 ± 1.15 | 99.33 ± 1.15 |
| Groups | Observations | Counts |
|---|---|---|
| C | 73.30 ± 13.76 | 71,891.20 ± 3860.08 |
| W1 | 68.30 ± 13.35 | 80,012.90 ± 2251.85 |
| W2 | 57.10 ± 6.63 | 85,198.20 ± 3295.04 |
| W3 | 60.10 ± 15.34 | 85,028.30 ± 3073.70 |
| Total number of counts taxonomically classified | 3,221,306 | |
| Mean number of counts per sample | 80,532.65 ± 1753.031 | |
| Total number of ASV | 513 | |
| Main Components | Groups | |||
|---|---|---|---|---|
| C | W1 | W2 | W3 | |
| crude protein (%) | 39.05 | |||
| crude fat (%) | 23.33 | |||
| carbohydrates (%) | 18.19 | |||
| crude fiber (%) | 2.70 | |||
| raw ash (%) | 6.19 | |||
| phosphorus (%) | 0.76 | |||
| Active ingredient | ||||
| sodium butyrate (mg/kg) | ND * | 50 | 150 | 50 |
| β- glucan (mg/kg) | ND * | 20 | 20 | 60 |
| vitamin C (mg/kg) | ND * | 30 | 30 | 30 |
| vitamin E (mg/kg) | ND * | 10 | 10 | 10 |
| vitamin K (mg/kg) | ND * | 0.4 | 0.4 | 0.4 |
| vitamin A (IU/kg) | ND * | 1200 | 1200 | 1200 |
| vitamin D3 (IU/kg) | ND * | 800 | 800 | 800 |
| Gene | Primer Sequences | Accession Number | References |
|---|---|---|---|
| β-actin | F: 5′ACCGGAGTCCATCACAATACCAGT 3′ R: 5′GAGCTGCGTGTTGCCCCTGAG 3′ | KJ722167.1 | [95] |
| HSP70 | F: 5′CAAACGCAACACCACTATTCC 3′ R: 5′CATGGCTCTCTCACCTTCATAC 3′ | MH341527.1 | [95] |
| IL-1β | F: 5′TGCAGTGAATCCAAGAGCTACAGC 3′ R: 5′CCACCTTTCAGAGTGAATGCCAGC 3′ | LC013677.1 | [95] |
| TNFα | F: 5′TCTCAGGTCAATACAACCCGC 3′ R: 5′GAGGCCTTTGCGGAAAATCTTG 3′ | KM593875 | [100] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arciuch-Rutkowska, M.; Nowosad, J.; Gil, Ł.; Czarnik, U.; Kucharczyk, D. Synergistic Effect of Dietary Supplementation with Sodium Butyrate, β-Glucan and Vitamins on Growth Performance, Cortisol Level, Intestinal Microbiome and Expression of Immune-Related Genes in Juvenile African Catfish (Clarias gariepinus). Int. J. Mol. Sci. 2024, 25, 4619. https://doi.org/10.3390/ijms25094619
Arciuch-Rutkowska M, Nowosad J, Gil Ł, Czarnik U, Kucharczyk D. Synergistic Effect of Dietary Supplementation with Sodium Butyrate, β-Glucan and Vitamins on Growth Performance, Cortisol Level, Intestinal Microbiome and Expression of Immune-Related Genes in Juvenile African Catfish (Clarias gariepinus). International Journal of Molecular Sciences. 2024; 25(9):4619. https://doi.org/10.3390/ijms25094619
Chicago/Turabian StyleArciuch-Rutkowska, Martyna, Joanna Nowosad, Łukasz Gil, Urszula Czarnik, and Dariusz Kucharczyk. 2024. "Synergistic Effect of Dietary Supplementation with Sodium Butyrate, β-Glucan and Vitamins on Growth Performance, Cortisol Level, Intestinal Microbiome and Expression of Immune-Related Genes in Juvenile African Catfish (Clarias gariepinus)" International Journal of Molecular Sciences 25, no. 9: 4619. https://doi.org/10.3390/ijms25094619
APA StyleArciuch-Rutkowska, M., Nowosad, J., Gil, Ł., Czarnik, U., & Kucharczyk, D. (2024). Synergistic Effect of Dietary Supplementation with Sodium Butyrate, β-Glucan and Vitamins on Growth Performance, Cortisol Level, Intestinal Microbiome and Expression of Immune-Related Genes in Juvenile African Catfish (Clarias gariepinus). International Journal of Molecular Sciences, 25(9), 4619. https://doi.org/10.3390/ijms25094619

