Evolution of a Human-Specific De Novo Open Reading Frame and Its Linked Transcriptional Silencer
Abstract
1. Introduction
2. Results
2.1. Characterization of the Human SMIM45 Gene
2.2. Ultra-Conservation of 68 aa ORF
2.3. Evolution of the Transcriptional Silencer
2.4. 107 aa ORF, Detection of an Early Developmental Sequence
2.5. Evolutionary Development of the 107 aa ORF during Primate Evolution
2.6. Search for Evolutionary Root Species of the 107 aa ORF
3. Discussion
4. Materials and Methods
4.1. Protocol for Finding the Evolutionary Early Developmental Stage of the 107 aa ORF
- The genomic region of the mouse SMIM45 that contains the 68 aa ORF displays synteny with the genomic region containing the human 107 aa ORF nt sequence. This serves as a guidepost for locating genomic nt sequences that are homologous to the human 107 aa nt sequence in the mouse and other species. By aligning the SMIM45 gene sequence from the mouse and other species with the sequences of human SMIM45 exon 2 and the human 107 aa mRNA, the mouse SMIM45 region that has homology with the human 107 aa mRNA is determined. The EMBL-EBI Clustal Omega alignment program (https://www.ebi.ac.uk/Tools/msa/clustalo/, accessed on 26 February 2024) is used for nt and aa sequence alignments. When studying a human gene that is not annotated in an ancestral species, the entire genomic sequence between two flanking genes that display synteny can be analyzed for similarities with the gene nt sequence. This is described below for SMIM45. Adjacent evolutionary conserved sequences are important to use as guideposts. With other genes, highly conserved enhancer sequences, when found adjacent to or within the gene being analyzed, can also be useful as a guidepost in locating a homologous sequence in an ancestor. For SMIM45, SEPTIN3 served as the consistent guidepost.
- A segment of the mouse SMIM45 nt sequence that produces a stretch of similarity to the human 107 aa mRNA is used to translate the nt sequence using the Expasy translation tool. One of the resulting aa sequences from the three translated 5′3′ Frames is found to contain the early developmental sequence. Thus, by aligning the translated three 5′3′ Frame sequences from the mouse or primate species with the human 107 aa ORF aa sequence, the early developmental aa sequence homologous to the human 107 aa sequence is obtained.
- For primates, as the growing aa sequence evolves during evolution of the ORF, the 5′3′ Frame aa alignments can be used identify additional aas that have an identity with the 107 aa sequence. With the mouse genomic sequence, only random identities are found outside of the early developmental aa sequence.
- For species that do not have the SMIM45 gene annotated (e.g., the tarsier), the SMIM45 sequence was determined by analyzing the DNA sequence between the two genes that show synteny, SEPTIN3 and CENPM. Nt sequences of the genomic regions are then aligned with the 68 aa sequence. This gave an accurate location of the homologous 107 aa nt sequence and/or the early embryonic sequence in these species.
- To assess possible species that may represent root origins of the 107 aa ORF, entire SMIM45 gene sequences from various species were aligned with the nt sequences of the 68 aa, 107 aa, and the human early developmental sequence SGLELVRVCGGGMQRDKT. Genomes of ancestral species that show no identity to the early developmental sequence and species that show a marginal but significant similarity are considered candidates for root origins. Synteny with the 68 aa sequence served as a guide in pinpointing sequences that are homologous to the early developmental sequence.
Species Analyzed for 68 aa and/or 107 aa ORFs
4.2. Source and Properties of Gene and Transcript Sequences
- 1 ccaaggccgc cgcgatgccg cacttcctgg actggttcgt gccggtctac ttggtcatct
- 61 cggtcctcat tctggtgggc ttcggcgcct gcatctacta cttcgagccg ggcctgcagg
- 121 aggcgcacaa gtggcgcatg cagcgccccc tggtggaccg cgacctccgc aagacgctaa
- 181 tggtgcgcga caacctggcc ttcggcggcc cggaggtctg agccgacttg caaaggggat
- 241 aggcgggcgg caccgggcgc cctcccccag cccgccccgc ccgcccagcc cggagacccc
- 301 caaggcagag ggaggccggc ctgttggccc tccacgctat ccctctgcag cctgggccct
- 361 cccgacagag gccccaggtg cgctggcagt ggaggtgggg cacttaggtg cctggctggc
- 421 ccagggcttg ctctccgtgt caagccgact cacccagagc ccaccctccc aagctcaggg
- 481 gcatcctccg ctgggcccca gtgcctttgc gctgcgcagc actctgccct ccactggact
- 541 caggcatgtc tatggctgcc tgtcctgagg ctccggagcc ctcatttctt cgtgaagtcc
- 601 ccagctcccc tgcctccact caatggcacc ggccctgcaa ctttaggcag gtcgaagcca
- 661 acccaaggaa agaacctaag aacctcgttt ggagggatgt cagcttgggc cagaccagcc
- 721 gcaccccgcg gggctcaggc ttggaactgg tgagggtgtg tggtgggggt atgcagaggg
- 781 ataagaccgt ggtagaggag agggttggtg aggagagaga gagagagaga gagagagtct
- 841 ggggggagcg ggcaagcatg gggagatgag atgtgtatat gtgagagaga gtgtgggggc
- 901 cccaggcagg gcaggaggtg gtggaaacgg ggtgaactcc gtgggctgtg tgaggactgt
- 961 ccatagtggg tcccaacccc ctccctctgc tggagtttcc tagcccttcc ccctccccaa
- 1021 gactgtggca gcaggcagga gcccctgccc tccctccctg tcctgtgcca cacttctggg
- 1081 gccaaaccca gcccccttga gccaggccct gccagactcc aagcccaccc tagaaccctc
- 1141 ctcctgtgtg gagactctgt tgccccactt tggacacaga ttggcaacct gcctcacccc
- 1201 gccccccttc gctggggctt ccatcttaat ttattctcaa taataaagac ttcatgatga
- 1261 tctctgca
- 68 aa mRNA
- 1 atgccgcact tcctggactg gttcgtgccg gtctacttgg tcatctcggt cctcattctg
- 61 gtgggcttcg gcgcctgcat ctactacttc gagccgggcc tgcaggaggc gcacaagtgg
- 121 cgcatgcagc gccccctggt ggaccgcgac ctccgcaaga cgctaatggt gcgcgacaac
- 181 ctggccttcg gcggcccgga ggtctga
- 107 aa mRNA
- 1 atgtctatgg ctgcctgtcc tgaggctccg gagccctcat ttcttcgtga agtccccagc
- 61 tcccctgcct ccactcaatg gcaccggccc tgcaacttta ggcaggtcga agccaaccca
- 121 aggaaagaac ctaagaacct cgtttggagg gatgtcagct tgggccagcc cagccgcacc
- 181 ccgcggggct caggcttgga actggtgagg gtgtgtggtg ggggtatgca gagggataag
- 241 accgtggtag aggagagggt tggtgaggag agagagagag agagagagag agtctggggg
- 301 gagcgggcaa gcatggggag atga
- 1 gccgacttgc aaaggggata ggcgggcggc accgggcgcc ctcccccagc ccgccccgcc
- 61 cgcccagccc ggagaccccc aaggcagagg gaggccggcc tgttggccct ccacgctatc
- 121 cctctgcagc ctgggccctc ccgacagagg ccccaggtgc gctggcagtg gaggtggggc
- 181 acttaggtgc ctggctggcc cagggcttgc tctccgtgtc aagccgactc acccagagcc
- 241 caccctccca agctcagggg catcctccgc tgggccccag tgcctttgcg ctgcgcagca
- 301 ctctgccctc cactggactc aggc
- 1 tgcgcgacaa cctggccttc ggcggcccgg aggtctgagc cgacttgcaa aggggatagg
- 61 cgggcggcac cgggcgccct cccccagccc gccccgcccg cccagcccgg agacccccaa
- 121 ggcagaggga ggccggcctg ttggccctcc acgctatccc tctgcagcct gggccctccc
- 181 gacagaggcc ccaggtgcgc tggcagtgga ggtggggcac ttaggtgcct
- 1 ctctgatggg cagggagaga taccagggtg ctgagccagt ccaggactgc cccctcctgg
- 61 cccactcaga gcccctgggt gtgagaagct cgtctcccgt gggttgcatt ggctctgccc
- 121 tatctctgcc tccagcaccc agggcggccg cagatggcag tgtctctggg gacagcagct
- 181 gcgaatgagt ccacgggcca atgctgagct gctcaggctg aggcggtgtg ctcagcacag
- 241 agcccccgga actggcatct gcagggcgtg agccaaggcc gccgcgatgc cgcacttcct
- 301 ggactggttc gtgccggtct acttggtcat ctcggtcctc attctggtgg gcttcggcgc
- 361 ctgcatctac tacttcgagc cgggcctgca ggaggcgcac aagtggcgca tgcagcgccc
- 421 cctggtggac cgcgacctcc gcaagacgct aatggtgcgc gacaacctgg ccttcggcgg
- 481 cccggaggtc tgagccgact tgcaaagggg ataggcgggc ggcaccgggc gccctccccc
- 541 agcccgcccc gcccgcccag cccggagacc cccaaggcag agggaggccg gcctgttggc
- 601 cctccacgct atccctctgc agcctgggcc ctcccgacag aggccccagg tgcgctggca
- 661 gtggaggtgg ggcacttagg tgcctggctg gcccagggct tgctctccgt gtcaagccga
- 721 ctcacccaga gcccaccctc ccaagctcag gggcatcctc cgctgggccc cagtgccttt
- 781 gcgctgcgca gcactctgcc ctccactgga ctcaggcatg tctatggctg cctgtcctga
- 841 ggctccggag ccctcatttc ttcgtgaagt ccccagctcc cctgcctcca ctcaatggca
- 901 ccggccctgc aactttaggc aggtcgaagc caacccaagg aaagaaccta agaacctcgt
- 961 ttggagggat gtcagcttgg gccagaccag ccgcaccccg cggggctcag gcttggaact
- 1021 ggtgagggtg tgtggtgggg gtatgcagag ggataagacc gtggtagagg agagggttgg
- 1081 tgaggagaga gagagagaga gagagagagt ctggggggag cgggcaagca tggggagatg
- 1141 agatgtgtat atgtgagaga gagtgtgggg gccccaggca gggcaggagg tggtggaaac
- 1201 ggggtgaact ccgtgggctg tgtgaggact gtccatagtg ggtcccaacc ccctccctct
- 1261 gctggagttt cctagccctt ccccctcccc aagactgtgg cagcaggcag gagcccctgc
- 1321 cctccctccc tgtcctgtgc cacacttctg gggccaaacc cagccccctt gagccaggcc
- 1381 ctgccagact ccaagcccac cctagaaccc tcctcctgtg tggagactct gttgccccac
- 1441 tttggacaca gattggcaac ctgcctcacc ccgcccccct tcgctggggc ttccatctta
- 1501 atttattctc aataataaag acttcatgat gatctctgca
- tcaggcttggaactggtgagggtgtgtggtgggggtatgcagagggataagacc
4.3. Expect Value (E)
4.4. Source of Evolutionary Divergent Age of Species
4.5. Nucleotide and Amino acid Sequence Alignment and Translation Tools
5. Conclusions
Supplementary Materials
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Benson, D.A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2013, 41, D36–D42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Segert, J.A.; Gisselbrecht, S.S.; Bulyk, M.L. Transcriptional Silencers: Driving Gene Expression with the Brakes On. Trends Genet. 2021, 37, 514–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fagerberg, L.; Hallström, B.M.; Oksvold, P.; Kampf, C.; Djureinovic, D.; Odeberg, J.; Habuka, M.; Tahmasebpoor, S.; Danielsson, A.; Edlund, K.; et al. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol. Cell. Proteomics. 2014, 2, 397–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sayers, E.W.; Cavanaugh, M.; Clark, K.; Pruitt, K.D.; Conrad, L.; Schoch, C.L.; Sherry, S.T.; Karsch-Mizrachi, I. GenBank. Nucleic Acids Res. 2022, 50, D161–D164. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.Y.; Shen, Q.S.; Zhou, W.Z.; Peng, J.; He, B.Z.; Li, Y.; Liu, C.J.; Luan, X.; Ding, W.; Li, S.; et al. Emergence, Retention and Selection: A Trilogy of Origination for Functional De Novo Proteins from Ancestral LncRNAs in Primates. PLoS Genet. 2015, 11, e1005391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, N.A.; Zhang, J.; Mo, F.; Luan, X.; Tian, L.; Shen, Q.S.; Li, X.; Li, C.; Zhou, F.; Zhang, B.; et al. De novo genes with an lncRNA origin encode unique human brain developmental functionality. Nat. Ecol. Evol. 2023, 7, 264–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohno, S. The role of gene duplication in vertebrate evolution. In The Biological Basis of Medicine; Bittar, E.D., Bittar, N., Eds.; Academic Press: London, UK, 1969; Chapter 4; Volume 4, pp. 109–132. [Google Scholar]
- Long MBetrán, E.; Thornton, K.; Wang, W. The origin of new genes: Glimpses from the young and old. Nat. Rev. Genet. 2003, 4, 865–875. [Google Scholar] [CrossRef] [Scilit]
- Levine, M.T.; Jones, C.D.; Kern, A.D.; Lindfors, H.A.; Begun, D.J. Novel genes derived from noncoding DNA in Drosophila melanogaster are frequently X-linked and exhibit testis-biased expression. Proc. Natl. Acad. Sci. USA 2006, 103, 9935–9939. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Q.; Wang, W. On the origin and evolution of new genes—A genomic and experimental perspective. J. Genet. Genom. 2008, 35, 639–648. [Google Scholar] [CrossRef] [Scilit]
- Carvunis, A.R.; Rolland, T.; Wapinski, I.; Calderwood, M.A.; Yildirim, M.A.; Simonis, N.; Charloteaux, B.; Hidalgo, C.A.; Barbette, J.; Santhanam, B. Proto-genes and de novo gene birth. Nature 2012, 487, 370–374. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.D.; Zhang, Y.P. Evolution and function of de novo originated genes. Mol. Phylogenet. Evol. 2013, 67, 541–545. [Google Scholar] [CrossRef] [Scilit]
- Tautz, D. The discovery of de novo gene evolution. Perspect. Biol. Med. 2014, 57, 149–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schlötterer, C. Genes from scratch—The evolutionary fate of de novo genes. Trends Genet. 2015, 31, 215–219. [Google Scholar] [CrossRef] [Scilit]
- Schmitz, J.F.; Bornberg-Bauer, E. Fact or fiction: Updates on how protein-coding genes might emerge de novo from previously non-coding. Version 1. F1000Research 2017, 6, 57. [Google Scholar] [CrossRef] [Scilit]
- Van Oss, S.B.; Carvunis, A.R. De novo gene birth. PLoS Genet. R 2019, 15, e1008160. [Google Scholar] [CrossRef] [Scilit]
- Vakirlis, N.; Acar, O.; Hsu, B.; Castilho Coelho, N.; Van Oss, S.B.; Wacholder, A.; Medetgul-Ernar, K.; Bowman, R.W., 2nd; Hines, C.P.; Iannotta, J. De novo emergence of adaptive membrane proteins from thymine-rich genomic sequences. Nat. Commun. 2020, 11, 781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Broeils, L.A.; Ruiz-Orera, J.; Snel, B.; Hubner, N.; van Heesch, S. Evolution and implications of de novo genes in humans. Nat. Ecol. Evol. 2023, 7, 804–815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vakirlis, N.; Vance, Z.; Kate, M.; Duggan, K.M.; McLysaght, A. De novo birth of functional microproteins in the human lineage. Cell Rep. 2022, 4, 111808. [Google Scholar] [CrossRef] [Scilit]
- Pang, B.; Snyder, M.P. Systematic identification of silencers in human cells. Nat. Genet. 2020, 52, 254–263. [Google Scholar] [CrossRef] [Scilit]
- Song, A.; Patel, A.; Thamatrakoln, K.; Liu, C.; Feng, D.; Clayberger, C.; Krensky, A.M. Functional domains and DNA-binding sequences of RFLAT-1/KLF13, a Krüppel-like transcription factor of activated T lymphocytes. J. Biol. Chem. 2002, 277, 30055–30065. [Google Scholar] [CrossRef] [Scilit]
- Ahituv, N. Exonic enhancers: Proceed with caution in exome and genome sequencing studies. Genome Med. 2016, 8, 14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doolittle, R.F. Similar amino acid sequences: Chance or common ancestry? Science 1981, 214, 149–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chung, S.Y.; Subbiah, S. A structural explanation for the twilight zone of protein sequence homology. Structure 1996, 4, 1123–1127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishihara, H.; Satta, Y.; Nikaido, M.; Thewissen, J.G.; Stanhope, M.J.; Okada, N. A retroposon analysis of Afrotherian phylogeny. Mol. Biol. Evol. 2005, 22, 1823–1833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levinson, G.; Gutman, G.A. Slipped-strand mispairing: A major mechanism for DNA sequence evolution. Mol. Biol. Evol. 1987, 4, 203–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hallgren, J.; Tsirigos, K.D.; Pedersen, M.D.; Almagro Armenteros, J.J.; Marcatili, P.; Nielsen, H.; Krogh, A.; Winther, O. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. bioRxiv 2022, 2022, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Choi, S.W.; Kim, H.W.; Nam, J.W. The small peptide world in long noncoding RNAs. Brief Bioinform. 2019, 20, 1853–1864. [Google Scholar] [CrossRef] [Scilit]
- Doni Jayavelu, N.; Jajodia, A.; Mishra, A.; Hawkins, R.D. Candidate silencer elements for the human and mouse genomes. Nat. Commun. 2020, 11, 1061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gisselbrecht, S.S.; Palagi, A.; Kurland, J.V.; Rogers, J.M.; Ozadam, H.; Zhan, Y.; Dekker, J.; Bulyk, M.L. Transcriptional Silencers in Drosophila Serve a Dual Role as Transcriptional Enhancers in Alternate Cellular Contexts. Mol. Cell. 2020, 77, 324–337.e8. [Google Scholar] [CrossRef] [Scilit]
- Pang, B.; van Weerd, J.H.; Hamoen, F.L.; Snyder, M.P. Identification of non-coding silencer elements and their regulation of gene expression. Nat. Rev. Mol. Cell Biol. 2023, 24, 383–395. [Google Scholar] [CrossRef] [Scilit]
- Sepp, M.; Leiss, K.; Murat, F.; Okonechnikov, K.; Joshi, P.; Leushkin, E.; Spänig, L.; Mbengue, N.; Schneider, C.; Schmidt, J.; et al. Cellular development and evolution of the mammalian cerebellum. Nature 2024, 625, 788–796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, F.J.; Amode, M.R.; Aneja, A.; Austine-Orimoloye, O.; Azov, A.G.; Barnes, I.F.; Becker, A.; Bennett, R.; Berry, A.; Jyothish Bhain, I.; et al. Ensembl 2023. Nucleic Acids Res. 2023, 51, D933–D941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rost, B. Twilight zone of protein sequence alignments. Protein Eng. 1999, 12, 85–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shao, Y.; Zhou, L.; Li, F.; Zhao, L.; Zhang, B.L.; Shao, F.; Chen, J.W.; Chen, C.Y.; Bi, X.; Zhuang, X.L.; et al. Phylogenomic analyses provide insights into primate evolution. Science 2023, 380, 913–924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuderna, L.F.K.; Gao, H.; Janiak, M.C.; Kuhlwilm, M.; Orkin, J.D.; Bataillon, T.; Manu, S.; Valenzuela, A.; Bergman, J.; Rousselle, M.; et al. A global catalog of whole-genome diversity from 233 primate species. Science 2023, 380, 906–913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siepel, A. Phylogenomics of primates and their ancestral populations. Genome Res. 2009, 19, 1929–1941. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.J.; Blackburn, D.C.; Liang, D.; Hillis, D.M.; Wake, D.B.; Cannatella, D.C.; Zhang, P. Phylogenomics reveals rapid, simultaneous diversification of three major clades of Gondwanan frogs at the Cretaceous-Paleogene boundary. Proc. Natl. Acad. Sci. USA 2017, 114, E5864–E5870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.E.; Vibranovski, M.D.; Landback, P.; Marais, G.A.; Long, M. Chromosomal redistribution of male-biased genes in mammalian evolution with two bursts of gene gain on the X chromosome. PLoS Biol. 2010, 8, e1000494. [Google Scholar] [CrossRef] [PubMed]
- Phillips, M.J.; Fruciano, C. The soft explosive model of placental mammal evolution. BMC Evol. Biol. 2018, 18, 104. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Suleski, M.; Craig, J.E.; Kasprowicz, A.E.; Sanderford, M.; Li, M.; Stecher, G.; Hedges, S.B. TimeTree 5: An Expanded Resource for Species Divergence Times. Mol. Biol. Evol. 2022, 39, msac174. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Madeira, F.; Pearce, M.; Tivey, A.R.N.; Basutkar, P.; Lee, J.; Edbali, O.; Madhusoodanan, N.; Kolesnikov, A.; Lopez, R. Search and sequence analysis tools services from EMBL-EBI in 2022. Nucleic Acids Res. 2022, 50, W276–W279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 3, 3784–3788. [Google Scholar] [CrossRef] [Scilit]
- Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 2000, 28, 1102–1104. [Google Scholar] [CrossRef] [Scilit]









| Species | MYA Age of Divergence from Common Ancestor | Expect | Percent Identity | bp Positions Showing Identity with Silencer2 |
|---|---|---|---|---|
| Cape elephant shrew | 99 | no significant similarity | ||
| Cape golden mole | 99 | 3 × 10−13 | 78 | 59–131 |
| Lesser Hedgehog | 99 | 6 × 10−5 | 73 | 56–100 |
| Aardvark | 99 | 4 × 10−8 | 75 | 64–131 |
| Elephant | 99 | 8 × 10−5 | 67 | 35–131 |
| Shrew | 94 | 5 × 10−7 | 86 | 108–136 |
| Cat | 94 | 1 × 10−15 | 73 | 28–151 |
| Squirrel | 87 | 1 × 10−21 | 74 | 54–182 |
| Tree shrew | 85 | 2 × 10−13 | 77 | 71–152 |
| Lemur catta | 61 | 2 × 10−25 | 71 | 21–190 |
| Marmoset | 43 | 2 × 10−40 | 84 | 1–165 |
| Rhesus | 31 | 2 × 10−70 | 88 | 1–192 |
| Orangutan | 20 | 2 × 10−75 | 92 | 1–192 |
| Chimpanzee | 6 | 3 × 10−103 | 100 | 1–192 |
| Human | 6 | 3 × 10−103 | 100 | 1–192 |
| Early Developmental Sequence | Species | % Identity | Evolutionary Age |
|---|---|---|---|
| SGLE*VTVYGGGVQKGKT | Mouse | 70.5 | 87 MYA |
| *GLELLRAYVGGVQRGCT | Tree shrew | 58.82 | 68 MYA |
| SGLELVRVCGGGAQRGET | Lemur | 83.33 | 61 MYA |
| SGLEIMRLCSRDRADGS | Tarsier | 35.29 | 58 MYA |
| SGLELVRVCGGGVQKGKT | Rhesus | 83.33 | 31 MYA |
| SGLELVRVCGGGMQRDKT | Tibetan macaque | 100.00 | 31 MYA |
| SGLELVRVCGGGMQRDKT | Baboon | 100.00 | 31 MYA |
| SGLELVRVCGGGMQRGKT | Orangutan | 100.00 | 20 MYA |
| SGLELVRVWWGYAEG*DR | Gorilla | 52.9 | 10 MYA |
| SGLELVRVCGGGMQRDKT | Chimpanzee | 100.00 | 6 MYA |
| SGLELVRVCGGGMQRDKT | Human | 100.00 | 6 MYA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Delihas, N. Evolution of a Human-Specific De Novo Open Reading Frame and Its Linked Transcriptional Silencer. Int. J. Mol. Sci. 2024, 25, 3924. https://doi.org/10.3390/ijms25073924
Delihas N. Evolution of a Human-Specific De Novo Open Reading Frame and Its Linked Transcriptional Silencer. International Journal of Molecular Sciences. 2024; 25(7):3924. https://doi.org/10.3390/ijms25073924
Chicago/Turabian StyleDelihas, Nicholas. 2024. "Evolution of a Human-Specific De Novo Open Reading Frame and Its Linked Transcriptional Silencer" International Journal of Molecular Sciences 25, no. 7: 3924. https://doi.org/10.3390/ijms25073924
APA StyleDelihas, N. (2024). Evolution of a Human-Specific De Novo Open Reading Frame and Its Linked Transcriptional Silencer. International Journal of Molecular Sciences, 25(7), 3924. https://doi.org/10.3390/ijms25073924
