The Cellular Respiration of Endometrial Biopsies from Patients with Various Forms of Endometriosis
Abstract
1. Introduction
2. Results
2.1. The OXPHOS Level in Endometrial Biopsies
2.2. Gene Expression of the Main Complexes, Involving in the OXPHOS and Glycolysis
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Estimation of the Oxygen Consumption Rate by the Polarography
4.3. Estimation of the Relative mRNA Content by qRT-PCR
4.4. Statistical Analysis
5. Conclusions
Limitations of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Koninckx, P.R.; Ussia, A.; Adamyan, L.; Wattiez, A.; Gomel, V.; Martin, D.C. Pathogenesis of endometriosis: The genetic/epigenetic theory. Fertil. Steril. 2019, 111, 327–340. [Google Scholar] [CrossRef]
- Flieder, D.B.; Moran, C.A.; Travis, W.D.; Koss, M.N.; Mark, E.J. Pleuro-pulmonary endometriosis and pulmonary ectopic deciduosis: A clinicopathologic and immunohistochemical study of 10 cases with emphasis on diagnostic pitfalls. Hum. Pathol. 1998, 29, 1495–1503. [Google Scholar] [CrossRef]
- Alzayer, H. Pulmonary endometriosis: A rare cause of hydropneumothorax. Respirol. Case Rep. 2019, 7, e432. [Google Scholar] [CrossRef] [PubMed]
- Oner, A.; Karakucuk, S.; Serin, S. Nasolacrimal endometriosis. A case report. Ophthalmic Res. 2006, 38, 313–314. [Google Scholar] [CrossRef] [PubMed]
- Türkçüoğlu, I.; Türkçüoğlu, P.; Kurt, J.; Yildirim, H. Presumed nasolacrimal endometriosis. Ophthalmic Plast. Reconstr. Surg. 2008, 24, 47–48. [Google Scholar] [CrossRef]
- Signorile, P.G.; Viceconte, R.; Baldi, A. New Insights in Pathogenesis of Endometriosis. Front. Med. 2022, 9, 879015. [Google Scholar] [CrossRef]
- Giudice, L.C.; Kao, L.C. Endometriosis. Lancet 2004, 364, 1789–1799. [Google Scholar] [CrossRef]
- Bulun, S.E. Endometriosis. N. Engl. J. Med. 2009, 360, 268–279. [Google Scholar] [CrossRef] [PubMed]
- Li, J.J.; Duan, H.; Wang, S.; Sun, F.Q.; Gan, L.; Tang, Y.Q.; Xu, Q.; Li, T.C. Expression Pattern of G-Protein-Coupled Estrogen Receptor in Myometrium of Uteri with and without Adenomyosis. BioMed Res. Int. 2017, 2017, 5974693. [Google Scholar] [CrossRef]
- Yilmaz, B.D.; Bulun, S.E. Endometriosis and nuclear receptors. Hum. Reprod. Update 2019, 25, 473–485. [Google Scholar] [CrossRef]
- Vazquez-Martinez, E.R.; Bello-Alvarez, C.; Hermenegildo-Molina, A.L.; Solis-Paredes, M.; Parra-Hernandez, S.; Cruz-Orozco, O.; Silvestri-Tomassoni, J.R.; Escobar-Ponce, L.F.; Hernandez-Lopez, L.A.; Reyes-Mayoral, C.; et al. Expression of Membrane Progesterone Receptors in Eutopic and Ectopic Endometrium of Women with Endometriosis. BioMed Res. Int. 2020, 2020, 2196024. [Google Scholar] [CrossRef]
- Stephens, V.R.; Rumph, J.T.; Ameli, S.; Bruner-Tran, K.L.; Osteen, K.G. The Potential Relationship Between Environmental Endocrine Disruptor Exposure and the Development of Endometriosis and Adenomyosis. Front. Physiol. 2022, 12, 807685. [Google Scholar] [CrossRef]
- Signorile, P.G.; Baldi, F.; Bussani, R.; D’Armiento, M.; De Falco, M.; Baldi, A. Ectopic endometrium in human foetuses is a common event and sustains the theory of müllerianosis in the pathogenesis of endometriosis, a disease that predisposes to cancer. J. Exp. Clin. Cancer Res. 2009, 28, 49. [Google Scholar] [CrossRef]
- Signorile, P.G.; Baldi, F.; Bussani, R.; D’Armiento, M.; De Falco, M.; Boccellino, M.; Quagliuolo, L.; Baldi, A. New evidence of the presence of endometriosis in the human fetus. Reprod. Biomed. Online 2010, 21, 142–147. [Google Scholar] [CrossRef]
- Signorile, P.G.; Baldi, F.; Bussani, R.; Viceconte, R.; Bulzomi, P.; D’Armiento, M.; D’Avino, A.; Baldi, A. Embryologic origin of endometriosis: Analysis of 101 human female fetuses. J. Cell Physiol. 2012, 227, 1653–1656. [Google Scholar] [CrossRef] [PubMed]
- Laganà, A.S.; Vitale, S.G.; Salmeri, F.M.; Triolo, O.; Ban Frangež, H.; Vrtačnik-Bokal, E.; Stojanovska, L.; Apostolopoulos, V.; Granese, R.; Sofo, V. Unus pro omnibus, omnes pro uno: A novel, evidence-based, unifying theory for the pathogenesis of endometriosis. Med. Hypotheses 2017, 103, 10–20. [Google Scholar] [CrossRef]
- Frankowska, K.; Dymanowska-Dyjak, I.; Abramiuk, M.; Polak, G. The Efficacy and Safety of Transvaginal Ethanol Sclerotherapy in the Treatment of Endometrial Cysts-A Systematic Review. Int. J. Mol. Sci. 2024, 25, 1337. [Google Scholar] [CrossRef]
- Agostini, A.; De Lapparent, T.; Collette, E.; Capelle, M.; Cravello, L.; Blanc, B. In situ methotrexate injection for treatment of recurrent endometriotic cysts. Eur. J. Obstet. Gynecol. Reprod. Biol. 2007, 130, 129–131. [Google Scholar] [CrossRef] [PubMed]
- Fisch, J.D.; Sher, G. Sclerotherapy with 5% tetracycline is a simple alternative to potentially complex surgical treatment of ovarian endometriomas before in vitro fertilization. Fertil. Steril. 2004, 82, 437–441. [Google Scholar] [CrossRef] [PubMed]
- Gatta, G.; Parlato, V.; Di Grezia, G.; Porto, A.; Cappabianca, S.; Grassi, R.; Rotondo, A. Ultrasound-guided aspiration and ethanol sclerotherapy for treating endometrial cysts. Radiol. Med. 2010, 115, 1330–1339. [Google Scholar] [CrossRef]
- Kim, G.H.; Kim, P.H.; Shin, J.H.; Nam, I.C.; Chu, H.H.; Ko, H.K. Ultrasound-guided sclerotherapy for the treatment of ovarian endometrioma: An updated systematic review and meta-analysis. Eur. Radiol. 2022, 32, 1726–1737. [Google Scholar] [CrossRef] [PubMed]
- Schrager, S.; Yogendran, L.; Marquez, C.M.; Sadowski, E.A. Adenomyosis: Diagnosis and Management. Am. Fam. Physician 2022, 105, 33–38. [Google Scholar]
- Etrusco, A.; Barra, F.; Chiantera, V.; Ferrero, S.; Bogliolo, S.; Evangelisti, G.; Oral, E.; Pastore, M.; Izzotti, A.; Venezia, R.; et al. Current Medical Therapy for Adenomyosis: From Bench to Bedside. Drugs 2023, 83, 1595–1611. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, H.; Shigetomi, H.; Imanaka, S. Nonhormonal therapy for endometriosis based on energy metabolism regulation. Reprod. Fertil. 2021, 2, C42–C57. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.H.; Hsiao, K.Y.; Tsai, S.J. Hypoxia: The force of endometriosis. J. Obstet. Gynaecol. Res. 2019, 45, 532–541. [Google Scholar] [CrossRef] [PubMed]
- Atkins, H.M.; Bharadwaj, M.S.; O’Brien Cox, A.; Furdui, C.M.; Appt, S.E.; Caudell, D.L. Endometrium and endometriosis tissue mitochondrial energy metabolism in a nonhuman primate model. Reprod. Biol. Endocrinol. 2019, 17, 70. [Google Scholar] [CrossRef] [PubMed]
- Horne, A.W.; Ahmad, S.F.; Carter, R.; Simitsidellis, I.; Greaves, E.; Hogg, C.; Morton, N.M.; Saunders, P.T.K. Repurposing dichloroacetate for the treatment of women with endometriosis. Proc. Natl. Acad. Sci. USA 2019, 116, 25389–25391. [Google Scholar] [CrossRef] [PubMed]
- Monsivais, D.; Dyson, M.T.; Yin, P.; Coon, J.S.; Navarro, A.; Feng, G.; Malpani, S.S.; Ono, M.; Ercan, C.M.; Wei, J.J.; et al. ERβ- and prostaglandin E2-regulated pathways integrate cell proliferation via Ras-like and estrogen-regulated growth inhibitor in endometriosis. Mol. Endocrinol. 2014, 28, 1304–1315. [Google Scholar] [CrossRef] [PubMed]
- Monsivais, D.; Dyson, M.T.; Yin, P.; Navarro, A.; Coon, J.S.T.; Pavone, M.E.; Bulun, S.E. Estrogen receptor β regulates endometriotic cell survival through serum and glucocorticoid-regulated kinase activation. Fertil. Steril. 2016, 105, 1266–1273. [Google Scholar] [CrossRef]
- Li, J.; Yanyan, M.; Mu, L.; Chen, X.; Zheng, W. The expression of Bcl-2 in adenomyosis and its effect on proliferation, migration, and apoptosis of endometrial stromal cells. Pathol. Res. Pract. 2019, 215, 152477. [Google Scholar] [CrossRef]
- Brunelle, J.K.; Letai, A. Control of mitochondrial apoptosis by the Bcl-2 family. J. Cell Sci. 2009, 122, 437–441. [Google Scholar] [CrossRef]
- Kagan, V.E.; Borisenko, G.G.; Tyurina, Y.Y.; Tyurin, V.A.; Jiang, J.; Potapovich, A.I.; Kini, V.; Amoscato, A.A.; Fujii, Y. Oxidative lipidomics of apoptosis: Redox catalytic interactions of cytochrome c with cardiolipin and phosphatidylserine. Free Radic. Biol. Med. 2004, 37, 1963–1985. [Google Scholar] [CrossRef]
- Lambert, A.J.; Brand, M.D. Reactive oxygen species production by mitochondria. Methods Mol. Biol. 2009, 554, 165–181. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; He, L.; Liu, Y.; Shi, Y.; Du, H. The expression and role of oxidative stress markers in the serum and follicular fluid of patients with endometriosis. Clin. Exp. Obstet. Gynecol. 2013, 40, 372–376. [Google Scholar]
- Bamm, V.V.; Henein, M.E.L.; Sproul, S.L.J.; Lanthier, D.K.; Harauz, G. Potential role of ferric hemoglobin in MS pathogenesis: Effects of oxidative stress and extracellular methemoglobin or its degradation products on myelin components. Free Radic. Biol. Med. 2017, 112, 494–503. [Google Scholar] [CrossRef]
- Toniyan, K.A.; Gorbacheva, E.Y.; Golubkova, M.A.; Povorova, V.V.; Boyarintsev, V.V.; Ogneva, I.V. Cytochrome-c-oxidase and ATP synthase content increases in the endometrium of the patients with adenomyosis. Mol. Biol. Rep. 2023, 50, 3919–3925. [Google Scholar] [CrossRef]
- Kapur, A.; Ayuso, J.M.; Rehman, S.; Kumari, S.; Felder, M.; Stenerson, Z.; Skala, M.C.; Beebe, D.; Barroilhet, L.; Patankar, M.S. Oxidative phosphorylation inhibitors inhibit proliferation of endometriosis cells. Reproduction 2023, 165, 617–628. [Google Scholar] [CrossRef]
- Lamceva, J.; Uljanovs, R.; Strumfa, I. The Main Theories on the Pathogenesis of Endometriosis. Int. J. Mol. Sci. 2023, 24, 4254. [Google Scholar] [CrossRef]
- Kobayashi, H.; Kimura, M.; Maruyama, S.; Nagayasu, M.; Imanaka, S. Revisiting estrogen-dependent signaling pathways in endometriosis: Potential targets for non-hormonal therapeutics. Eur. J. Obstet. Gynecol. Reprod. Biol. 2021, 258, 103–110. [Google Scholar] [CrossRef]
- Sahni, P.V.; Zhang, J.; Sosunov, S.; Galkin, A.; Niatsetskaya, Z.; Starkov, A.; Brookes, P.S.; Ten, V.S. Krebs cycle metabolites and preferential succinate oxidation following neonatal hypoxic-ischemic brain injury in mice. Pediatr. Res. 2018, 83, 491–497. [Google Scholar] [CrossRef]
- Hou, S.; Lei, S.; Peng, H.; Weng, L.; Lv, S.; Li, M.; Zhao, D. Downregulating HK2 inhibits proliferation of endometrial stromal cells through a noncanonical pathway involving phosphorylation of signal transducer and activator of transcription 1 in endometriosis. Biol. Reprod. 2022, 107, 488–499. [Google Scholar] [CrossRef] [PubMed]
- Bramer, S.A.; Macedo, A.; Klein, C. Hexokinase 2 drives glycogen accumulation in equine endometrium at day 12 of diestrus and pregnancy. Reprod. Biol. Endocrinol. 2017, 15, 4. [Google Scholar] [CrossRef]
- Christofk, H.R.; Vander Heiden, M.G.; Harris, M.H.; Ramanathan, A.; Gerszten, R.E.; Wei, R.; Fleming, M.D.; Schreiber, S.L.; Cantley, L.C. The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 2008, 452, 230–233. [Google Scholar] [CrossRef]
- Atas, E.; Oberhuber, M.; Kenner, L. The Implications of PDK1-4 on Tumor Energy Metabolism, Aggressiveness and Therapy Resistance. Front. Oncol. 2020, 10, 583217. [Google Scholar] [CrossRef]
- Hamza, A.; Cho, J.Y.; Cap, K.C.; Hossain, A.J.; Kim, J.G.; Park, J.B. Extracellular pyruvate kinase M2 induces cell migration through p-Tyr42 RhoA-mediated superoxide generation and epithelial-mesenchymal transition. Free Radic. Biol. Med. 2023, 208, 614–629. [Google Scholar] [CrossRef] [PubMed]
- Toniyan, K.A.; Povorova, V.V.; Gorbacheva, E.Y.; Boyarintsev, V.V.; Ogneva, I.V. Organization of the Cytoskeleton in Ectopic Foci of the Endometrium with Rare Localization. Biomedicines 2021, 9, 998. [Google Scholar] [CrossRef]
- Liao, T.L.; Tzeng, C.R.; Yu, C.L.; Wang, Y.P.; Kao, S.H. Estrogen receptor-? in mitochondria: Implications for mitochondrial bioenergetics and tumorigenesis. Ann. N. Y. Acad. Sci. 2015, 1350, 52–60. [Google Scholar] [CrossRef]
- Wang, T.; Zhang, J.; Hu, M.; Zhang, Y.; Cui, P.; Li, X.; Li, J.; Vestin, E.; Brännström, M.; Shao, L.R.; et al. Differential Expression Patterns of Glycolytic Enzymes and Mitochondria-Dependent Apoptosis in PCOS Patients with Endometrial Hyperplasia, an Early Hallmark of Endometrial Cancer, In Vivo and the Impact of Metformin In Vitro. Int. J. Biol. Sci. 2019, 15, 714–725. [Google Scholar] [CrossRef] [PubMed]
- Kong, A.; Johnson, N.; Kitchener, H.C.; Lawrie, T.A. Adjuvant radiotherapy for stage I endometrial cancer. Cochrane Database Syst. Rev. 2012, 2012, CD003916. [Google Scholar] [CrossRef]
- Kuznetsov, A.V.; Veksler, V.; Gellerich, F.N.; Saks, V.; Margreiter, R.; Kunz, W.S. Analysis of mitochondrial function in situ in permeabilized muscle fibers, tissues and cells. Nat. Protoc. 2008, 3, 965–976. [Google Scholar] [CrossRef] [PubMed]
- Ogneva, I.V.; Usik, M.A.; Burtseva, M.V.; Biryukov, N.S.; Zhdankina, Y.S.; Sychev, V.N.; Orlov, O.I. Drosophila melanogaster Sperm under Simulated Microgravity and a Hypomagnetic Field: Motility and Cell Respiration. Int. J. Mol. Sci. 2020, 21, 5985. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Primer Sequence, Forward/Reverse (5′…3′) | Product Size, bp |
---|---|---|
CYC1 (Cytochrome c-1) | GAGGTGGAGGTTCAAGACGG/ TAGCTCGCACGATGTAGCTG | 160 |
COX4I1 (cytochrome c oxidase subunit IV isoform 1) | GCGGCAGAATGTTGGCTAC/ GATGAAGAACATGGCACCGC | 341 |
ATP5A1 (ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1) | TCAAAAGACTGGGACTGCTGA/ ATGTACGCGGGCAATACCAT | 127 |
HK1 (hexokinase 1) | AAGCAGACGCACAACAATGC/ AGGGCCAAGAAGTCACCATTC | 92 |
HK2 (hexokinase 2) | TGTGGATTCCAGCATTTGCC/ CCTGGCTTTGGTTTCATTGC | 70 |
PFKL (phosphofructokinase, liver type) | AAGGGTCAGGTGCAAGAAGTAG/ GATGCGGATGTTCTCCACAATG | 129 |
PFKM (phosphofructokinase, muscle type) | CAAAGATGTGACCAAGGCCATG/ TGCGAACCACTCTTAGATACCG | 138 |
PFKP (phosphofructokinase, platelet) | TGGACGGAGGCTCAAACATC/ CTGGAAGGAACACCCAGTCC | 519 |
PKM (pyruvate kinase M1/2) | GGAAGTGGGCAGCAAGATCT/ GCTCCATCCAGGACTGCATT | 564 |
H3F3A (H3 histone, family 3A) | AATCGACCGGTGGTAAAGCA/ GACGCTGGAAGGGAAGTTTG | 183 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Toniyan, K.A.; Malkov, A.A.; Biryukov, N.S.; Gorbacheva, E.Y.; Boyarintsev, V.V.; Ogneva, I.V. The Cellular Respiration of Endometrial Biopsies from Patients with Various Forms of Endometriosis. Int. J. Mol. Sci. 2024, 25, 3680. https://doi.org/10.3390/ijms25073680
Toniyan KA, Malkov AA, Biryukov NS, Gorbacheva EY, Boyarintsev VV, Ogneva IV. The Cellular Respiration of Endometrial Biopsies from Patients with Various Forms of Endometriosis. International Journal of Molecular Sciences. 2024; 25(7):3680. https://doi.org/10.3390/ijms25073680
Chicago/Turabian StyleToniyan, Konstantin A., Artyom A. Malkov, Nikolay S. Biryukov, Elena Yu. Gorbacheva, Valery V. Boyarintsev, and Irina V. Ogneva. 2024. "The Cellular Respiration of Endometrial Biopsies from Patients with Various Forms of Endometriosis" International Journal of Molecular Sciences 25, no. 7: 3680. https://doi.org/10.3390/ijms25073680
APA StyleToniyan, K. A., Malkov, A. A., Biryukov, N. S., Gorbacheva, E. Y., Boyarintsev, V. V., & Ogneva, I. V. (2024). The Cellular Respiration of Endometrial Biopsies from Patients with Various Forms of Endometriosis. International Journal of Molecular Sciences, 25(7), 3680. https://doi.org/10.3390/ijms25073680