Anti-Biofilm Activity of Assamsaponin A, Theasaponin E1, and Theasaponin E2 against Candida albicans
Abstract
1. Introduction
2. Results
2.1. The Biofilm Growth Curve of Biofilm Formation of C. albicans ATCC 10231
2.2. ASA, TE1, and TE2 Inhibit the Adhesion of C. albicans
2.3. ASA, TE1, and TE2 Inhibit the Biofilm Formation and Mature Biofilm of C. albicans
2.4. ASA, TE1, and TE2 Reduce Cell Surface Hydrophobicity and Extracellular Phospholipase of C. albicans
2.5. Effects of ASA, TE1, and TE2 on Genes Associated with Virulence Factors in C. albicans
2.6. Effects of ASA, TE1, and TE2 on C. albicans via Addition of cAMP
3. Discussion
4. Materials and Methods
4.1. Chemicals, Strains, and Growth Conditions
4.2. Establishment of a Biofilm Model
4.3. The Effects of ASA, TE1, and TE2 on the Adhesion Ability of C. albicans ATCC 10231
4.4. The Effects of ASA, TE1, and TE2 on Biofilm of C. albicans ATCC 10231
4.5. Determination of Cell Surface Hydrophobicity (CSH)
4.6. Extracellular Phospholipase Assay
4.7. Real-Time Quantitative Reverse Transcription PCR (qRT-PCR) of Virulence Factor Genes Related to C. albicans ATCC 10231
4.8. cAMP Rescue Test
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lu, Y.; Su, C.; Liu, H.P. Candida albicans hyphal initiation and elongation. Trends Microbiol. 2014, 22, 707–714. [Google Scholar] [CrossRef]
- Palková, Z.; Váchová, L. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts. Semin. Cell Dev. Biol. 2016, 57, 110–119. [Google Scholar] [CrossRef]
- Mathé, L.; Van, D.P. Recent insights into Candida albicans biofilm resistance mechanisms. Curr. Genet. 2013, 59, 251–264. [Google Scholar] [CrossRef]
- Nobile, C.J.; Johnson, A.D. Candida albicans biofilms and human disease. Annu. Rev. Microbiol. 2015, 69, 71–92. [Google Scholar] [CrossRef]
- Tsui, C.; Kong, E.F.; Jabra-rizk, M.Z. Pathogenesis of Candida albicans biofilm. Pathog. Dis. 2016, 74, ftw018. [Google Scholar] [CrossRef]
- Gulati, M.; Nobile, C.J. Candida albicans biofilms: Development, regulation, and molecular mechanisms. Microbes Infect. 2016, 18, 310–321. [Google Scholar] [CrossRef]
- Lohse, M.B.; Gulati, M.; Johnson, A.D.; Nobile, C.J. Development and regulation of single- and multi-species Candida albicans biofilms. Nat. Rev. Microbiol. 2018, 16, 19–31. [Google Scholar] [CrossRef]
- Zida, A.; Bamba, S.; Yacouba, A.; Ouedraogo-Traore, R.; Guiguemdé, R.T. Anti-Candida albicans natural products, sources of new antifungal drugs: A review. J. Mycol. Medicale 2017, 27, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Nett, J.E.; Sanchez, H.; Cain, M.T.; Andes, D.R. Genetic basis of Candida biofilm resistance due to drug-sequestering matrix glucan. J. Infect. Dis. 2010, 202, 171–175. [Google Scholar] [CrossRef] [PubMed]
- Vediyappan, G.; Rossignol, T.; D’enfert, C. Interaction of Candida albicans biofilms with antifungals: Transcriptional response and binding of antifungals to beta-glucans. Antimicrob. Agents Chemother. 2010, 54, 2096–2111. [Google Scholar] [CrossRef] [PubMed]
- Nett, J.E.; Sanchez, H.; Cain, M.T.; Ross, K.M.; Andes, D.R. Interface of Candida albicans biofilm matrix-associated drug resistance and cell wall integrity regulation. Eukaryot. Cell 2011, 10, 1660–1669. [Google Scholar] [CrossRef]
- Bonhomme, J.; D’enfert, C. Candida albicans biofilms: Building a heterogeneous, drug-tolerant environment. Curr. Opin. Microbiol. 2013, 16, 398–403. [Google Scholar] [CrossRef] [PubMed]
- Donlan, R.M. Biofilm formation: A clinically relevant microbiological process. Clin. Infect. Dis. 2001, 33, 1387–1392. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.H.; Gao, Y.; Yuan, M.A.; Zheng, Z.S.; Yin, J.F. Anti-Candida albicans effects and mechanisms of theasaponin E1 and assamsaponin A. Int. J. Mol. Sci. 2023, 24, 9350. [Google Scholar] [CrossRef] [PubMed]
- Chandra, J.; Mukherjee, P.K. Candida biofilms: Development, architecture, and resistance. Microbiol. Spectr. 2015, 3, 115–134. [Google Scholar] [CrossRef] [PubMed]
- Leonhard, H.; Tobudic, S.; Moser, D.; Zatorska, B.; Bigenzahn, W.; Schneider-Stickler, B. Growth kinetics of Candida biofilm on medical polymers: A long-term in vitro study. Laryngoscope 2013, 123, 732–737. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.H.; Lee, H.J.; Hong, S.H.; Kim, K.H.; Kwon, T.Y. Influence of surface characteristics on the adhesion of Candida albicans to various denture lining materials. Acta Odontol. Scand. 2013, 71, 241–248. [Google Scholar] [CrossRef] [PubMed]
- Alnuaimi, A.D.; O’Brien-Simpson, N.M.; Reynolds, E.C.; McCullough, M.J. Clinical isolates and laboratory reference Candida species and strains have varying abilities to form biofilms. FEMS Yeast Res. 2013, 13, 689–699. [Google Scholar] [CrossRef] [PubMed]
- Ramage, G.; Vande, W.K.; Wickes, B.L.; López-Ribot, J.L. Standardized method for in vitro antifungal susceptibility testing of Candida albicans biofilms. Antimicrob. Agents Chemother. 2001, 45, 2475–2479. [Google Scholar] [CrossRef]
- Hazen, B.W.; Hazen, K.C. Isolation of hydrophobic and hydrophilic variants of Candida albicans. FEMS Microbiol. Lett. 1989, 48, 167–171. [Google Scholar] [CrossRef]
- Bujdáková, H.; Didiásová, M.; Drahovská, H.; Cernáková, L. Role of cell surface hydrophobicity in Candida albicans biofilm. Cent. Eur. J. Biol. 2013, 8, 259–262. [Google Scholar] [CrossRef]
- Liu, Q.; Bai, L. Advance in the research of phospholipase B and the its action on Candida albicans. China Trop. Med. 2008, 8, 1050–1052. (In Chinese) [Google Scholar] [CrossRef]
- Zhou, Y.; Ma, X.M.; Zhang, X.M.; Jin, F.L.; Deng, D. Relationship between phospholipase activity and other virulence attributes of Candida albicans. Chin. J. Microecol. 2009, 21, 1001–1004+1007. (In Chinese) [Google Scholar] [CrossRef]
- Takagi, J.; Aoki, K.; Turner, B.S.; Lamont, S.; Lehoux, S.; Kavanaugh, N.; Megha, G.; Arevalo, A.V.; Lawrence, T.J.; Kim, C.Y.; et al. Mucin O-glycans are natural inhibitors of Candida albicans pathogenicity. Nat. Chem. Biol. 2022, 18, 762–773. [Google Scholar] [CrossRef] [PubMed]
- Moyes, D.L.; Wilson, D.; Richardson, J.P.; Mogavero, S.; Tang, S.X.; Wernecke, J.; Hofs, S.; Gratacap, R.L.; Robbins, J.; Runglall, M.; et al. Candidalysin is a fungal peptide toxin critical for mucosal infection. Nature 2016, 532, 64–68. [Google Scholar] [CrossRef] [PubMed]
- Verma, A.; Gaffen, S.L.; Swidergall, M. Innate immunity to mucosal Candida Infections. J. Fungi 2017, 3, 60. [Google Scholar] [CrossRef] [PubMed]
- Vila, T.; Sultan, A.S.; Montelongo-Jauregui, D.; Jabra-Rizk, M.A. Oral candidiasis: A disease of opportunity. J. Fungi 2020, 6, 15. [Google Scholar] [CrossRef] [PubMed]
- Alcazar-Fuoli, L.; Mellado, E. Current status of antifungal resistance and its impact on clinical practice. Br. J. Haematol. 2014, 166, 471–484. [Google Scholar] [CrossRef] [PubMed]
- Calderone, R.A.; Fonzi, W.A. Virulence factors of Candida albicans. Trends Microbiol. 2001, 9, 327–335. [Google Scholar] [CrossRef] [PubMed]
- Findley, K.; Oh, J.; Yang, J.; Conlan, S.; Deming, C.; Meyer, J.A.; Schoenfeld, D.; Nomicos, E.; Park, M.; Program, N.; et al. Topographic diversity of fungal and bacterial communities in human skin. Nature 2013, 498, 367–370. [Google Scholar] [CrossRef] [PubMed]
- Kuiper, I.; Lagendijk, E.L.; Pickford, R.; Derrick, J.P.; Lamers, G.E.M.; Thomasoates, J.E.; Lugtanberg, B.J.J.; Bloemberg, G.V. Characterization of two Pseudomonas putida lipopeptide biosurfactants, putisolvin I and II, which inhibit biofilm formation and break down existing biofilms. Mol. Microbiol. 2004, 51, 97–113. [Google Scholar] [CrossRef]
- Janek, T.; Lukaszewicz, M.; Krasowska, a. Antiadhesive activity of the biosurfactant pseudofactin II secreted by the Arctic bacterium Pseudomonas fluorescens BD5. BMC Microbiol. 2012, 12, 24. [Google Scholar] [CrossRef]
- Tawfik, S.M.; Zaky, M.F.; Mohammad, T.G.M.; Attia, H.A.E. Synthesis, characterization, and in vitro antifungal activity of anionic and nonionic surfactants against crop pathogenic fungi. J. Ind. Eng. Chem. 2015, 29, 163–171. [Google Scholar] [CrossRef]
- Monniot, C.; Boisramé, A.; Da Costa, G.; Chauvel, M.; Sautour, M.; Bougnoux, M.E.; Bellon-Fontaine, M.N.; Dalle, F.; D’enfert, C.; Richard, M.L. Rbt1 protein domains analysis in Candida albicans brings insights into hyphal surface modifications and Rbt1 potential role during adhesion and biofilm formation. PLoS ONE 2013, 8, e82395. [Google Scholar] [CrossRef]
- Fu, Y.; Ibrahim, A.S.; Sheppard, D.C.; Chen, Y.C.; French, S.W.; Cutler, J.E.; Filler, S.G.; Edwards, J.E. Candida albicans Als1p: An adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol. Microbiol. 2002, 44, 61–72. [Google Scholar] [CrossRef]
- Kamai, Y.; Kubota, M.; Kamai, Y.; Hosokawa, T.; Fukuaka, T.; Filler, S.G. Contribution of Candida albicans ALS1 to the pathogenesis of experimental oropharyngeal candidiasis. Infect. Imumunity 2002, 70, 5256–5258. [Google Scholar] [CrossRef]
- Almeida, R.S.; Brunke, S.; Albrecht, A.; Thewes, S.; Laue, M.; Edwards, J.E.; Filler, S.G.; Hube, B. The hyphal-associated adhesin and invasin Als3 of Candida albicans mediates iron acquisition from host ferritin. PLoS Pathog. 2008, 4, e1000217. [Google Scholar] [CrossRef]
- Phan, Q.T.; Myers, C.L.; Fu, Y.; Sheppard, D.C.; Yeaman, M.R.; Welch, W.H.; Ibrahim, A.S.; Edwards, J.E.; Filler, S.G. Als3 is a Candida albicans invasin that binds to cadherins and induces endocytosis by host cells. PLoS Biol. 2007, 5, 543–557. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.M.; Oh, S.H.; Cheng, G.; Green, C.B.; Nuessen, J.A.; Yeater, K.; Leng, R.P.; Brown, A.J.P.; Hoyer, L.L. ALS3 and ALS8 represent a single locus that encodes a Candida albicans adhesin; functional comparisons between Als3p and Als1p. Microbiology 2004, 150, 2415–2428. [Google Scholar] [CrossRef] [PubMed]
- Orsi, C.F.; Borghi, E.; Colombari, B.; Neglia, R.G.; Quaglino, D.; Ardizzoni, A.; Morace, G.; Blasi, E. Impact of Candida albicans hyphal wall protein 1 (HWP1) genotype on biofilm production and fungal susceptibility to microglial cells. Microb. Pathog. 2014, 67–70, 20–27. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Palecek, S.P. Distinct domains of the Candida albicans adhesin Eap1p mediate cell-cell and cell-substrate interactions. Microbiology 2008, 154, 1193–1203. [Google Scholar] [CrossRef] [PubMed]
- Ghannoum, M.A. Potential role of phospholipases in virulence and fungal pathogenesis. Clin. Microbiol. Rev. 2000, 13, 122–143. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.; Li, C.Y. Correlation of phospholipase activity and virulence of Candida albicans between fluconazole-resistant and susceptible strains. J. Shandong Univ. 2007, 45, 535–537. (In Chinese) [Google Scholar]
- Jin, Y.; Zhang, H. Advance on the phospholipases of Candida albicans. Foreign Med. Sci. 2002, 28, 40–42. (In Chinese) [Google Scholar]
- Dalle, F.; Wächtler, B.; L’ollivier, C.; Holland, G.; Bannert, N.; Wilson, D.; Labruère, C.; Bonnin, A.; Hube, B. Cellular interactions of Candida albicans with human oral epithelial cells and enterocytes. Cell. Microbiol. 2010, 12, 248–271. [Google Scholar] [CrossRef] [PubMed]
- Baillie, G.S.; Douglas, L.J. Role of dimorphism in the development of Candida albicans biofilms. J. Med. Microbiol. 1999, 48, 671–679. [Google Scholar] [CrossRef] [PubMed]
- Leberer, E.; Harcus, D.; Dignard, D.; Johnson, L.; Ushinsky, S.; Thomas, D.Y.; Schrppel, K. Ras links cellular morphogenesis to virulence by regulation of the MAP kinase and cAMP signalling pathways in the pathogenic fungus Candida albicans. Mol. Microbiol. 2001, 42, 673–687. [Google Scholar] [CrossRef]
- Li, Y.; Shan, M.Z.; Li, S.H.; Wang, Y.C.; Yang, H.; Chen, Y.; Gu, B.; Zhu, Z.B. Teasaponin suppresses Candida albicans filamentation by reducing the level of intracellular cAMP. Ann. Transl. Med. 2020, 8, 175. [Google Scholar] [CrossRef] [PubMed]
- Liang, S.H.; Anderson, M.Z.; Hirakawa, M.P.; Wang, J.M.; Frazer, C.; Alaalm, L.M.; Thomson, G.J.; Ene, I.V.; Bennett, R.J. Hemizygosity enables a mutational transition governing fungal virulence and commensalism. Cell Host Microbe 2019, 25, 418–431. [Google Scholar] [CrossRef]
- Kitagawa, I.; Hori, T.; Motozawa, T.; Murakami, T.; Yoshikawa, M. Structures of new acylated oleanene-type triterpene oligoglycosides, Theasaponins E1 and E2, from the seeds of tea plant, Camellia sinensis (L.) O. Kuntze. Chem. Pharm. Bull. 1998, 46, 1901–1906. [Google Scholar] [CrossRef]
- Morikawa, T.; Li, N.; Nagatomo, A.; Matsuda, H.; Li, X.; Yoshikawa, M. Triterpene saponins with gastroprotective effects from tea seed (the seeds of Camellia sinensis). J. Nat. Prod. 2006, 69, 185–190. [Google Scholar] [CrossRef]
- Ren, H.J. The Extraction and Purification of Tea Saponin and Application in Daily Chemical Products. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2016. (In Chinese). [Google Scholar]
- Pan, R.T. The Research about Antibacterial Activity and Toxicology of Tea Saponin. Master’s Thesis, Hunan Agricultural University, Changsha, China, 2014. (In Chinese). [Google Scholar]
- Guo, X.J. Mutagenicity and Subchronic Toxicity Study of Tea Saponin in Rats. Master’s Thesis, Wuhan University of Science and Technology, Wuhan, China, 2015. (In Chinese). [Google Scholar]
- Wang, S.; Huang, X.F.; Zhang, P.; Newell, K.A.; Wang, H.Q.; Zheng, K.Y.; Yu, Y.H. Dietary teasaponin ameliorates alteration of gut microbiota and cognitive decline in diet-induced obese mice. Sci. Rep. 2017, 7, 12203. [Google Scholar] [CrossRef]
- Pan, L.L.; Yao, Y.Y.; Zheng, H.L.; Yan, S.Z.; Chen, S.L. Inhibitory effects and mechanism of action of elsinochrome A on Candida albicans and its biofilm. J. Fungi 2022, 8, 841. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.T.; Wang, F.; Shen, Y.; Yu, F.Z.; Qiu, L.L.; Zhang, L.J.; Chen, Y.H.; Yuan, Q.; Zhang, H.; Sun, Y.; et al. Inhibitory effect of ficin on Candida albicans biofilm formation and pre-formed biofilms. BMC Oral Health 2022, 22, 350. [Google Scholar] [CrossRef] [PubMed]
- Nett, J.E.; Cain, M.T.; Crawford, K.; Andes, D.R. Optimizing a Candida biofilm microtiter plate model for measurement of antifungal susceptibility by tetrazolium salt assay. J. Clin. Microbiol. 2011, 49, 1426–1433. [Google Scholar] [CrossRef] [PubMed]
- Biniarz, P.; Baranowska, G.; Feder-Kubis, J.; Krasowska, A. The lipopeptides pseudofactin II and surfactin effectively decrease Candida albicans adhesion and hydrophobicity. Antonie Van Leeuwenhoek Int. J. Gen. Mol. Microbiol. 2015, 108, 343–353. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yousuf, S.; Ahmad, A.; Khan, A.; Manzoor, N.; Khan, L.A. Effect of garlic-derived allyl sulphides on morphogenesis and hydrolytic enzyme secretion in Candida albicans. Med. Mycol. 2011, 49, 444–448. [Google Scholar] [CrossRef]








| Primer | Sequence |
|---|---|
| ACT1-F | TGACCGAAGCTCCAATGAATCC |
| ACT1-R | CCGGTGGTTCTACCAGAAGAGT |
| ALS1-F | CCTATGCCACCACTACCACTGT |
| ALS1-R | AATCGGAGGTTGTGCTGTTGAC |
| ALS3-F | CGCAACCACCACTACCATTACC |
| ALS3-R | CACCTGGAGGAGCAGTGATTGT |
| HWP1-F | ACAGGTAGACGGTCAAGGTGAA |
| HWP1-R | TGAGGTGGATTGTCGCAAGGT |
| EAP1-F | TGTGATGGCGGTTCTTGTTCTC |
| EAP1-R | GTGGACTCGGTAGCTGGTGTAG |
| NRG1-F | TGCTAGTGCTGCTGGTAGTACA |
| NRG1-R | CTGCTGCTGCTTGGTTGGTATT |
| UME6-F | TGGTGGTGTCAGTGTTAGTGCT |
| UME6-R | TTGGTGGTGGTGGAAGAGAAGG |
| HGC1-F | GCAACCACCACCACCAATGAA |
| HGC1-R | ACAGCACGAGAACCAGCGATA |
| EED1-F | TGCTCTACCACCACAACAAG |
| EED1-R | TTGCGGTGCTTGCTCATA |
| HYR1-F | GCTCAGGCTCAGGCTCACAA |
| HYR1-R | TTCGGAACCAGAACCAGAACCA |
| TPK2-F | TTCAACAACCGCAGCAACAACT |
| TPK2-R | TTCAGCAGCCGATTTGGAAACA |
| RAS1-F | TGGTGGTGTAAGTAGTGATGGA |
| RAS1-R | GTTGTTGCTGTTGTTGTTGTCT |
| EFG1-F | TTCACAACAGCCACCACTACCA |
| EFG1-R | TGCTCTTCTGACAACCGACACA |
| CPH1-F | TGCTGCCACTGCTCCAATGTA |
| CPH1-R | TGCTGCTGCTGCTGTTGTTG |
| SAP5-F | CCGTCGATGAGACTGGTAGAGA |
| SAP5-R | GGGAAGTGCGGGAAGATGCT |
| PLB1-F | TGGTCGTCCAACTGGTAAGTGT |
| PLB1-R | GCCATCTTCTCCACCGTCAAC |
| PLB2-F | ACATGCCAATCCCACCATTCCT |
| PLB2-R | TGACCGTCTTCACCTCCATCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Gao, Y.; Li, Y.; Yin, J. Anti-Biofilm Activity of Assamsaponin A, Theasaponin E1, and Theasaponin E2 against Candida albicans. Int. J. Mol. Sci. 2024, 25, 3599. https://doi.org/10.3390/ijms25073599
Chen Y, Gao Y, Li Y, Yin J. Anti-Biofilm Activity of Assamsaponin A, Theasaponin E1, and Theasaponin E2 against Candida albicans. International Journal of Molecular Sciences. 2024; 25(7):3599. https://doi.org/10.3390/ijms25073599
Chicago/Turabian StyleChen, Yuhong, Ying Gao, Yifan Li, and Junfeng Yin. 2024. "Anti-Biofilm Activity of Assamsaponin A, Theasaponin E1, and Theasaponin E2 against Candida albicans" International Journal of Molecular Sciences 25, no. 7: 3599. https://doi.org/10.3390/ijms25073599
APA StyleChen, Y., Gao, Y., Li, Y., & Yin, J. (2024). Anti-Biofilm Activity of Assamsaponin A, Theasaponin E1, and Theasaponin E2 against Candida albicans. International Journal of Molecular Sciences, 25(7), 3599. https://doi.org/10.3390/ijms25073599

