Aspirin Caused Intestinal Damage through FXR and ET-1 Signaling Pathways
Abstract
1. Introduction
2. Results
2.1. Non-Targeted Metabolomics Identified the Disruption of Bile Acid Pools and Inhibition of FXR in Aspirin-Induced Intestinal Injury
2.2. Activation of FXR Can Significantly Reduce Duodenum Injury Induced by Aspirin and Alleviate ET-1 Overexpression
2.3. The Role of FXR in Regulating ET-1 Expression Was Verified in Fxr-Knockout Mice
2.4. Inhibition of ET-1 Improves Inflammation and Oxidative Stress in Intestinal Injury
2.5. CDCA Improved Aspirin-Induced Chronic Duodenal and Ileum Damage through FXR and ET-1 Pathways
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Biochemical Analysis and Histological Analysis
4.3. Sample Extraction and Metabolomics Analysis
4.4. Animal Experiment
4.5. Detection of Gene Expression Levels
4.6. Western Blotting
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Genes | Forward Primer | Reverse Primer |
|---|---|---|
| Gapdh | TTGTATGTGCAACAATCTCCAC | CGTCCCGTAGACAAAATGTGT |
| Il6 | CGGAGAGGAGACTTCACAGAGGA | TTTCCACGATTTCCCAGAGAACA |
| iNOS | GTTCTCAGCCCAACAATACAAGA | GTGGACGGGTCGATGTCAC |
| Gpx4 | GATGGAGCCCATTCCTGAACC | CCCTGTACTTATCCAGGCAGA |
| Cox2 | TTCCAATCCATGTCAAAACCGT | AGTCCGGGTACAGTCACACTT |
| Ccl2 | ATCCACGGCATACTATCAACATC | TCGTAGTCATACGGTGTGGTG |
| Il1b | CCCTGCAGCTGGAGAGTGTGGA | TGTGCTCTGCTTGTGAGGTGCTG |
| ET-1 | TTTCCCGTGATCTTCTCTCTGC | CTGAGTTCGGCTCCCAAGAC |
| Cfos | CGGGTTTCAACGCCGACTA | TGGCACTAGAGACGGACAGAT |
| Cjun | GGGACACAGCTTTCACCCTA | GAAAAGTAGCCCCCAACCTC |
| Caspase3 | CTCGCTCTGGTACGGATGTG | TCCCATAAATGACCCCTTCATCA |
| Hsf1 | ACAGTCACCCGGCTGTTG | ACTGCACCAGTGAGATGAGGAA |
| p53 | TGAACCGCCGACCTATCCTTA | GGCACAAACACGAACCTCAAA |
| Shp | GTGCCCAGCATACTCAAGAAG | TGGGGTCTGTCTGGCAGTT |
| Ostb | GTATTTTCGTGCAGAAGATGCG | TTTCTGTTTGCCAGGATGCTC |
| Osta | CACTGGCTCAGTTGCCATTT | GCATACGGCATAAAACGAGGT |
| Ibabp | CCCCAACTATCACCAGACTTC | ACATCCCCGATGGTGGAGAT |
| Fgf15 | GGACCAGCGGAGTACAGGT | CTTCCTCCGAGTAGCGAATCAG |
| 18S | ATTGGAGCTGGAATTACCGC | CGGCTACCACATCCAAGGAA |
| β-actin | AGCCATGTACGTAGCCATCC | GCTGTGGTGGTGAAGCTGTA |
| Lamin B1 | CCGGCCTCAAGGCTCTCTA | GTGCCGCCTCATACTCTCG |
| Rank | GeNorm | NormFinder | ||
|---|---|---|---|---|
| Gene | Stability | Gene | Stability | |
| 1 | 18s | 0.53 | Gapdh | 0.44 |
| 2 | Gapdh | 0.53 | 18s | 0.51 |
| 3 | β-actin | 0.85 | β-actin | 0.84 |
| 4 | Lamin B1 | 0.95 | Lamin B1 | 0.85 |
Appendix B




References
- Wolfe, M.M.; Lichtenstein, D.R.; Singh, G. Gastrointestinal toxicity of nonsteroidal antiinflammatory drugs. N. Engl. J. Med. 1999, 340, 1888–1899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pusztaszeri, M.P.; Genta, R.M.; Cryer, B.L. Drug-induced injury in the gastrointestinal tract: Clinical and pathologic considerations. Nat. Clin. Pract. Gastroenterol. Hepatol. 2007, 4, 442–453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Sullivan, J.W. Aspirin for the primary prevention of cardiovascular disease in the elderly. BMJ Evid.-Based Med. 2019, 24, 143–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Wang, Z.; Shen, B.; Chen, C.; Ding, X.; Song, H. Effects of aspirin on the gastrointestinal tract: Pros vs. cons. Oncol. Lett. 2020, 20, 2567–2578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, J.; Li, X.H.; Zhang, W.; Yang, Y.M.; Wu, Y.H.; Li, W.Q.; Peng, J.; Li, Y.J. Involvement of glutamate-cystine/glutamate transporter system in aspirin-induced acute gastric mucosa injury. Biochem. Biophys. Res. Commun. 2014, 450, 135–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.C.; Lin, K.H.; Huang, Y.T.; Tsai, T.J.; Sun, W.C.; Chuah, S.K.; Wu, D.C.; Hsu, P.I. The risk of lower gastrointestinal bleeding in low-dose aspirin users. Aliment. Pharmacol. Ther. 2017, 45, 1542–1550. [Google Scholar] [CrossRef] [Scilit]
- Tarnawski, A.S.; Ahluwalia, A. Increased susceptibility of aging gastric mucosa to injury and delayed healing: Clinical implications. World J. Gastroenterol. 2018, 24, 4721–4727. [Google Scholar] [CrossRef] [Scilit]
- Lavie, C.J.; Howden, C.W.; Scheiman, J.; Tursi, J. Upper Gastrointestinal Toxicity Associated with Long-Term Aspirin Therapy: Consequences and Prevention. Curr. Probl. Cardiol. 2017, 42, 146–164. [Google Scholar] [CrossRef] [Scilit]
- Lué, A.; Lanas, A. Protons pump inhibitor treatment and lower gastrointestinal bleeding: Balancing risks and benefits. World J. Gastroenterol. 2016, 22, 10477–10481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.T.; Wang, M.R.; Hua, G.D.; Li, Q.Y.; Wang, X.J.; Lang, R.; Weng, W.L.; Xue, C.M.; Zhu, B.C. Inhibition of Aspirin-Induced Gastrointestinal Injury: Systematic Review and Network Meta-Analysis. Front. Pharmacol. 2021, 12, 730681. [Google Scholar] [CrossRef] [Scilit]
- Fukushi, K.; Tominaga, K.; Nagashima, K.; Kanamori, A.; Izawa, N.; Kanazawa, M.; Sasai, T.; Hiraishi, H. Gastroduodenal ulcer bleeding in elderly patients on low dose aspirin therapy. World J. Gastroenterol. 2018, 24, 3908–3918. [Google Scholar] [CrossRef] [Scilit]
- Magierowski, M.; Magierowska, K.; Hubalewska-Mazgaj, M.; Adamski, J.; Bakalarz, D.; Sliwowski, Z.; Pajdo, R.; Kwiecien, S.; Brzozowski, T. Interaction between endogenous carbon monoxide and hydrogen sulfide in the mechanism of gastroprotection against acute aspirin-induced gastric damage. Pharmacol. Res. 2016, 114, 235–250. [Google Scholar] [CrossRef] [Scilit]
- Bjarnason, I.; Scarpignato, C.; Holmgren, E.; Olszewski, M.; Rainsford, K.D.; Lanas, A. Mechanisms of Damage to the Gastrointestinal Tract From Nonsteroidal Anti-Inflammatory Drugs. Gastroenterology 2018, 154, 500–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakamoto, C. Roles of COX-1 and COX-2 in gastrointestinal pathophysiology. J. Gastroenterol. 1998, 33, 618–624. [Google Scholar] [CrossRef] [Scilit]
- Doutremepuich, C.; Aguejouf, O.; Desplat, V.; Eizayaga, F.X. Aspirin therapy: An attempt to explain the events of prothrombotic complications after treatment discontinuation. Thromb. Haemost. 2010, 103, 171–180. [Google Scholar]
- Nagata, N.; Niikura, R.; Aoki, T.; Shimbo, T.; Kishida, Y.; Sekine, K.; Tanaka, S.; Watanabe, K.; Sakurai, T.; Yokoi, C.; et al. Colonic diverticular hemorrhage associated with the use of nonsteroidal anti-inflammatory drugs, low-dose aspirin, antiplatelet drugs, and dual therapy. J. Gastroenterol. Hepatol. 2014, 29, 1786–1793. [Google Scholar] [CrossRef] [Scilit]
- Staels, B.; Fonseca, V.A. Bile acids and metabolic regulation: Mechanisms and clinical responses to bile acid sequestration. Diabetes Care 2009, 32 (Suppl. 2), S237–S245. [Google Scholar] [CrossRef] [Scilit]
- Jiang, L.; Zhang, H.; Xiao, D.; Wei, H.; Chen, Y. Farnesoid X receptor (FXR): Structures and ligands. Comput. Struct. Biotechnol. J. 2021, 19, 2148–2159. [Google Scholar] [CrossRef] [Scilit]
- Armstrong, L.E.; Guo, G.L. Role of FXR in Liver Inflammation during Nonalcoholic Steatohepatitis. Curr. Pharmacol. Rep. 2017, 3, 92–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gadaleta, R.M.; van Erpecum, K.J.; Oldenburg, B.; Willemsen, E.C.; Renooij, W.; Murzilli, S.; Klomp, L.W.; Siersema, P.D.; Schipper, M.E.; Danese, S.; et al. Farnesoid X receptor activation inhibits inflammation and preserves the intestinal barrier in inflammatory bowel disease. Gut 2011, 60, 463–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, M.; Wang, D.; Li, X.; Cao, Y.; Yi, C.; Wiredu Ocansey, D.K.; Zhou, Y.; Mao, F. Farnesoid-X receptor as a therapeutic target for inflammatory bowel disease and colorectal cancer. Front. Pharmacol. 2022, 13, 1016836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, M.; Peng, W.; Lin, L.; Wu, Z.E.; Zhang, T.; Zhao, Q.; Cheng, Y.; Lin, Q.; Zhang, B.; Liu, A.; et al. Celastrol as an intestinal FXR inhibitor triggers tripolide-induced intestinal bleeding: Underlying mechanism of gastrointestinal injury induced by Tripterygium wilfordii. Phytomed. Int. J. Phytother. Phytopharm. 2023, 121, 155054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fiorucci, S.; Mencarelli, A.; Cipriani, S.; Renga, B.; Palladino, G.; Santucci, L.; Distrutti, E. Activation of the farnesoid-X receptor protects against gastrointestinal injury caused by non-steroidal anti-inflammatory drugs in mice. Br. J. Pharmacol. 2011, 164, 1929–1938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kjærgaard, K.; Frisch, K.; Sørensen, M.; Munk, O.L.; Hofmann, A.F.; Horsager, J.; Schacht, A.C.; Erickson, M.; Shapiro, D.; Keiding, S. Obeticholic acid improves hepatic bile acid excretion in patients with primary biliary cholangitis. J. Hepatol. 2021, 74, 58–65. [Google Scholar] [CrossRef] [Scilit]
- Schwabl, P.; Hambruch, E.; Seeland, B.A.; Hayden, H.; Wagner, M.; Garnys, L.; Strobel, B.; Schubert, T.L.; Riedl, F.; Mitteregger, D.; et al. The FXR agonist PX20606 ameliorates portal hypertension by targeting vascular remodelling and sinusoidal dysfunction. J. Hepatol. 2017, 66, 724–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jorgensen, T.G. Ulcer formation and histochemical changes in rat-stomach mucosa induced by acetylsalicylic acid. Acta Pathol. Microbiol. Scand. Sect. A Pathol. 1976, 84, 64–72. [Google Scholar] [CrossRef] [Scilit]
- Huang, F.; Zheng, X.; Ma, X.; Jiang, R.; Zhou, W.; Zhou, S.; Zhang, Y.; Lei, S.; Wang, S.; Kuang, J.; et al. Theabrownin from Pu-erh tea attenuates hypercholesterolemia via modulation of gut microbiota and bile acid metabolism. Nat. Commun. 2019, 10, 4971. [Google Scholar] [CrossRef] [Scilit]
- Diwakar, L.; Gowaikar, R.; Chithanathan, K.; Gnanabharathi, B.; Tomar, D.S.; Ravindranath, V. Endothelin-1 mediated vasoconstriction leads to memory impairment and synaptic dysfunction. Sci. Rep. 2021, 11, 4868. [Google Scholar] [CrossRef] [Scilit]
- Theodorakis, N.; Maluccio, M.; Skill, N. Murine study of portal hypertension associated endothelin-1 hypo-response. World J. Gastroenterol. 2015, 21, 4817–4828. [Google Scholar] [CrossRef] [Scilit]
- Divino, J.N.; Chawla, K.S.; da Silva, C.M.; Bjorge, A.M.; Brittingham, A. Endothelin-1 production by the canine macrophage cell line DH82: Enhanced production in response to microbial challenge. Vet. Immunol. Immunopathol. 2010, 136, 127–132. [Google Scholar] [CrossRef] [Scilit]
- Przepiera-Będzak, H.; Fischer, K.; Brzosko, M. Axial spondyloarthritis and inflammatory bowel disease: Association between disease activity and endothelial dysfunction markers. Rheumatol. Int. 2022, 42, 273–277. [Google Scholar] [CrossRef] [Scilit]
- Kanazawa, S.; Tsunoda, T.; Onuma, E.; Majima, T.; Kagiyama, M.; Kikuchi, K. VEGF, basic-FGF, and TGF-beta in Crohn’s disease and ulcerative colitis: A novel mechanism of chronic intestinal inflammation. Am. J. Gastroenterol. 2001, 96, 822–828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McKenna, S.; Gossling, M.; Bugarini, A.; Hill, E.; Anderson, A.L.; Rancourt, R.C.; Balasubramaniyan, N.; El Kasmi, K.C.; Wright, C.J. Endotoxemia Induces IκBβ/NF-κB-Dependent Endothelin-1 Expression in Hepatic Macrophages. J. Immunol. 2015, 195, 3866–3879. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wu, Y.; Liu, Y.; Deng, Q.H.; Mak, M.; Yang, X. Atmospheric nanoparticles affect vascular function using a 3D human vascularized organotypic chip. Nanoscale 2019, 11, 15537–15549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adner, M.; Shankley, N.; Edvinsson, L. Evidence that ET-1, but not ET-3 and S6b, ET(A)-receptor mediated contractions in isolated rat mesenteric arteries are modulated by co-activation of ET(B) receptors. Br. J. Pharmacol. 2001, 133, 927–935. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.; Qiu, C.Y.; Wei, S.; Han, L.; Liu, T.T.; Hu, W.P. Potentiation of P2X3 receptor mediated currents by endothelin-1 in rat dorsal root ganglion neurons. Neuropharmacology 2020, 181, 108356. [Google Scholar] [CrossRef] [Scilit]
- van de Water, F.M.; Russel, F.G.; Masereeuw, R. Regulation and expression of endothelin-1 (ET-1) and ET-receptors in rat epithelial cells of renal and intestinal origin. Pharmacol. Res. 2006, 54, 429–435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi-Wen, X.; Rodríguez-Pascual, F.; Lamas, S.; Holmes, A.; Howat, S.; Pearson, J.D.; Dashwood, M.R.; du Bois, R.M.; Denton, C.P.; Black, C.M.; et al. Constitutive ALK5-independent c-Jun N-terminal kinase activation contributes to endothelin-1 overexpression in pulmonary fibrosis: Evidence of an autocrine endothelin loop operating through the endothelin A and B receptors. Mol. Cell. Biol. 2006, 26, 5518–5527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aktar, M.K.; Kido-Nakahara, M.; Furue, M.; Nakahara, T. Mutual upregulation of endothelin-1 and IL-25 in atopic dermatitis. Allergy 2015, 70, 846–854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, H.L.; Lin, C.C.; Chan, H.J.; Yang, C.M.; Yang, C.M. c-Src-dependent EGF receptor transactivation contributes to ET-1-induced COX-2 expression in brain microvascular endothelial cells. J. Neuroinflamm. 2012, 9, 152. [Google Scholar] [CrossRef] [Scilit]
- He, F.; Li, J.; Mu, Y.; Kuruba, R.; Ma, Z.; Wilson, A.; Alber, S.; Jiang, Y.; Stevens, T.; Watkins, S.; et al. Downregulation of endothelin-1 by farnesoid X receptor in vascular endothelial cells. Circ. Res. 2006, 98, 192–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Slomiany, B.L.; Piotrowski, J.; Slomiany, A. Role of endothelin-1 and constitutive nitric oxide synthase in gastric mucosal resistance to indomethacin injury: Effect of antiulcer agents. Scand. J. Gastroenterol. 1999, 34, 459–464. [Google Scholar] [PubMed]
- Sostres, C.; Lanas, A. Gastrointestinal effects of aspirin. Nat. Rev. Gastroenterol. Hepatol. 2011, 8, 385–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bilodeau, S.; Caron, V.; Gagnon, J.; Kuftedjian, A.; Tremblay, A. A CK2-RNF4 interplay coordinates non-canonical SUMOylation and degradation of nuclear receptor FXR. J. Mol. Cell Biol. 2017, 9, 195–208. [Google Scholar] [CrossRef] [Scilit]
- Shaid, S.; Brandts, C.H.; Serve, H.; Dikic, I. Ubiquitination and selective autophagy. Cell Death Differ. 2013, 20, 21–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hellström, P.M.; Nilsson, I.; Svenberg, T. Role of bile in regulation of gut motility. J. Intern. Med. 1995, 237, 395–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alrehaili, B.D.; Lee, M.; Takahashi, S.; Novak, R.; Rimal, B.; Boehme, S.; Trammell, S.A.J.; Grevengoed, T.J.; Kumar, D.; Alnouti, Y.; et al. Bile acid conjugation deficiency causes hypercholanemia, hyperphagia, islet dysfunction, and gut dysbiosis in mice. Hepatol. Commun. 2022, 6, 2765–2780. [Google Scholar] [CrossRef] [Scilit]
- Forman, B.M.; Goode, E.; Chen, J.; Oro, A.E.; Bradley, D.J.; Perlmann, T.; Noonan, D.J.; Burka, L.T.; McMorris, T.; Lamph, W.W.; et al. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995, 81, 687–693. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Q.; Tang, P.; Zhang, T.; Huang, J.F.; Xiao, X.R.; Zhu, W.F.; Gonzalez, F.J.; Li, F. Celastrol ameliorates acute liver injury through modulation of PPARα. Biochem. Pharmacol. 2020, 178, 114058. [Google Scholar] [CrossRef] [Scilit]
- Yang, R.; Zhao, Q.; Hu, D.D.; Xiao, X.R.; Huang, J.F.; Li, F. Metabolomic analysis of cholestatic liver damage in mice. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2018, 120, 253–260. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Rao, Q.; Dai, M.; Wu, Z.E.; Zhao, Q.; Li, F. Tripterygium wilfordii protects against an animal model of autoimmune hepatitis. J. Ethnopharmacol. 2023, 309, 116365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinal, C.J.; Tohkin, M.; Miyata, M.; Ward, J.M.; Lambert, G.; Gonzalez, F.J. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000, 102, 731–744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.F.; Zhao, Q.; Dai, M.Y.; Xiao, X.R.; Zhang, T.; Zhu, W.F.; Li, F. Gut microbiota protects from triptolide-induced hepatotoxicity: Key role of propionate and its downstream signalling events. Pharmacol. Res. 2020, 155, 104752. [Google Scholar] [CrossRef] [Scilit]
- Dai, M.; Peng, W.; Zhang, T.; Zhao, Q.; Ma, X.; Cheng, Y.; Wang, C.; Li, F. Metabolomics reveals the role of PPARα in Tripterygium Wilfordii-induced liver injury. J. Ethnopharmacol. 2022, 289, 115090. [Google Scholar] [CrossRef] [Scilit] [PubMed]






Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, Q.; Zhang, B.; Dai, M.; Cheng, Y.; Li, F. Aspirin Caused Intestinal Damage through FXR and ET-1 Signaling Pathways. Int. J. Mol. Sci. 2024, 25, 3424. https://doi.org/10.3390/ijms25063424
Lin Q, Zhang B, Dai M, Cheng Y, Li F. Aspirin Caused Intestinal Damage through FXR and ET-1 Signaling Pathways. International Journal of Molecular Sciences. 2024; 25(6):3424. https://doi.org/10.3390/ijms25063424
Chicago/Turabian StyleLin, Qiuxia, Binbin Zhang, Manyun Dai, Yan Cheng, and Fei Li. 2024. "Aspirin Caused Intestinal Damage through FXR and ET-1 Signaling Pathways" International Journal of Molecular Sciences 25, no. 6: 3424. https://doi.org/10.3390/ijms25063424
APA StyleLin, Q., Zhang, B., Dai, M., Cheng, Y., & Li, F. (2024). Aspirin Caused Intestinal Damage through FXR and ET-1 Signaling Pathways. International Journal of Molecular Sciences, 25(6), 3424. https://doi.org/10.3390/ijms25063424
