IFI16 Is Indispensable for Promoting HIF-1α-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions
Abstract
1. Introduction
2. Results
2.1. A Transient Accumulation of Hypoxia-Induced HIF-1α Is Sufficient to Stimulate the Expression of APOL1 in Human Podocytes
2.2. The Minimal Impact of the cGAS/STING/IRF3 Pathway on Roxadustat-Induced APOL1 Expression
2.3. IFI16 Plays a Crucial Role in the Induction of APOL1 Expression in Human Podocytes under Hypoxic Conditions
2.4. The Interaction between IFI16 and HIF-1α Is Dispensable for the Induction of APOL1 Expression in Hypoxic Podocytes
2.5. Identification of Active Hypoxia Response Elements within the Regulatory Region of the APOL1 Gene
2.6. IFI16 Does Not Significantly Impact the Expression of a Subset of Hypoxia-Targeted Genes in Podocytes
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Generation of IFI16 Knockout (IFI16KO) Cells
4.3. Roxadustat Treatment
4.4. Hypoxia Experiments
4.5. siRNA Transfections
4.6. Quantitative Real-Time PCR (RT-qPCR)
4.7. Protein Extraction, Immunoblotting, and Antibodies
4.8. Assessing Activity and Treatment with cGAS Inhibitor G150
4.9. Subcellular Fractionation of AB8/13 and IFI16KO Podocytes and Immunoblotting
4.10. Nuclear Co-Immunoprecipitation of HIF-1α and IFI16 and Immunoblotting
4.11. Chromatin Immunoprecipitation (ChIP)-qPCR
4.12. Cloning of APOL1 Hypoxia Response Elements into pGL4 Luciferase Reporter Vector and Luciferase Reporter and β-Galactosidase Assays
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Duchateau, P.N.; Pullinger, C.R.; Orellana, R.E.; Kunitake, S.T.; Naya-Vigne, J.; O’Connor, P.M.; Malloy, M.J.; Kane, J.P. Apolipoprotein L, a new human high density lipoprotein apolipoprotein expressed by the pancreas. Identification, cloning, characterization, and plasma distribution of apolipoprotein L. J. Biol. Chem. 1997, 272, 25576–25582. [Google Scholar] [CrossRef]
- Raper, J.; Fung, R.; Ghiso, J.; Nussenzweig, V.; Tomlinson, S. Characterization of a novel trypanosome lytic factor from human serum. Infect. Immun. 1999, 67, 1910–1916. [Google Scholar] [CrossRef]
- Pays, E.; Vanhollebeke, B.; Vanhamme, L.; Paturiaux-Hanocq, F.; Nolan, D.P.; Pérez-Morga, D. The trypanolytic factor of human serum. Nat. Rev. Microbiol. 2006, 4, 477–486. [Google Scholar] [CrossRef] [PubMed]
- Perez-Morga, D.; Vanhollebeke, B.; Paturiaux-Hanocq, F.; Nolan, D.P.; Lins, L.; Homble, F.; Vanhamme, L.; Tebabi, P.; Pays, A.; Poelvoorde, P.; et al. Apolipoprotein L-I promotes trypanosome lysis by forming pores in lysosomal membranes. Science 2005, 309, 469–472. [Google Scholar] [CrossRef]
- Thomson, R.; Genovese, G.; Canon, C.; Kovacsics, D.; Higgins, M.K.; Carrington, M.; Winkler, C.A.; Kopp, J.; Rotimi, C.; Adeyemo, A.; et al. Evolution of the primate trypanolytic factor APOL1. Proc. Natl. Acad. Sci. USA 2014, 111, E2130–E2139. [Google Scholar] [CrossRef] [PubMed]
- Lan, X.; Wen, H.; Lederman, R.; Malhotra, A.; Mikulak, J.; Popik, W.; Skorecki, K.; Singhal, P.C. Protein domains of APOL1 and its risk variants. Exp. Mol. Pathol. 2015, 99, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Lecordier, L.; Vanhollebeke, B.; Poelvoorde, P.; Tebabi, P.; Paturiaux-Hanocq, F.; Andris, F.; Lins, L.; Pays, E. C-terminal mutants of apolipoprotein L-I efficiently kill both Trypanosoma brucei brucei and Trypanosoma brucei rhodesiense. PLoS Pathog. 2009, 5, e1000685. [Google Scholar] [CrossRef] [PubMed]
- Smith, E.E.; Malik, H.S. The apolipoprotein L family of programmed cell death and immunity genes rapidly evolved in primates at discrete sites of host-pathogen interactions. Genome Res. 2009, 19, 850–858. [Google Scholar] [CrossRef]
- Freedman, B.I.; Kopp, J.B.; Langefeld, C.D.; Genovese, G.; Friedman, D.J.; Nelson, G.W.; Winkler, C.A.; Bowden, D.W.; Pollak, M.R. The apolipoprotein L1 (APOL1) gene and nondiabetic nephropathy in African Americans. J. Am. Soc. Nephrol. 2010, 21, 1422–1426. [Google Scholar] [CrossRef] [PubMed]
- Genovese, G.; Friedman, D.J.; Ross, M.D.; Lecordier, L.; Uzureau, P.; Freedman, B.I.; Bowden, D.W.; Langefeld, C.D.; Oleksyk, T.K.; Uscinski Knob, A.L.; et al. Association of trypanolytic ApoL1 variants with kidney disease in African Americans. Science 2010, 329, 841–845. [Google Scholar] [CrossRef]
- Beckerman, P.; Susztak, K. APOL1: The Balance Imposed by Infection, Selection, and Kidney Disease. Trends Mol. Med. 2018, 24, 682–695. [Google Scholar] [CrossRef] [PubMed]
- Bruggeman, L.A.; O’Toole, J.F.; Sedor, J.R. APOL1 polymorphisms and kidney disease: Loss-of-function or gain-of-function? Am. J. Physiol. Renal Physiol. 2019, 316, F1–F8. [Google Scholar] [CrossRef]
- Pollak, M.R.; Genovese, G.; Friedman, D.J. APOL1 and kidney disease. Curr. Opin. Nephro.l Hypertens. 2012, 21, 179–182. [Google Scholar] [CrossRef] [PubMed]
- Yusuf, A.A.; Govender, M.A.; Brandenburg, J.T.; Winkler, C.A. Kidney disease and APOL1. Hum. Mol. Genet. 2021, 30, R129–R137. [Google Scholar] [CrossRef]
- An, P.; Kirk, G.D.; Limou, S.; Binns-Roemer, E.; Kopp, J.B.; Winkler, C.A. Impact of APOL1 Genetic Variants on HIV-1 Infection and Disease Progression. Front. Immunol. 2019, 10, 53. [Google Scholar] [CrossRef]
- Kasembeli, A.N.; Duarte, R.; Ramsay, M.; Mosiane, P.; Dickens, C.; Dix-Peek, T.; Limou, S.; Sezgin, E.; Nelson, G.W.; Fogo, A.B.; et al. APOL1 Risk Variants Are Strongly Associated with HIV-Associated Nephropathy in Black South Africans. J. Am. Soc. Nephrol. 2015, 26, 2882–2890. [Google Scholar] [CrossRef]
- Kopp, J.B.; Heymann, J.; Winkler, C.A. APOL1 Renal Risk Variants: Fertile Soil for HIV-Associated Nephropathy. Semin. Nephrol. 2017, 37, 514–519. [Google Scholar] [CrossRef]
- Genovese, G.; Tonna, S.J.; Knob, A.U.; Appel, G.B.; Katz, A.; Bernhardy, A.J.; Needham, A.W.; Lazarus, R.; Pollak, M.R. A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9. Kidney Int. 2010, 78, 698–704. [Google Scholar] [CrossRef]
- Kopp, J.B.; Nelson, G.W.; Sampath, K.; Johnson, R.C.; Genovese, G.; An, P.; Friedman, D.; Briggs, W.; Dart, R.; Korbet, S.; et al. APOL1 genetic variants in focal segmental glomerulosclerosis and HIV-associated nephropathy. J. Am. Soc. Nephrol. 2011, 22, 2129–2137. [Google Scholar] [CrossRef]
- Ashley-Koch, A.E.; Okocha, E.C.; Garrett, M.E.; Soldano, K.; De Castro, L.M.; Jonassaint, J.C.; Orringer, E.P.; Eckman, J.R.; Telen, M.J. MYH9 and APOL1 are both associated with sickle cell disease nephropathy. Br. J. Haematol. 2011, 155, 386–394. [Google Scholar] [CrossRef]
- Blazer, A.; Wang, B.; Simpson, D.; Kirchhoff, T.; Heffron, S.; Clancy, R.M.; Heguy, A.; Ray, K.; Snuderl, M.; Buyon, J.P. Apolipoprotein L1 risk variants associate with prevalent atherosclerotic disease in African American systemic lupus erythematosus patients. PLoS ONE 2017, 12, e0182483. [Google Scholar] [CrossRef]
- Blazer, A.D.; Clancy, R.M. ApoL1 and the Immune Response of Patients with Systemic Lupus Erythematosus. Curr. Rheumatol. Rep. 2017, 19, 13. [Google Scholar] [CrossRef]
- Freedman, B.I.; Langefeld, C.D.; Andringa, K.K.; Croker, J.A.; Williams, A.H.; Garner, N.E.; Birmingham, D.J.; Hebert, L.A.; Hicks, P.J.; Segal, M.S.; et al. End-stage renal disease in African Americans with lupus nephritis is associated with APOL1. Arthritis. Rheumatol. 2014, 66, 390–396. [Google Scholar] [CrossRef]
- Larsen, C.P.; Beggs, M.L.; Saeed, M.; Walker, P.D. Apolipoprotein L1 risk variants associate with systemic lupus erythematosus-associated collapsing glomerulopathy. J. Am. Soc. Nephrol. 2013, 24, 722–725. [Google Scholar] [CrossRef]
- Beckerman, P.; Bi-Karchin, J.; Park, A.S.; Qiu, C.; Dummer, P.D.; Soomro, I.; Boustany-Kari, C.M.; Pullen, S.S.; Miner, J.H.; Hu, C.A.; et al. Transgenic expression of human APOL1 risk variants in podocytes induces kidney disease in mice. Nat. Med. 2017, 23, 429–438. [Google Scholar] [CrossRef]
- Lan, X.; Jhaveri, A.; Cheng, K.; Wen, H.; Saleem, M.A.; Mathieson, P.W.; Mikulak, J.; Aviram, S.; Malhotra, A.; Skorecki, K.; et al. APOL1 risk variants enhance podocyte necrosis through compromising lysosomal membrane permeability. Am. J. Physiol. Renal Physiol. 2014, 307, F326–F336. [Google Scholar] [CrossRef]
- Mikulak, J.; Oriolo, F.; Portale, F.; Tentorio, P.; Lan, X.; Saleem, M.A.; Skorecki, K.; Singhal, P.C.; Mavilio, D. Impact of APOL1 polymorphism and IL-1beta priming in the entry and persistence of HIV-1 in human podocytes. Retrovirology 2016, 13, 63. [Google Scholar] [CrossRef]
- Reiser, J.; Altintas, M.M. Podocytes. F1000Res 2016, 5, 114. [Google Scholar] [CrossRef]
- Reiser, J.; Sever, S. Podocyte biology and pathogenesis of kidney disease. Annu. Rev. Med. 2013, 64, 357–366. [Google Scholar] [CrossRef]
- Daneshpajouhnejad, P.; Kopp, J.B.; Winkler, C.A.; Rosenberg, A.Z. The evolving story of apolipoprotein L1 nephropathy: The end of the beginning. Nat. Rev. Nephrol. 2022, 18, 307–320. [Google Scholar] [CrossRef]
- Friedman, D.J.; Pollak, M.R. APOL1 and Kidney Disease: From Genetics to Biology. Annu. Rev. Physiol. 2020, 82, 323–342. [Google Scholar] [CrossRef]
- Giovinazzo, J.A.; Thomson, R.P.; Khalizova, N.; Zager, P.J.; Malani, N.; Rodriguez-Boulan, E.; Raper, J.; Schreiner, R. Apolipoprotein L-1 renal risk variants form active channels at the plasma membrane driving cytotoxicity. Elife 2020, 9, e51185. [Google Scholar] [CrossRef] [PubMed]
- Granado, D.; Muller, D.; Krausel, V.; Kruzel-Davila, E.; Schuberth, C.; Eschborn, M.; Wedlich-Soldner, R.; Skorecki, K.; Pavenstadt, H.; Michgehl, U.; et al. Intracellular APOL1 Risk Variants Cause Cytotoxicity Accompanied by Energy Depletion. J. Am. Soc. Nephrol. 2017, 28, 3227–3238. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Snipes, J.A.; Murea, M.; Molina, A.J.A.; Divers, J.; Freedman, B.I.; Ma, L.; Petrovic, S. An Acidic Environment Induces APOL1-Associated Mitochondrial Fragmentation. Am. J. Nephrol. 2020, 51, 695–704. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Ainsworth, H.C.; Snipes, J.A.; Murea, M.; Choi, Y.A.; Langefeld, C.D.; Parks, J.S.; Bharadwaj, M.S.; Chou, J.W.; Hemal, A.K.; et al. APOL1 Kidney-Risk Variants Induce Mitochondrial Fission. Kidney Int. Rep. 2020, 5, 891–904. [Google Scholar] [CrossRef]
- Ma, L.; Palmer, N.D.; Choi, Y.A.; Murea, M.; Snipes, J.A.; Parks, J.S.; Langefeld, C.D.; Freedman, B.I. APOL1 Risk Variants Impair Multiple Mitochondrial Pathways in a Metabolomics Analysis. Kidney360 2020, 1, 1353–1362. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.S.; Lannon, H.; Dias, L.; Zhang, J.Y.; Alper, S.L.; Pollak, M.R.; Friedman, D.J. APOL1 Kidney Risk Variants Induce Cell Death via Mitochondrial Translocation and Opening of the Mitochondrial Permeability Transition Pore. J. Am. Soc. Nephrol. 2019, 30, 2355–2368. [Google Scholar] [CrossRef] [PubMed]
- Grampp, S.; Krüger, R.; Lauer, V.; Uebel, S.; Knaup, K.X.; Naas, J.; Höffken, V.; Weide, T.; Schiffer, M.; Naas, S.; et al. Hypoxia hits APOL1 in the kidney. Kidney Int. 2023, 104, 53–60. [Google Scholar] [CrossRef]
- Faivre, A.; Scholz, C.C.; de Seigneux, S. Hypoxia in chronic kidney disease: Towards a paradigm shift? Nephrol. Dial Transplant. 2021, 36, 1782–1790. [Google Scholar] [CrossRef]
- Fu, Q.; Colgan, S.P.; Shelley, C.S. Hypoxia: The Force that Drives Chronic Kidney Disease. Clin. Med. Res. 2016, 14, 15–39. [Google Scholar] [CrossRef]
- Liu, Z.Z.; Bullen, A.; Li, Y.; Singh, P. Renal Oxygenation in the Pathophysiology of Chronic Kidney Disease. Front. Physiol. 2017, 8, 385. [Google Scholar] [CrossRef] [PubMed]
- Miguel, V.; Rojo, A. Hypoxia-Driven Responses in Chronic Kidney Disease. Oxygen 2023, 3, 300–321. [Google Scholar] [CrossRef]
- Ow, C.P.C.; Ngo, J.P.; Ullah, M.M.; Hilliard, L.M.; Evans, R.G. Renal hypoxia in kidney disease: Cause or consequence? Acta Physiol. 2018, 222, e12999. [Google Scholar] [CrossRef] [PubMed]
- Shu, S.; Wang, Y.; Zheng, M.; Liu, Z.; Cai, J.; Tang, C.; Dong, Z. Hypoxia and Hypoxia-Inducible Factors in Kidney Injury and Repair. Cells 2019, 8, 207. [Google Scholar] [CrossRef]
- Tanaka, S.; Tanaka, T.; Nangaku, M. Hypoxia and hypoxia-inducible factors in chronic kidney disease. Ren. Replace. Ther. 2016, 2, 25. [Google Scholar] [CrossRef]
- Wang, B.; Li, Z.L.; Zhang, Y.L.; Wen, Y.; Gao, Y.M.; Liu, B.C. Hypoxia and chronic kidney disease. EBioMedicine 2022, 77, 103942. [Google Scholar] [CrossRef]
- Evans, R.G.; Smith, D.W.; Lee, C.J.; Ngo, J.P.; Gardiner, B.S. What Makes the Kidney Susceptible to Hypoxia? Anat. Rec. 2020, 303, 2544–2552. [Google Scholar] [CrossRef]
- Chen, P.S.; Chiu, W.T.; Hsu, P.L.; Lin, S.C.; Peng, I.C.; Wang, C.Y.; Tsai, S.J. Pathophysiological implications of hypoxia in human diseases. J. Biomed. Sci. 2020, 27, 63. [Google Scholar] [CrossRef]
- Semenza, G.L. HIF-1: Mediator of physiological and pathophysiological responses to hypoxia. J. Appl. Physiol. 2000, 88, 1474–1480. [Google Scholar] [CrossRef]
- Wang, G.L.; Jiang, B.H.; Rue, E.A.; Semenza, G.L. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc. Natl. Acad. Sci. USA 1995, 92, 5510–5514. [Google Scholar] [CrossRef]
- Wang, G.L.; Semenza, G.L. Purification and characterization of hypoxia-inducible factor 1. J. Biol. Chem. 1995, 270, 1230–1237. [Google Scholar] [CrossRef]
- Wiener, C.M.; Booth, G.; Semenza, G.L. In vivo expression of mRNAs encoding hypoxia-inducible factor 1. Biochem. Biophys. Res. Commun. 1996, 225, 485–488. [Google Scholar] [CrossRef]
- Kaelin, W.G. Proline hydroxylation and gene expression. Annu. Rev. Biochem. 2005, 74, 115–128. [Google Scholar] [CrossRef]
- Lee, P.; Chandel, N.S.; Simon, M.C. Cellular adaptation to hypoxia through hypoxia inducible factors and beyond. Nat. Rev. Mol. Cell Biol. 2020, 21, 268–283. [Google Scholar] [CrossRef]
- Prabhakar, N.R.; Semenza, G.L. Oxygen Sensing and Homeostasis. Physiology 2015, 30, 340–348. [Google Scholar] [CrossRef]
- Davis, S.E.; Khatua, A.K.; Popik, W. Nucleosomal dsDNA Stimulates APOL1 Expression in Human Cultured Podocytes by Activating the cGAS/IFI16-STING Signaling Pathway. Sci. Rep. 2019, 9, 15485. [Google Scholar] [CrossRef]
- Almine, J.F.; O’Hare, C.A.; Dunphy, G.; Haga, I.R.; Naik, R.J.; Atrih, A.; Connolly, D.J.; Taylor, J.; Kelsall, I.R.; Bowie, A.G.; et al. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes. Nat. Commun. 2017, 8, 14392. [Google Scholar] [CrossRef] [PubMed]
- Dunphy, G.; Flannery, S.M.; Almine, J.F.; Connolly, D.J.; Paulus, C.; Jønsson, K.L.; Jakobsen, M.R.; Nevels, M.M.; Bowie, A.G.; Unterholzner, L. Non-canonical Activation of the DNA Sensing Adaptor STING by ATM and IFI16 Mediates NF-κB Signaling after Nuclear DNA Damage. Mol. Cell 2018, 71, 745–760.e745. [Google Scholar] [CrossRef] [PubMed]
- Jønsson, K.L.; Laustsen, A.; Krapp, C.; Skipper, K.A.; Thavachelvam, K.; Hotter, D.; Egedal, J.H.; Kjolby, M.; Mohammadi, P.; Prabakaran, T.; et al. IFI16 is required for DNA sensing in human macrophages by promoting production and function of cGAMP. Nat. Commun. 2017, 8, 14391. [Google Scholar] [CrossRef] [PubMed]
- Bouhamida, E.; Morciano, G.; Perrone, M.; Kahsay, A.E.; Della Sala, M.; Wieckowski, M.R.; Fiorica, F.; Pinton, P.; Giorgi, C.; Patergnani, S. The Interplay of Hypoxia Signaling on Mitochondrial Dysfunction and Inflammation in Cardiovascular Diseases and Cancer: From Molecular Mechanisms to Therapeutic Approaches. Biology 2022, 11, 300. [Google Scholar] [CrossRef] [PubMed]
- Liao, S.; Luo, J.; Kadier, T.; Ding, K.; Chen, R.; Meng, Q. Mitochondrial DNA Release Contributes to Intestinal Ischemia/Reperfusion Injury. Front. Pharmacol. 2022, 13, 854994. [Google Scholar] [CrossRef] [PubMed]
- Paul, S.; Kaplan, M.H.; Khanna, D.; McCourt, P.M.; Saha, A.K.; Tsou, P.S.; Anand, M.; Radecki, A.; Mourad, M.; Sawalha, A.H.; et al. Centromere defects, chromosome instability, and cGAS-STING activation in systemic sclerosis. Nat. Commun. 2022, 13, 7074. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Tian, S.; Liang, J.; Fan, J.; Lai, J.; Chen, Q. Therapeutic Development by Targeting the cGAS-STING Pathway in Autoimmune Disease and Cancer. Front. Pharmacol. 2021, 12, 779425. [Google Scholar] [CrossRef] [PubMed]
- Ka, N.L.; Lim, G.Y.; Kim, S.S.; Hwang, S.; Han, J.; Lee, Y.H.; Lee, M.O. Type I IFN stimulates IFI16-mediated aromatase expression in adipocytes that promotes E(2)-dependent growth of ER-positive breast cancer. Cell Mol. Life Sci. 2022, 79, 306. [Google Scholar] [CrossRef] [PubMed]
- Mole, D.R.; Blancher, C.; Copley, R.R.; Pollard, P.J.; Gleadle, J.M.; Ragoussis, J.; Ratcliffe, P.J. Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts. J. Biol. Chem. 2009, 284, 16767–16775. [Google Scholar] [CrossRef] [PubMed]
- Lubbers, D.W.; Baumgartl, H. Heterogeneities and profiles of oxygen pressure in brain and kidney as examples of the pO2 distribution in the living tissue. Kidney Int. 1997, 51, 372–380. [Google Scholar] [CrossRef]
- Lu, H.; Kapur, G.; Mattoo, T.K.; Lyman, W.D. Hypoxia decreases podocyte expression of slit diaphragm proteins. Int. J. Nephrol. Renovasc. Dis. 2012, 5, 101–107. [Google Scholar] [CrossRef]
- Singh, A.K.; Kolligundla, L.P.; Francis, J.; Pasupulati, A.K. Detrimental effects of hypoxia on glomerular podocytes. J. Physiol. Biochem. 2021, 77, 193–203. [Google Scholar] [CrossRef]
- Ren, Y.; Wang, J.; Guo, W.; Chen, J.; Wu, X.; Gu, S.; Xu, L.; Wu, Z.; Wang, Y. Renoprotection of Microcystin-RR in Unilateral Ureteral Obstruction-Induced Renal Fibrosis: Targeting the PKM2-HIF-1alpha Pathway. Front. Pharmacol. 2022, 13, 830312. [Google Scholar] [CrossRef]
- Fine, L.G.; Norman, J.T. Chronic hypoxia as a mechanism of progression of chronic kidney diseases: From hypothesis to novel therapeutics. Kidney Int. 2008, 74, 867–872. [Google Scholar] [CrossRef]
- Zhou, H.; Yang, M.; Jiang, Z.; Ding, J.; Di, J.; Cui, L. Renal Hypoxia: An Important Prognostic Marker in Patients with Chronic Kidney Disease. Am. J. Nephrol. 2018, 48, 46–55. [Google Scholar] [CrossRef]
- Chamboredon, S.; Ciais, D.; Desroches-Castan, A.; Savi, P.; Bono, F.; Feige, J.J.; Cherradi, N. Hypoxia-inducible factor-1alpha mRNA: A new target for destabilization by tristetraprolin in endothelial cells. Mol. Biol. Cell 2011, 22, 3366–3378. [Google Scholar] [CrossRef]
- Chu, C.Y.; Jin, Y.T.; Zhang, W.; Yu, J.; Yang, H.P.; Wang, H.Y.; Zhang, Z.J.; Liu, X.P.; Zou, Q. CA IX is upregulated in CoCl2-induced hypoxia and associated with cell invasive potential and a poor prognosis of breast cancer. Int. J. Oncol. 2016, 48, 271–280. [Google Scholar] [CrossRef]
- Johnstone, R.W.; Wei, W.; Greenway, A.; Trapani, J.A. Functional interaction between p53 and the interferon-inducible nucleoprotein IFI 16. Oncogene 2000, 19, 6033–6042. [Google Scholar] [CrossRef]
- Caposio, P.; Gugliesi, F.; Zannetti, C.; Sponza, S.; Mondini, M.; Medico, E.; Hiscott, J.; Young, H.A.; Gribaudo, G.; Gariglio, M.; et al. A novel role of the interferon-inducible protein IFI16 as inducer of proinflammatory molecules in endothelial cells. J. Biol. Chem. 2007, 282, 33515–33529. [Google Scholar] [CrossRef]
- Thompson, M.R.; Sharma, S.; Atianand, M.; Jensen, S.B.; Carpenter, S.; Knipe, D.M.; Fitzgerald, K.A.; Kurt-Jones, E.A. Interferon gamma-inducible protein (IFI) 16 transcriptionally regulates type i interferons and other interferon-stimulated genes and controls the interferon response to both DNA and RNA viruses. J. Biol. Chem. 2014, 289, 23568–23581. [Google Scholar] [CrossRef] [PubMed]
- Johnstone, R.W.; Kerry, J.A.; Trapani, J.A. The human interferon-inducible protein, IFI 16, is a repressor of transcription. J. Biol. Chem. 1998, 273, 17172–17177. [Google Scholar] [CrossRef] [PubMed]
- Albadari, N.; Deng, S.; Li, W. The transcriptional factors HIF-1 and HIF-2 and their novel inhibitors in cancer therapy. Expert Opin. Drug Discov. 2019, 14, 667–682. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.J.; Lee, M.H.; Kang, H.L.; Kim, S.H.; Ahn, J.R.; Na, H.; Na, T.Y.; Kim, Y.N.; Seong, J.K.; Lee, M.O. Differential regulation of estrogen receptor alpha expression in breast cancer cells by metastasis-associated protein 1. Cancer Res. 2014, 74, 1484–1494. [Google Scholar] [CrossRef] [PubMed]
- Kwak, J.C.; Ongusaha, P.P.; Ouchi, T.; Lee, S.W. IFI16 as a negative regulator in the regulation of p53 and p21(Waf1). J. Biol. Chem. 2003, 278, 40899–40904. [Google Scholar] [CrossRef]
- Semenza, G.L.; Agani, F.; Booth, G.; Forsythe, J.; Iyer, N.; Jiang, B.H.; Leung, S.; Roe, R.; Wiener, C.; Yu, A. Structural and functional analysis of hypoxia-inducible factor 1. Kidney Int. 1997, 51, 553–555. [Google Scholar] [CrossRef] [PubMed]
- Yfantis, A.; Mylonis, I.; Chachami, G.; Nikolaidis, M.; Amoutzias, G.D.; Paraskeva, E.; Simos, G. Transcriptional Response to Hypoxia: The Role of HIF-1-Associated Co-Regulators. Cells 2023, 12, 798. [Google Scholar] [CrossRef] [PubMed]
- D’Anna, F.; Van Dyck, L.; Xiong, J.; Zhao, H.; Berrens, R.V.; Qian, J.; Bieniasz-Krzywiec, P.; Chandra, V.; Schoonjans, L.; Matthews, J.; et al. DNA methylation repels binding of hypoxia-inducible transcription factors to maintain tumor immunotolerance. Genome Biol. 2020, 21, 182. [Google Scholar] [CrossRef]
- Casciello, F.; Al-Ejeh, F.; Kelly, G.; Brennan, D.J.; Ngiow, S.F.; Young, A.; Stoll, T.; Windloch, K.; Hill, M.M.; Smyth, M.J.; et al. G9a drives hypoxia-mediated gene repression for breast cancer cell survival and tumorigenesis. Proc. Natl. Acad. Sci. USA 2017, 114, 7077–7082. [Google Scholar] [CrossRef] [PubMed]
- Bao, L.; Chen, Y.; Lai, H.T.; Wu, S.Y.; Wang, J.E.; Hatanpaa, K.J.; Raisanen, J.M.; Fontenot, M.; Lega, B.; Chiang, C.M.; et al. Methylation of hypoxia-inducible factor (HIF)-1alpha by G9a/GLP inhibits HIF-1 transcriptional activity and cell migration. Nucleic Acids Res. 2018, 46, 6576–6591. [Google Scholar] [CrossRef]
- Saleem, M.A.; O’Hare, M.J.; Reiser, J.; Coward, R.J.; Inward, C.D.; Farren, T.; Xing, C.Y.; Ni, L.; Mathieson, P.W.; Mundel, P. A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J. Am. Soc. Nephrol. 2002, 13, 630–638. [Google Scholar] [CrossRef]
- Cheatham, A.M.; Davis, S.E.; Khatua, A.K.; Popik, W. Blocking the 5’ splice site of exon 4 by a morpholino oligomer triggers APOL1 protein isoform switch. Sci. Rep. 2018, 8, 8739. [Google Scholar] [CrossRef]
- Khatua, A.K.; Cheatham, A.M.; Kruzel, E.D.; Singhal, P.C.; Skorecki, K.; Popik, W. Exon 4-encoded sequence is a major determinant of cytotoxicity of apolipoprotein L1. Am. J. Physiol. Cell Physiol. 2015, 309, C22–C37. [Google Scholar] [CrossRef]








| Primer sequences used for RT-qPCR | |||
| Gene | Forward | Reverse | |
| VEGFA | TTGCCTTGCTGCTCTACCTCCA | GATGGCAGTAGCTGCGCTGATA | |
| LDHA | GGATCTCCAACATGCAGCCTT | AGACGGCTTTCTCCCTCTTGCT | |
| PDK1 | CATGTCACGCTGGTAATGAGG | CTCAACACGAGGTCTTGGTGCA | |
| LOX | ATTTCTTACCCAGCCGACCA | ACTTGCTTTGTGGCCTTCAG | |
| cGAS | AGGAAGCAACTACGACTAAAGCC | CGATGTGAGAGAAGGATAGCCG | |
| STING | CCTGAGTCTCAGAACAACTGCC | GGTCTTCAAGCTGCCCACAGTA | |
| IRF3 | TCTGCCCTCAACCGCAAAGAAG | TACTGCCTCCACCATTGGTGTC | |
| APOL1 | GCTTTGCTGAGAGTCTCTGTCC | GGGCTTACTTTGAGGATCTCCAG | |
| HIF-1α | TATGAGCCAGAAGAACTTTTAGGC | CACCTCTTTTGGCAAGCATCCTG | |
| IFI16 | GATGCCTCCATCAACACCAAGC | CTGTTGCGTTCAGCACCATCAC | |
| β-ACTIN | CACCATTGGCAATGAGCGGTTC | AGGTCTTTGCGGATGTCCACGT | |
| Primer sequences used for ChIP-qPCR | |||
| APOL1HREs | Forward | Reverse | Amplicon Size |
| HRE1 | GAGGGTGGGGCTGGACTGAA | ACCGAGGAATTCGAAAGGGAAAGTG | 103 bp |
| HRE2 | TCCTGGGTGCATCCTCAACCT | CAGCAACTCAGGGAGGAGGC | 145 bp |
| HRE3 | TGAGCCGAGATCACAACAC | GGGTCCCAAGATTTGATTTTCC | 127 bp |
| HRE4 | CACAACGCCAAGAGATCGAG | CCTCAGCCTCCCAAGTAGC | 124 bp |
| HRE5 | TCAGACCAAACTCGTGACCA | TCTCGATCTCTTGGCGTTGT | 150 bp |
| HRE6 | GAAACTCCCTGCCCTGTTCT | TCCCTGAGTGCACAATTTCTG | 153 bp |
| Primer sequences used for cloning APOL1 HRE5 and HRE6 into pGL4-luciferase vector | |||
| Forward (KpnI underlined) | Reverse (NheI underlined) | Amplicon Size | |
| gatcGGTACCCCTGACGACCTGTGTATGCA | actgGCTAGCCTCGATCTCTTGGCGTTGTG | 387 bp | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Randle, R.K.; Amara, V.R.; Popik, W. IFI16 Is Indispensable for Promoting HIF-1α-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions. Int. J. Mol. Sci. 2024, 25, 3324. https://doi.org/10.3390/ijms25063324
Randle RK, Amara VR, Popik W. IFI16 Is Indispensable for Promoting HIF-1α-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions. International Journal of Molecular Sciences. 2024; 25(6):3324. https://doi.org/10.3390/ijms25063324
Chicago/Turabian StyleRandle, Richaundra K., Venkateswara Rao Amara, and Waldemar Popik. 2024. "IFI16 Is Indispensable for Promoting HIF-1α-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions" International Journal of Molecular Sciences 25, no. 6: 3324. https://doi.org/10.3390/ijms25063324
APA StyleRandle, R. K., Amara, V. R., & Popik, W. (2024). IFI16 Is Indispensable for Promoting HIF-1α-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions. International Journal of Molecular Sciences, 25(6), 3324. https://doi.org/10.3390/ijms25063324
