Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection
by
,
Anna Lenart-Boroń
1,*,
Klaudia Stankiewicz
1,
Natalia Czernecka
2,
Anna Ratajewicz
2,
Klaudia Bulanda
3,
Miłosz Heliasz
2,
Daria Sosińska
2,
Kinga Dworak
4,
Dominika Ciesielska
5,
Izabela Siemińska
5 and
Marek Tischner
6 1
Department of Microbiology and Biomonitoring, Faculty of Agriculture and Economics, University of Agriculture in Kraków, Adam Mickiewicz Ave. 24/28, 30-059 Krakow, Poland
2
Scientific Circle of Biotechnologists, Faculty of Biotechnology and Horticulture, University of Agriculture in Kraków, 29 Listopada Ave. 54, 31-425 Krakow, Poland
3
Department of Forest Ecosystems Protection, Faculty of Forestry, University of Agriculture in Kraków, 29 Listopada Ave. 46, 31-425 Kraków, Poland
4
Diagnostyka S.A. Medical Microbiological Laboratory, Na Skarpie 66, 31-913 Krakow, Poland
5
The University Centre of Veterinary Medicine, Adam Mickiewicz Ave. 24/28, 30-059 Krakow, Poland
6
Department of Animal Reproduction, Anatomy and Genomics, Faculty of Animal Science, Adam Mickiewicz Ave. 24/28, 30-059 Krakow, Poland
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(6), 3121; https://doi.org/10.3390/ijms25063121
Submission received: 19 January 2024
/
Revised: 5 March 2024
/
Accepted: 5 March 2024
/
Published: 8 March 2024
(This article belongs to the Special Issue Novel Mechanisms of Bacterial Antibiotic Resistance and Strategies to Fight Them)
Abstract
:Skin wounds and their infections by antibiotic-resistant bacteria (ARB) are very common in small animals, posing the risk of acquiring ARB by pet owners or antibiotic resistance gene (ARG) transfer to the owners’ microbiota. The aim of this study was to identify the most common pathogens infecting wounds of companion animals, assess their antibiotic resistance, and determine the ARGs using culture-based, molecular, and proteomic methods. A total of 136 bacterial strains were isolated from wound swabs. Their species was identified using chromogenic media, followed by MALDI-TOF spectrometry. Antibiotic resistance was tested using disc diffusion, and twelve ARGs were detected using PCRs. The dominant species included Staphylococcus pseudintermedius (9.56%), E. coli, and E. faecalis (both n = 11, 8.09%). Enterobacterales were mostly resistant to amoxicillin/clavulanic acid (68.3% strains), all Pseudomonas were resistant to ceftazidime, piperacillin/tazobactam, imipenem, and tylosin, Acinetobacter were mostly resistant to tylosin (55.5%), all Enterococcus were resistant to imipenem, and 39.2% of Staphylococci were resistant to clindamycin. Among ARGs, strA (streptomycin resistance), sul3 (sulfonamide resistance), and blaTEM, an extended-spectrum beta-lactamase determinant, were the most frequent. The risk of ARB and ARG transfer between animals and humans causes the need to search for new antimicrobial therapies in future veterinary medicine.
1. Introduction
In recent years, the number of pets in European countries has gradually increased, with dogs and cats becoming the two most prevalent types of companion animals [1]. The social role of companion animals has changed, and attention to their health and welfare has significantly increased, too [2]. Skin wounds are very common in small animals. Such wounds are frequently colonized by bacteria or show signs of bacterial infection. Both colonization and infection often result in healing delays and difficulties, thus increasing the cost of treatment [3]. Currently, the treatment of wounds in veterinary medicine is based on the administration of broad-spectrum antibiotics, the continuous administration of which contributes to the increasing antimicrobial resistance among both pathogenic bacteria and even commensal skin microbiota [4].
In this context, the threat of wound infection, especially by antimicrobial-resistant bacteria (ARB), becomes an even more serious problem. This is due to the risk of pet owners acquiring the ARB or antibiotic resistance genes (ARGs) via contact with their companion animals [2]. The risk of interspecies transmission of bacteria, including antibiotic-resistant or multidrug-resistant bacteria, is very high because the majority of bacterial pathogens in companion animals are bacterial species that can also commonly occur in humans. These pathogens and opportunistic pathogens are Staphylococcus (including S. aureus), Pseudomonas (including P. aeruginosa), beta-haemolytic Streptococcus, E. coli, or Enterococcus (including E. faecalis or E. faecium) [1,2,3,4,5,6].
With respect to the high risk of companion animals’ infections with pathogenic ARB, the risk of infection treatment failure is also high. There are surprisingly few studies concerning the scope of antimicrobial resistance in companion animals, while research on animal wound infections is limited to only a few texts [3,4]. For this reason, understanding the prevalence of companion animals’ wound infections caused by antimicrobial-resistant bacteria that can easily be transmitted to their owners or veterinarians is among the most important gaps to be filled. With this in mind, the aim of this study was to identify the most common pathogens infecting wounds of companion animals treated in veterinary clinics, assess their resistance to antibacterial agents used in their treatment, and determine the genes determining the most common and dangerous resistance mechanisms. The combination of culture-based, molecular biology, and proteomic methods was used in order to obtain the most reliable results.
2. Results
A total of 136 bacterial isolates were obtained from the collected swabs, including 80 (58.82%) from dogs, 52 (38.24%) from cats, and 4 (2.94%) from rabbits. There were 71 (52.21%) Gram-positive and 65 (47.79%) Gram-negative isolates. The dominant genera (Table 1) were Staphylococcus spp. (n = 37, 27.21%), followed by Enterococcus spp. (n = 17, 12.50%), Escherichia (n = 11, 8.09%), and Acinetobacter (n = 10, 7.35%), with the following dominant species: S. pseudintermedius (n = 13, 9.56%), and E. coli and E. faecalis (both n = 11, 8.09%). The dominant bacterial genera and species differed between the examined groups of animals (Table 1 and Supplementary Table S1, respectively).
Antimicrobial resistance of 120 bacterial isolates was tested using 16 antibacterial agents in five combinations based on the target organism (Table 1 and table in Section 4.3). Among the group of Enterobacterales, resistance to amoxicillin/clavulanic acid was the most prevalent (detected in 68.3% of strains), followed by ampicillin (52.6%) and tylosin (44.7%). The extended-spectrum beta-lactamase (ESBL) phenotype of resistance was detected in 13.16% of strains (Supplementary Figure S1A and Figure 1A). None of the examined antimicrobials were effective against all strains. All strains of Pseudomonas spp. (n = 7) were resistant to ceftazidime, piperacillin/tazobactam, imipenem, and tylosin. Only amikacin proved effective against all strains of Pseudomonas spp. (Figure 1B). Finally, Acinetobacter (n = 9) showed the highest percentage of resistance to tylosin (55.5% of strains), followed by enrofloxacin and gentamicin (both 44.4%, Figure 1C). In the case of Gram-positive bacteria, all Enterococcus spp. strains (n = 15) were resistant to imipenem, 66.7% were resistant to tigecycline, and 46.7% to enrofloxacin (Figure 2A). In Staphylococcus spp., resistance to clindamycin was the most frequently observed (i.e., in 39.2% of strains). Methicillin resistance (MRS), shown by resistance to cefoxitin, was the second most prevalent, and was observed in 33.3% of strains (Figure 2B), along with resistance to erythromycin (also detected in 33.3% of strains). Both macrolide/streptogramin b (MSb) and macrolide/lincosamid/streptogramin b (MLSb) constitutive phenotypes of resistance were observed in 13.7%, while the inducible MLSb phenotype was observed in 3.9% of strains (Supplementary Figure S1C,D; Figure 2B).
One Enterobacterales strain (canine Proteus mirabilis), out of all examined, was resistant (or insusceptible) to eight out of nine antimicrobial agents tested. Two other Gram-negative strains (K. pneumoniae and Aeromonas media) were resistant to seven antimicrobials (Table 2). Among Gram-positives, three Staphylococci were resistant to seven out of eight antimicrobials tested (Table 2; these were feline S. pseudintermedius and S. aureus, and canine S. pseudintermedius).
Finally, PCR tests were carried out to search for 12 genetic determinants of antibiotic resistance to all antimicrobial classes used in the treatment of Gram-positive and Gram-negative bacteria. Due to the fact that various resistance mechanisms may be characteristic of Gram-positive and Gram-negative bacteria, some genes examined in these two groups of bacteria varied (such as methicillin and MLSb resistance determinants assessed only in Gram-positives and ESBL determinants assessed only in Gram-negatives), while others (such as strA determining the aminoglycoside resistance and sul3 that determines the resistance to sulfonamides) were common for both of these groups.
Ten out of the tested twelve genetic determinants of antimicrobial resistance were detected in the DNA extracted from bacterial isolates from cats, dogs, and rabbits (Table 3 and Table 4). Figure 3 presents the selected, most representative pictures showing the PCR results for the most frequently detected genes. Genes ereA (erythromycin esterase), qnrA and qnrD (plasmid-mediated quinolone resistance genes) were not detected in any of the examined samples. On the other hand, the streptomycin resistance gene, strA (Figure 3A), was detected in 29 samples, in all groups thereof, in both Gram-positive and Gram-negative bacteria. In terms of the detection frequency, it was followed by sul3 (Figure 3B), a sulfonamide resistance gene (14 positive samples in Gram-positive and Gram-negative isolates of both cats and dogs), and blaTEM (Figure 3C), an ESBL determinant characteristic of Gram-negative bacteria (13 positive samples in cats and dogs, Table 4 and Figure 3A).
Interestingly, there have been six canine and one feline bacterial isolates with phenotypic and molecular resistance profiles (Table 5) that could make them alarming, as they were resistant to all or nearly all examined antimicrobial agents and their DNA contained three or four different ARGs.
3. Discussion
There is growing evidence that resistant bacteria (including multidrug-resistant) occur in companion animals and that many species among them are shared between animals and humans [2]. With this in mind, the inappropriate use of antimicrobials in animals may result in the selection and spread of antimicrobial resistance, thus constituting a potential risk to public health [2]. This study provides data on bacteria colonizing wounds of companion animals, their antimicrobial resistance profiles, and genetic determinants of resistance to all classes of antimicrobial agents among Gram-negative and Gram-positive bacteria. The distribution of bacterial taxa shows that Staphylococcus spp. (with S. pseudintermedius and S. aureus), Enterococcus spp. (with E. faecalis), E. coli, Acinetobacter spp. (with A. ursingii), and Pseudomonas (with P. aeruginosa) were the most frequently isolated from all samples. A high prevalence of Staphylococcus spp., with higher numbers of S. pseudintermedius than of S. aureus, was reported by [6,7]. Kožár et al. [3] also observed that Staphylococcus (including S. intermedius, later reclassified to S. pseudintermedius) was the most frequent among wound-infecting Gram-positive bacteria, while E. coli was the most frequently identified Gram-negative bacterium. Staphylococcus pseudintermedius is the most common canine bacterial pathogen, but it is, indeed, accompanied by a variety of other bacteria—both Gram-positive and Gram-negative bacteria.
In recent years, increased attention has been paid to the welfare of small companion animals, which results in, e.g., increased expenses on veterinary care. This involves the frequent use of antimicrobial agents in pets, and many of these antimicrobials are commonly used in both human and veterinary medicine. However, the identification of causal agents and their antimicrobial susceptibility is often neglected, leading to inappropriate empirical treatment [8]. In both cats and dogs, the most frequent causes of antimicrobial use are wound infections [8]. The most frequently used classes of antibiotics in animals are fluoroquinolones, β-lactams, cephalosporins, sulfonamides, macrolides, and glycopeptides [9]. Among the consequences of antimicrobial use in companion animals is that the amounts and patterns of antibiotic administration are reflected in the rate at which resistance develops and spreads in the exposed bacterial population [8].
In our study, a high percentage of Enterobacterales was resistant to β-lactam antibiotics (amoxicillin/clavulanic acid and ampicillin—68.3% and 52.6%, respectively), while 100% of Pseudomonas isolates were insusceptible to ceftazidime (cephalosporin), piperacillin/tazobactam (β-lactam), imipenem (carbapanem), and tylosin (macrolide). However, resistance to enrofloxacin (fluoroquinolone) ranged from 11.8% in Staphylococci to 46.7% in Enterococci, and it was never the highest—only in Acinetobacter spp., it was the third highest (44.4%) among the observed resistance rates. Generally, enrofloxacin is commonly used systemically in the infection treatment of small animals, and although it is still efficient, there have been cases of treatment failure [8]. With respect to the fact that inappropriate use (e.g., pulse-dose, low-dose) is very common in the treatment of small animals, this might favor the development of resistant strains, particularly when long-term treatment is required [10]. As far as the antibiotic administration effect is concerned, it has been reported that enrofloxacin treatment promotes multidrug-resistant (MDR) E. coli colonization and that the proportion of dogs carrying resistant E. coli increased with the duration of hospital stay and with the antimicrobial treatment [2].
Even though antimicrobial resistance is spread among environmental microorganisms and human and animal pathogens, resistance against last-resort antimicrobial agents for human medicine detected in microorganisms that can be easily transmitted between animals and humans seems of special concern [2,8]. Insusceptibility to imipenem (carbapenem antimicrobial) has been detected quite frequently in our study. All Enterococcus spp. and all Pseudomonas spp. isolates were resistant to this antimicrobial. Importantly, both canine E. faecalis MDR strains, positive for four genetic determinants of resistance and resistant to four antibiotics mentioned in Table 5, were also resistant to imipenem. In the case of Gram-negative isolates mentioned in the special concern group (Table 5), one canine E. coli and P. mirabilis were also imipenem-resistant. All these species are listed as human pathogens, too. They cause, among many others, urinary tract infections [8,11]. Close interaction between pets and humans favors the transmission of bacteria by both direct contact and through the domestic environment, which puts children at greater risk than adults. This is due to their more common and closer physical contact with pets and with the household environment [8]. The most important hazard for human health in the case of dealing with animals’ wounds is therefore related to the transmission of antimicrobial-resistant bacteria from pets to humans and the related zoonotic infections [2].
Notably, antimicrobial resistance can be transmitted by low bacterial numbers or even in the absence thereof, if only the genetic determinants are present in the environment. Resistance gene transfer frequently occurs horizontally. Most classes of antibiotics have long been used in both human and veterinary medicine; thus, the same resistance genes are being identified in bacteria isolated from humans and animals [8]. In our study, ten genetic determinants of antimicrobial resistance have been identified in bacterial isolates of cats, dogs, and rabbits. Streptomycin resistance (strA) was most frequently identified, followed by sulfonamide resistance (sul3) and one of the ESBL determinants (blaTEM). Studies on the genetic determinants in bacteria isolated from companion animals are scarce. However, the listed genes have also been mentioned by other authors to occur in bacteria isolated from companion animals [8,12,13]. All four examined ESBL determinants were detected in this study at the following frequency: blaTEM > blaSHV > blaCTX m > blaOXA. Carvalho et al. [12], on the other hand, detected blaTEM, blaCTX m, and blaSHV in similar proportions in E. coli isolates obtained from dogs and their owners. Akhtardanesh et al. [13] examined the presence of nine genes determining the resistance to tetracyclines, quinolones, aminoglycosides, sulfonamides, and trimethoprim in E. coli isolates from pet cats. Similarly, as in our study, qnr genes (determining quinolone resistance) were very rare or absent. In this study, resistance to enrofloxacin, which is the most frequently applied fluoroquinolone veterinary antibiotic, varied and ranged from 11.7% in staphylococci to 46.7% in enterococci. In an earlier study focused on antimicrobial resistance and the molecular resistance mechanisms in chicken feces-derived E. coli, Lenart-Boroń et al. [14] observed that the fluoroquinolone resistance would reach even 93.3% of isolates. At the same time, resistance to β-lactams was also very frequent, with some experimental groups reaching 100% of bacterial isolates. Consequently, qnrB and qnrS genes were very frequent (detected in more than 81% and 86% of isolates of some experimental groups, respectively). However, the selection pressure put on bacteria present in farm poultry is much higher than on bacteria derived from pet animals. The reason for such a situation is that, despite the restrictions resulting from European Union regulations, the doses of antimicrobial agents administered to poultry are often inflated, used contrary to the veterinarians’ instructions, or the treatment duration is extended without justification [14].
4. Materials and Methods
4.1. Collection of Samples
A total of 145 wound swabs were collected from companion animals (84 dogs, 60 cats, and 1 rabbit) that underwent treatment at the University of Agriculture Veterinary Clinic. The samples were collected with a sterile swab by a qualified veterinarian (Supplementary Figure S2), immediately transferred to the Laboratory of Microbiology and Biomonitoring, and inoculated on selective media for the isolation and preliminary identification of bacterial pathogens and opportunistic pathogens.
4.2. Isolation and Identification of Bacteria
The culture media included: Chromogenic UTI Medium (ThermoFisher Scientific, Oxford, UK) for presumptive identification and differentiation of Enterococcus, Escherichia coli, Proteus, Pseudomonas, Staphylococcus, and Klebsiella; MacConkey agar (Biomaxima, Lublin, Poland) for Gram-negative Enterobacterales; Tryptone-bile-X-glucuronide agar (Biomaxima, Lublin, Poland) for E. coli; Slanetz-Bartley agar (Biomaxima, Lublin, Poland) for Enterococcus; Baird Parker agar (Biomaxima, Lublin, Poland) for Staphylococcus aureus; Columbia CNA agar with 5% sheep blood (ThermoFisher Scientific, Oxford, UK) for Gram-positive cocci and determination of their haemolysis type; Cetrimide agar (Biomaxima, Lublin, Poland) for Pseudomonas. All cultures were conducted for 24–48 h at 37 ± 1 °C. After incubation, different morphotypes, characteristic of the examined groups of bacteria (Figure 4), were subcultured by plate streaking, followed by observations of Gram-stained preparations. The species identification was performed via MALDI-TOF (Matrix-assisted laser desorption/ionisation time-of-flight) technology on a Bruker microflex ® mass spectrometry instrument (Bruker, Billerica, MA, US). This technique uses a laser to ionize and separate molecules by their mass-to-charge ratio. The resulting peptide mass fingerprint can be compared to a database of known spectra to find the best match. The high throughput, accuracy, and small required sample size of the MALDI-TOF MS have made it a widely used technique in the clinical microbiological laboratory. All identified bacteria had a log (score) value higher or equal to 2.0, which indicated ‘highly probable species identification’.
4.3. Antibacterial Susceptibility Tests
A total of 136 bacterial strains were isolated from the examined swabs. The antimicrobial susceptibility patterns were assessed using the disc-diffusion method, based on the recommendations of the Polish National Reference Centre for Antimicrobial Susceptibility [15]. Some species (e.g., Brevundimonas diminuta, Hafnia alvei, Bacillus pumilus, or Curtobacterium flaccumfaciens, Supplementary Table S1) proved either commensal or typically environmental. For this reason, international and Polish recommendations for antimicrobial susceptibility testing are not available, and neither is the interpretation of results. Therefore, the examinations were carried out on 120 isolates of Gram-negative (n = 54) and Gram-positive (n = 66) bacterial pathogens and potential pathogens. As the examined bacteria were classified into 28 different genera, the recommendations for both Gram-positive and Gram-negative bacteria were applied and divided into five groups (Table 6). Antimicrobial disc cartridges were obtained from Oxoid (Basingstoke, Great Britain). The ESBL (extended-spectrum beta-lactamase)-positive Enterobacterales and Pseudomonas strains were confirmed with the double disc synergy test [16]. The resistance of macrolide, lincosamid, and b-type streptogramin was assessed according to [17].
After incubation for 18–24 h at 36 ± 1 °C, the growth inhibition zone diameters around discs were measured (in mm) and compared to the most recent breakpoint values provided by the European Committee on Antimicrobial Susceptibility Testing [18].
4.4. Assessment of Genes Conferring the Bacterial Resistance to Different Groups of Antimicrobials
Bacterial DNA was extracted from all 120 strains subjected to antimicrobial resistance testing and from the control strains: susceptible E. coli ATCC 25922, Methicillin-susceptible S. aureus ATCC 25923; environmental strains of methicillin-resistant S. aureus and ESBL-positive E. coli were used as positive controls. DNA extraction was conducted from overnight cultures, using the Genomic Mini DNA extraction set of reagents (A&A Biotechnology, Gdańsk, Poland), following the manufacturer’s recommendations.
PCR amplifications were conducted using specific primers (Table 7) to search for genes conferring methicillin resistance in staphylococci, antibiotics from groups of macrolides, lincosamids, and streptogramins in Gram-positive cocci, ESBL determinants in Enterobacteriaceae and Pseudomonas, aminoglycosides, carbapenems, fluoroquinolones, sulfonamides, and tetracyclines in both Gram-negative and Gram-positive isolates. The reactions were performed in a volume of 25 μL containing 50 ng of DNA template, 12.5 pM of each primer, and 2× (12.5 μL) of PCR Mix Plus Green (A&A Biotechnology, Gdańsk, Poland) filled up with ultrapure water up to 25 μL. The following temperature profile was used for the reactions: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 45 s, annealing for 45 s at temperatures corresponding to individual primers, then extension at 72 °C for 1 min, with the final extension at 72 °C for 10 min. The reactions were performed in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). The PCR products were electrophoresed for 60 min in 1 × TBE SimplySafe (EurX, Gdańsk, Poland)-stained 1% agarose gel and visualized in UV light. DNA size Marker 3 (A&A Biotechnology, Gdańsk, Poland) was used to assess the size of product bands.
4.5. Statistical Analysis
The significance of differences in bacterial resistance to various antimicrobial agents and the presence of genetic determinants of antimicrobial resistance were assessed using the chi-square test (https://www.socscistatistics.com/tests/chisquare2/default2.aspx, accessed 3 December 2023). The significance level was set at a p value of < 0.05 for all tests.
5. Conclusions
The issues of infection control, antimicrobial resistance, and the spread of resistance genes are the same in companion animal and human hospitals, as these facilities are characterized by intensive use of antibiotics and a high density of patients. For these reasons, they are high-risk environments for the occurrence and spread of nosocomial infections, resistant bacteria, and genetic determinants thereof [2,29]. As shown in the current study, the composition of bacterial species that infect companion animals’ wounds can vary greatly, and even though some species could be considered more prevalent than others, none of them were prevalent enough to conclude that their presence in pets’ wounds could be assumed with high probability. Moreover, these bacteria can carry a number of resistance genes that determine their insusceptibility to a variety of antimicrobial agents. This study also resulted in two disturbing observations: the first refers to the prevalence of multidrug-resistant bacteria (in some groups reaching even 100% of isolates), while the second is the detection of bacteria that are also human pathogens (e.g., Proteus mirabilis), which were resistant to nearly all or all antimicrobial agents tested and carried three or four antibiotic resistance genes. The widely reported risk of transfer of resistant bacteria between animals and humans, coupled with the increasing demand for advanced therapies in companion animals and the spread of MDR bacteria, may result in the need to search for new antimicrobial therapies in the future in veterinary medicine.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25063121/s1.
Author Contributions
Conceptualization, A.L.-B. and K.S.; methodology, A.L.-B., K.S. and M.T.; software, A.L.-B. and K.D.; validation, K.S. and K.D.; formal analysis, A.L.-B. and K.S.; investigation, N.C., A.R., K.B., M.H., D.S., I.S., and D.C.; resources, A.L.-B., K.S., K.D., I.S. and M.T.; data curation, K.S.; writing—original draft preparation, A.L.-B.; writing—review and editing, K.S. and K.D.; visualization, A.L.-B. and K.S.; supervision, A.L.-B.; project administration, A.L.-B.; funding acquisition, A.L.-B. and M.T. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the measures of the state budget of the Polish Ministry of Education and Science under the program “Student scientific circles create innovations”—Research on the effectiveness of innovative hyaluron bionanocomposites with nanoencapsulated ozonated olive oil, graphene, and nanosilver against bacteria that infect wounds in dogs and cats (Agreement No. SKN/SP/569551/2023) and by the statutory measures of the University of Agriculture in Kraków.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data generated in this study are available on request from the corresponding author.
Conflicts of Interest
Author Kinga Dworak was employed by the company ‘Diagnostyka S.A. Medical Microbiological Laboratory, Na Skarpie 66, 31-913 Krakow, Poland’. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
- Marco-Fuertes, A.; Marin, C.; Lorenzo-Rebenaque, L.; Vega, S.; Montoro-Dasi, L. Antimicrobial Resistance in Companion Animals: A New Challenge for the One Health Approach in the European Union. Vet. Sci. 2022, 9, 208. [Google Scholar] [CrossRef]
- Pomba, C.; Rantala, M.; Greko, C.; Baptiste, K.E.; Catry, B.; van Duijkeren, E.; Mateus, A.; Moreno, M.A.; Pyörälä, S.; Ružauskas, M.; et al. Public Health Risk of Antimicrobial Resistance Transfer from Companion Animals. J. Antimicrob. Chemother. 2017, 72, 957–968. [Google Scholar] [CrossRef]
- Kožár, M.; Hamilton, H.; Koščová, J. Types of Wounds and the Prevalence of Bacterial Contamination of Wounds in the Clinical Practice of Small Animals. Folia Vet. 2018, 62, 39–47. [Google Scholar] [CrossRef]
- Windahl, U.; Bengtsson, B.; Nyman, A.K.; Holst, B.S. The Distribution of Pathogens and Their Antimicrobial Susceptibility Patterns among Canine Surgical Wound Infections in Sweden in Relation to Different Risk Factors. Acta Vet. Scand. 2015, 57, 11. [Google Scholar] [CrossRef]
- Scott Weese, J. Antimicrobial Resistance in Companion Animals. Anim. Health Res. Rev. 2008, 9, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Fernández, R.; Durán, I.; Molina-López, R.A.; Darwich, L. Antimicrobial Resistance in Bacteria Isolated From Cats and Dogs From the Iberian Peninsula. Front. Microbiol. 2021, 11, 621597. [Google Scholar] [CrossRef]
- Pires Dos Santos, T.; Damborg, P.; Moodley, A.; Guardabassi, L. Systematic Review on Global Epidemiology of Methicillin-Resistant Staphylococcus Pseudintermedius: Inference of Population Structure from Multilocus Sequence Typing Data. Front. Microbiol. 2016, 7, 1599. [Google Scholar] [CrossRef] [PubMed]
- Guardabassi, L.; Schwarz, S.; Lloyd, D.H. Pet Animals as Reservoirs of Antimicrobial-Resistant Bacteria: Review. J. Antimicrob. Chemother. 2004, 54, 321–332. [Google Scholar] [CrossRef]
- Caneschi, A.; Bardhi, A.; Barbarossa, A.; Zaghini, A. The Use of Antibiotics and Antimicrobial Resistance in Veterinary Medicine, a Complex Phenomenon: A Narrative Review. Antibiotics 2023, 12, 487. [Google Scholar] [CrossRef]
- Ganière, J.P.; Médaille, C.; Limet, A.; Ruvoen, N.; André-Fontaine, G. Antimicrobial Activity of Enrofloxacin against Staphylococcus Intermedius Strains Isolated from Canine Pyodermas. Vet. Dermatol. 2001, 12, 171–175. [Google Scholar] [CrossRef]
- Actor, J.K. 12—Clinical Bacteriology. In Elsevier’s Integrated Review Immunology and Microbiology, 2nd ed.; W.B. Saunders: Philadelphia, PA, USA, 2012; pp. 105–120. ISBN 978-0-323-07447-6. [Google Scholar]
- Carvalho, A.C.; Barbosa, A.V.; Arais, L.R.; Ribeiro, P.F.; Carneiro, V.C.; Cerqueira, A.M.F. Resistance Patterns, ESBL Genes, and Genetic Relatedness of Escherichia Coli from Dogs and Owners. Braz. J. Microbiol. 2016, 47, 150–158. [Google Scholar] [CrossRef]
- Akhtardanesh, B.; Ghanbarpour, R.; Ganjalikhani, S.; Gazanfari, P. Determination of Antibiotic Resistance Genes in Relation to Phylogenetic Background in Escherichia Coli Isolates from Fecal Samples of Healthy Pet Cats in Kerman City. Vet. Res. Forum Int. Q. J. 2016, 7, 301–308. [Google Scholar]
- Lenart-Boron, A.; Augustyniak, K.; Boron, P. Screening of Antimicrobial Resistance and Molecular Detection of Fluoroquinolone Resistance Mechanisms in Chicken Faeces-Derived Escherichia Coli. Vet. Med. 2016, 61, 80–89. [Google Scholar] [CrossRef]
- Gniadkowski, M.; Żabicka, D.; Hryniewicz, W. Rekomendacje Doboru Testów Do Oznaczania Wrażliwości Bakterii Na Antybiotyki i Chemioterapeutyki 2009 Oznaczanie Wrażliwo ś Ci Pałeczek Gram-Ujemnych; National Reference Center for Antimicrobial Susceptibility, National Institute of Medicines: Warsaw, Poland, 2009; pp. 1–29. [Google Scholar]
- Drieux, L.; Brossier, F.; Sougakoff, W.; Jarlier, V. Phenotypic Detection of Extended-Spectrum β-Lactamase Production in Enterobacteriaceae: Review and Bench Guide. Clin. Microbiol. Infect. 2008, 14, 90–103. [Google Scholar] [CrossRef]
- Fiebelkorn, K.R.; Crawford, S.A.; McElmeel, M.L.; Jorgensen, J.H. Practical Disk Diffusion Method for Detection of Inducible Clindamycin Resistance in Staphylococcus Aureus and Coagulase-Negative Staphylococci. J. Clin. Microbiol. 2003, 41, 4740–4744. [Google Scholar] [CrossRef]
- EUCAST European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. 2023, pp. 1–77. Available online: http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_5.0_Breakpoint_Table_01.pdf (accessed on 10 September 2023).
- Lina, G.; Quaglia, A.; Reverdy, M.E.; Leclercq, R.; Vandenesch, F.; Etienne, J. Distribution of Genes Encoding Resistance to Macrolides, Lincosamides, and Streptogramins among Staphylococci. Antimicrob. Agents Chemother. 1999, 43, 1062–1066. [Google Scholar] [CrossRef] [PubMed]
- Sutcliffe, J.; Grebe, T.; Tait-Kamradt, A.; Wondrack, L. Detection of Erythromycin-Resistant Determinants by PCR. Antimicrob. Agents Chemother. 1996, 40, 2562–2566. [Google Scholar] [CrossRef]
- Geha, D.J.; Uhl, J.R.; Gustaferro, C.A.; Persing, D.H. Multiplex PCR for Identification of Methicillin-Resistant Staphylococci in the Clinical Laboratory. J. Clin. Microbiol. 1994, 32, 1768–1772. [Google Scholar] [CrossRef]
- Pazda, M.; Rybicka, M.; Stolte, S.; Piotr Bielawski, K.; Stepnowski, P.; Kumirska, J.; Wolecki, D.; Mulkiewicz, E. Identification of Selected Antibiotic Resistance Genes in Two Different Wastewater Treatment Plant Systems in Poland: A Preliminary Study. Molecules 2020, 25, 2851. [Google Scholar] [CrossRef]
- Sáenz, Y.; Briñas, L.; Domínguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of Resistance in Multiple-Antibiotic-Resistant Escherichia Coli Strains of Human, Animal, and Food Origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef]
- Batchelor, M.; Hopkins, K.; Threlfall, E.J.; Clifton-Hadley, F.A.; Stallwood, A.D.; Davies, R.H.; Liebana, E. BlaCTX-M Genes in Clinical Salmonella Isolates Recovered from Humans in England and Wales from 1992 to 2003. Antimicrob. Agents Chemother. 2005, 49, 1319–1322. [Google Scholar] [CrossRef] [PubMed]
- Szczepanowski, R.; Linke, B.; Krahn, I.; Gartemann, K.-H.; Gützkow, T.; Eichler, W.; Pühler, A.; Schlüter, A. Detection of 140 Clinically Relevant Antibiotic-Resistance Genes in the Plasmid Metagenome of Wastewater Treatment Plant Bacteria Showing Reduced Susceptibility to Selected Antibiotics. Microbiology 2009, 155, 2306–2319. [Google Scholar] [CrossRef] [PubMed]
- Cattoir, V.; Poirel, L.; Rotimi, V.; Soussy, C.-J.; Nordmann, P. Multiplex PCR for Detection of Plasmid-Mediated Quinolone Resistance Qnr Genes in ESBL-Producing Enterobacterial Isolates. J. Antimicrob. Chemother. 2007, 60, 394–397. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.; Li, L.; Ashbolt, N.; Wang, X.; Cui, Y.; Zhu, X.; Xu, Y.; Yang, Y.; Mao, D.; Luo, Y. Arctic Antibiotic Resistance Gene Contamination, a Result of Anthropogenic Activities and Natural Origin. Sci. Total Environ. 2018, 621, 1176–1184. [Google Scholar] [CrossRef]
- Walsh, F.; Ingenfeld, A.; Zampicolli, M.; Hilber-Bodmer, M.; Frey, J.E.; Duffy, B. Real-Time PCR Methods for Quantitative Monitoring of Streptomycin and Tetracycline Resistance Genes in Agricultural Ecosystems. J. Microbiol. Methods 2011, 86, 150–155. [Google Scholar] [CrossRef]
- Morley, P.S. Surveillance for Nosocomial Infections in Veterinary Hospitals. Vet. Clin. N. Am. Equine Pract. 2004, 20, 561–576, vi–vii. [Google Scholar] [CrossRef]
Figure 1.
Share (%) of resistant (R) and susceptible (S) Gram-negative bacterial strains ((A)—Enterobacterales; (B)—Pseudomonas; (C)—Acinetobacter) isolated from wounds of companion animals. CN—gentamycin; SXT—trimethoprim/sulfamethoxazole; CTX—cefotaxime; AK—amikacin; AMC—amoxicillin/clavulanic acid; CAZ—ceftazidime; ENR—enrofloxacin; AMP—ampicillin; IMP—imipenem; TY—tylosin; TZP—piperacillin/tazobactam; ESBL—extended-spectrum-beta-lactamase-producing strains of Enterobacterales.
Figure 1.
Share (%) of resistant (R) and susceptible (S) Gram-negative bacterial strains ((A)—Enterobacterales; (B)—Pseudomonas; (C)—Acinetobacter) isolated from wounds of companion animals. CN—gentamycin; SXT—trimethoprim/sulfamethoxazole; CTX—cefotaxime; AK—amikacin; AMC—amoxicillin/clavulanic acid; CAZ—ceftazidime; ENR—enrofloxacin; AMP—ampicillin; IMP—imipenem; TY—tylosin; TZP—piperacillin/tazobactam; ESBL—extended-spectrum-beta-lactamase-producing strains of Enterobacterales.
Figure 2.
Share (%) of resistant (R) and susceptible (S) Gram-positive bacterial strains ((A)—Enterococcus; (B)—Staphylococcus) isolated from wounds of companion animals. AMP—ampicillin; CN—gentamycin; DA—clindamycin; E—erythromycin; IMP—imipenem; ENR—enrofloxacin; FOX—cefoxitin; SXT—trimethoprim/sulfamethoxazole; TGC—tigecycline; TE—tetracycline; TY—tylosin; MSb—resistance mechanisms to macrolides and streptogramins b; MLSb ind—inducible mechanisms of resistance to macrolides, lincosamids, and streptogramins b; MLSb const—constitutive mechanisms of resistance to macrolides, lincosamids, and streptogramins b.
Figure 2.
Share (%) of resistant (R) and susceptible (S) Gram-positive bacterial strains ((A)—Enterococcus; (B)—Staphylococcus) isolated from wounds of companion animals. AMP—ampicillin; CN—gentamycin; DA—clindamycin; E—erythromycin; IMP—imipenem; ENR—enrofloxacin; FOX—cefoxitin; SXT—trimethoprim/sulfamethoxazole; TGC—tigecycline; TE—tetracycline; TY—tylosin; MSb—resistance mechanisms to macrolides and streptogramins b; MLSb ind—inducible mechanisms of resistance to macrolides, lincosamids, and streptogramins b; MLSb const—constitutive mechanisms of resistance to macrolides, lincosamids, and streptogramins b.
Figure 3.
Positive results of the PCR test for the exemplary bacterial isolates, the three most frequently detected genes in Gram-positive and Gram-negative bacteria. Lanes marked as M—DNA Marker 3 (A&A Biotechnology, Poland, Gdańsk); lanes 1–17 (A), 1–15 (B) and 1–18 (C)—bacterial DNA isolates; lanes 2, 5, 7, 8, 12, 14–17—DNA bands of searched length, confirming the presence of strA gene (A); lanes 1, 3–6, 9–14—DNA bands of searched length, confirming the presence of sul3 gene (B); lanes 5–7 and 13–18—DNA bands of searched length, confirming the presence of blaTEM gene.
Figure 3.
Positive results of the PCR test for the exemplary bacterial isolates, the three most frequently detected genes in Gram-positive and Gram-negative bacteria. Lanes marked as M—DNA Marker 3 (A&A Biotechnology, Poland, Gdańsk); lanes 1–17 (A), 1–15 (B) and 1–18 (C)—bacterial DNA isolates; lanes 2, 5, 7, 8, 12, 14–17—DNA bands of searched length, confirming the presence of strA gene (A); lanes 1, 3–6, 9–14—DNA bands of searched length, confirming the presence of sul3 gene (B); lanes 5–7 and 13–18—DNA bands of searched length, confirming the presence of blaTEM gene.
Figure 4.
Typical culture characteristics and colors of the bacteria analyzed in this study. (A) UTI medium E. coli—pink/purple, P. aeruginosa—brown translucent, and S. aureus—yellow; (B) E. faecalis—turquoise, K. pneumoniae—dark blue; (C) haemolytic Streptococcus spp. on Columbia CAN with 5% sheep blood and (D) S. aureus on Baird-Parker medium.
Figure 4.
Typical culture characteristics and colors of the bacteria analyzed in this study. (A) UTI medium E. coli—pink/purple, P. aeruginosa—brown translucent, and S. aureus—yellow; (B) E. faecalis—turquoise, K. pneumoniae—dark blue; (C) haemolytic Streptococcus spp. on Columbia CAN with 5% sheep blood and (D) S. aureus on Baird-Parker medium.
Table 1.
Genera of bacteria isolated from wounds of companion animals (n = 136).
| Gram-negative (n = 65; 47.79%) | ||
| Genus | Number | Percentage |
| Acinetobacter | 10 | 7.35 |
| Aeromonas | 1 | 0.74 |
| Brevundimonas | 2 | 1.47 |
| Citrobacter | 3 | 2.21 |
| Enterobacter | 3 | 2.21 |
| Escherichia | 11 | 8.09 |
| Hafnia | 1 | 0.74 |
| Klebsiella | 3 | 2.21 |
| Leclercia | 1 | 0.74 |
| Pantoea | 3 | 2.21 |
| Moraxella | 1 | 0.74 |
| Proteus | 8 | 5.88 |
| Pseudomonas | 9 | 6.62 |
| Psychrobacter | 3 | 2.21 |
| Serratia | 4 | 2.94 |
| Stenotrophomonas | 2 | 1.47 |
| Gram-positive (n = 71; 52.21%) | ||
| Bacillus | 1 | 0.74 |
| Curtobacterium | 1 | 0.74 |
| Enterococcus | 17 | 12.50 |
| Kocuria | 1 | 0.74 |
| Lactococcus | 1 | 0.74 |
| Lysinibacillus | 1 | 0.74 |
| Macrococcus | 1 | 0.74 |
| Micrococcus | 1 | 0.74 |
| Microbacterium | 4 | 2.94 |
| Peribacillus | 1 | 0.74 |
| Staphylococcus | 37 | 27.21 |
| Streptococcus | 5 | 3.68 |
Table 2.
The resistance profile in the dominant groups of bacteria isolated from wounds of companion animals; 0–8: number of antibiotics bacteria in different groups were resistant to *.
Table 2.
The resistance profile in the dominant groups of bacteria isolated from wounds of companion animals; 0–8: number of antibiotics bacteria in different groups were resistant to *.
| Number of Antibiotics Bacteria Are Resistant to (n, %) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Group of Bacteria | 0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | MDR |
| Enterobacterales (n = 38) | 3 (7.9) | 2 (5.3) | 12 (31.6) | 7 (18.4) | 6 (15.8) | 3 (7.9) | 2 (5.3) | 2 (5.3) | 1 (2.6) | 16 (42.1) |
| Pseudomonas (n = 7) | 0 | 0 | 0 | 1 | 0 | 3 (42.9) | 3 (42.9) | 0 | 0 | 7 (100) |
| Acinetobacter (n = 9) | 0 | 5 (55.6) | 1 (11.1) | 1 (11.1) | 1 (11.1) | 1 (11.1) | 0 | - | - | 3 (33.3) |
| Enterococcus (n = 15) | 0 | 3 (20.0) | 3 (20.0) | 2 (13.3) | 7 (46.7) | 0 | - | - | - | 9 (60) |
| Staphylococcus (n = 51) | 14 (27.5) | 15 (29.4) | 8 (15.7) | 3 (5.9) | 5 (9.8) | 0 | 3 (5.9) | 3 (5.9) | 0 | 14 (27.5) |
* Values in the table show the number and percentage (in brackets) of bacteria resistant to different numbers of antimicrobial agents. For example, in Enterobacterales, there were three (7.9%) bacteria susceptible to all antibiotics tested. Two (5.3%) bacteria were resistant to one antibiotic, 12 (31.6%) bacteria were resistant to two antimicrobials, etc. One isolate of Enterobacterales (comprising 2.6%) was resistant to a total of eight antibiotics.
Table 3.
Positive results for Gram-positive (n = 59) bacteria isolated from cats (n = 25) and dogs (n = 34).
Table 3.
Positive results for Gram-positive (n = 59) bacteria isolated from cats (n = 25) and dogs (n = 34).
| Animal | n (%) | |||||
|---|---|---|---|---|---|---|
| mecA | msrA | lnuA | strA | tetK | sul3 | |
| Cat | 0 | 3 (12) | 0 | 7 (28) | 6 (21.4) | 6 (21.4) |
| Dog | 4 (11.8) | 1 (2.9) | 4 (11.8) | 10 (29.4) | 3 (8.8) | 3 (8.8) |
Table 4.
Positive results for Gram-negative (n = 49) bacteria isolated from cats (n = 12), dogs (n = 33), and rabbits (n = 4).
Table 4.
Positive results for Gram-negative (n = 49) bacteria isolated from cats (n = 12), dogs (n = 33), and rabbits (n = 4).
| Animal | n (%) | ||||||
|---|---|---|---|---|---|---|---|
| blaTEM | blaSHV | blaCTX-M | blaOXA-1 | sul3 | qnrD | strA | |
| Cat | 3 (25) | 0 | 1 (8.3) | 0 | 3 (25) | 0 | 1 (8.3) |
| Dog | 10 (30.3) | 3 (9.1) | 1 (3) | 1 (3) | 2 (6.1) | 0 | 10 (30.3) |
| Rabbit | 0 | 1 (25) | 0 | 0 | 0 | 0 | 1 (25) |
Table 5.
Selected phenotypic and molecular resistance profiles of canine and feline bacteria isolated from wounds.
Table 5.
Selected phenotypic and molecular resistance profiles of canine and feline bacteria isolated from wounds.
| Origin | Species | Phenotype of Resistance (Antibiotic Class) | Resistance Genes (Type of Resistance) |
|---|---|---|---|
| feline | Enterococcus faecalis | IMP (β-lactam-carbapenem) ENR (fluoroquinolone) TGC (tetracycline) TY (macrolide) | mecA (methicillin) msrA (macrolides) lnuA (lincosamides) tetK (tetracyclines) |
| canine | Enterococcus faecalis | IMP (β-lactam-carbapenem) ENR (fluoroquinolone) TGC (tetracycline) TY (macrolide) | msrA (macrolides) strA (aminoglycosides) tetK (tetracyclines) sul3 (sulfonamides) |
| canine | Staphylococcus sciuri | - | lnuA (lincosamides) strA (aminoglycosides) tetK (tetracyclines) |
| canine | Staphylococus pseudintermedius | TE (tetracycline) DA (lincosamide) E (macrolide) SXT (diaminopyrimidines/sulfonamide) ENR (fluoroquinolone) CN (aminoglycoside) TY (macrolide) | lnuA (lincosamides) strA (aminoglycosides) tetK (tetracyclines) |
| canine | Escherichia coli | CN (aminoglycoside) AMC (β-lactam/β-lactamase inhibitor) AMP (β-lactam-aminopenicillin) IMP (β-lactam-carbapenem) | blaTEM (ESBL) blaSHV (ESBL) strA (aminoglycosides) |
| canine | Escherichia coli | CTX (β-lactam–3rd gen. cephalosporin) AMC (β-lactam/β-lactamase inhibitor) CAZ (β-lactam–3rd gen. cephalosporin) AMP (β-lactam-aminopenicillin) TY (macrolide) | blaTEM (ESBL) blaSHV (ESBL) strA (aminoglycosides) |
| canine | Proteus mirabilis | CN (aminoglycoside) SXT (diaminopyrimidines/sulfonamide) CTX (β-lactam–3rd gen. cephalosporin) AMC (β-lactam/β-lactamase inhibitor) CAZ (β-lactam–3rd gen. cephalosporin) ENR (fluoroquinolone) AMP (β-lactam-aminopenicillin) IMP (β-lactam/carbapenem) | blaTEM (ESBL) blaOXA-1 (ESBL-carbapenems) strA (aminoglycosides) |
Table 6.
Antimicrobial susceptibility tests according to groups of bacteria.
| Enterobacterales (E. coli, Klebsiella, Proteus, Enterobacter) | Pseudomonas | Acinetobacter | Enterococcus | Staphylococcus | |
|---|---|---|---|---|---|
| No of strains in total | 38 | 7 | 9 | 15 | 51 |
| Cats | 7 | 1 | 3 | 5 | 21 |
| Dogs | 28 | 6 | 5 | 10 | 30 |
| Rabbit | 3 | 0 | 1 | 0 | 0 |
| antimicrobial disks abbreviations * | ENR | ENR | ENR | ENR | ENR |
| AMC (ESBL) ** | AMC (ESBL) ** | AK | AMP | E (MLSb) ** | |
| CAZ (ESBL) ** | CAZ (ESBL) ** | CN | MEM/IMP | DA (MLSb) ** | |
| CTX (ESBL) ** | CTX (ESBL) ** | MEM/IMP | TGC | FOX (MRS) ** | |
| AMP | AK | SXT | TY | CN | |
| CN | MEM/IMP | TY | SXT | ||
| SXT | TZP | TE | |||
| MEM/IMP | TY | TY | |||
| TY |
* ENR (enrofloxacin 5 µg), E (erythromycin 15 µg), DA (clindamycin 2 µg), FOX (cefoxitin 30 µg), CN (gentamicin 10 µg), SXT (trimethoprim/sulfamethoxazole 1.25/23.75 µg), TE (tetracycline 30 µg), TY (tylosin 30 µg), AMC (amoxicillin/clavulanic acid 20/10 µg), CAZ (ceftazidime 30 µg), CTX (cefotaxime 30 µg), AMP (ampicillin 10 µg), MEM (meropenem 10 µg), IMP (imipenem 10 µg), TZP (piperacillin/tazobactam 100/10 µg), TGC (tigecycline 15 µg). ** in brackets—mechanisms of resistance determined using the provided antimicrobial discs: ESBL—extended spectrum beta lactamases; MLSb—constitutive or inducible resistance to macrolides, lincosamids, and streptogramins b; MRS—methicillin resistance.
Table 7.
PCR primers used in the study.
| No. | Gene | Primer | Sequence (5′-3′) | Annealing Temp. (°C) | Product Length (bp) | Reference |
|---|---|---|---|---|---|---|
| 1. | msrA | msrA-F | GGCACAATAAGAGTGTTTAAAGG AAGTTATATCATGAATAGATTGTCCTGTT | 50 | 940 | [19] |
| msrA-R | ||||||
| 2. | ereA | ereA-F | AACACCCTGAACCCAAGGGACG CTTCACATCCGGATTCGCTCGA | 57 | 420 | [20] |
| ereA-R | ||||||
| 3. | lnuA | lnuA-F | GGTGGCTGGGGGGTAGATGTATTAACTGG GCTTCTTTTGAAATACATGGTATTTTTCGATC | 57 | 323 | [19] |
| lnuA-R | ||||||
| 4. | mecA | mecA-F | GTAGAAAATGACTGAACGTCCGATAA CAATTCCACATTGTTTCGGTCTAA | 55 | 310 | [21] |
| mecA-R | ||||||
| 5. | tetK | tetK-F | TCGATAGGAACAGCAGTA CAGCAGATCCTACTCCTT | 55 | 169 | [22] |
| tetK-R | ||||||
| 6. | blaTEM | blaTEM-F | ATTCTTGAAGACGAAAGGGC ACGCTCAGTGGAACGAAAAC | 60 | 1150 | [23] |
| blaTEM-R | ||||||
| 7. | blaSHV | blaSHV-F | CACTCAAGGATGTATTGTG TTAGCGTTGCCAGTGCTCG | 52 | 885 | [23] |
| blaSHV-R | ||||||
| 8. | blaCTX-M | blaCTX-M-F | CGATGTGCAGTACCAGTAA TTAGTGACCAGAATCAGCGG | 55 | 585 | [24] |
| blaCTX-M-R | ||||||
| 9. | blaOXA-1 | blaOXA-1-F | ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC | 61 | 813 | [23] |
| blaOXA-1-R | ||||||
| 10. | sul3 | sul3-F | ACCACCGATAGTTTTTCCGA TGCCTTTTTCTTTTAAAGCC | 62 | 199 | [25] |
| sul3-R | ||||||
| 11. | qnrA | qnrA-F | GGGTATGGATATTATTGATAAAG CTAATCCGGCAGCACTATTA | 55 | 580 | [26] |
| qnrA-R | ||||||
| 12. | qnrD | qnrD-F | AGTGAGTGTTTAGCTCAAGGAG CAGTGCCATTCCAGCGATT | 53 | 175 | [27] |
| qnrD-R | ||||||
| 13. | strA | strA-F | TCAATCCCGACTTCTTACCG CACCATGGCAAACAACCATA | 52 | 126 | [28] |
| strA-R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Lenart-Boroń, A.; Stankiewicz, K.; Czernecka, N.; Ratajewicz, A.; Bulanda, K.; Heliasz, M.; Sosińska, D.; Dworak, K.; Ciesielska, D.; Siemińska, I.; et al. Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection. Int. J. Mol. Sci. 2024, 25, 3121. https://doi.org/10.3390/ijms25063121
AMA Style
Lenart-Boroń A, Stankiewicz K, Czernecka N, Ratajewicz A, Bulanda K, Heliasz M, Sosińska D, Dworak K, Ciesielska D, Siemińska I, et al. Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection. International Journal of Molecular Sciences. 2024; 25(6):3121. https://doi.org/10.3390/ijms25063121
Chicago/Turabian StyleLenart-Boroń, Anna, Klaudia Stankiewicz, Natalia Czernecka, Anna Ratajewicz, Klaudia Bulanda, Miłosz Heliasz, Daria Sosińska, Kinga Dworak, Dominika Ciesielska, Izabela Siemińska, and et al. 2024. "Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection" International Journal of Molecular Sciences 25, no. 6: 3121. https://doi.org/10.3390/ijms25063121
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
