Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Collection of Samples
4.2. Isolation and Identification of Bacteria
4.3. Antibacterial Susceptibility Tests
4.4. Assessment of Genes Conferring the Bacterial Resistance to Different Groups of Antimicrobials
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Marco-Fuertes, A.; Marin, C.; Lorenzo-Rebenaque, L.; Vega, S.; Montoro-Dasi, L. Antimicrobial Resistance in Companion Animals: A New Challenge for the One Health Approach in the European Union. Vet. Sci. 2022, 9, 208. [Google Scholar] [CrossRef]
- Pomba, C.; Rantala, M.; Greko, C.; Baptiste, K.E.; Catry, B.; van Duijkeren, E.; Mateus, A.; Moreno, M.A.; Pyörälä, S.; Ružauskas, M.; et al. Public Health Risk of Antimicrobial Resistance Transfer from Companion Animals. J. Antimicrob. Chemother. 2017, 72, 957–968. [Google Scholar] [CrossRef]
- Kožár, M.; Hamilton, H.; Koščová, J. Types of Wounds and the Prevalence of Bacterial Contamination of Wounds in the Clinical Practice of Small Animals. Folia Vet. 2018, 62, 39–47. [Google Scholar] [CrossRef]
- Windahl, U.; Bengtsson, B.; Nyman, A.K.; Holst, B.S. The Distribution of Pathogens and Their Antimicrobial Susceptibility Patterns among Canine Surgical Wound Infections in Sweden in Relation to Different Risk Factors. Acta Vet. Scand. 2015, 57, 11. [Google Scholar] [CrossRef]
- Scott Weese, J. Antimicrobial Resistance in Companion Animals. Anim. Health Res. Rev. 2008, 9, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Fernández, R.; Durán, I.; Molina-López, R.A.; Darwich, L. Antimicrobial Resistance in Bacteria Isolated From Cats and Dogs From the Iberian Peninsula. Front. Microbiol. 2021, 11, 621597. [Google Scholar] [CrossRef]
- Pires Dos Santos, T.; Damborg, P.; Moodley, A.; Guardabassi, L. Systematic Review on Global Epidemiology of Methicillin-Resistant Staphylococcus Pseudintermedius: Inference of Population Structure from Multilocus Sequence Typing Data. Front. Microbiol. 2016, 7, 1599. [Google Scholar] [CrossRef] [PubMed]
- Guardabassi, L.; Schwarz, S.; Lloyd, D.H. Pet Animals as Reservoirs of Antimicrobial-Resistant Bacteria: Review. J. Antimicrob. Chemother. 2004, 54, 321–332. [Google Scholar] [CrossRef]
- Caneschi, A.; Bardhi, A.; Barbarossa, A.; Zaghini, A. The Use of Antibiotics and Antimicrobial Resistance in Veterinary Medicine, a Complex Phenomenon: A Narrative Review. Antibiotics 2023, 12, 487. [Google Scholar] [CrossRef]
- Ganière, J.P.; Médaille, C.; Limet, A.; Ruvoen, N.; André-Fontaine, G. Antimicrobial Activity of Enrofloxacin against Staphylococcus Intermedius Strains Isolated from Canine Pyodermas. Vet. Dermatol. 2001, 12, 171–175. [Google Scholar] [CrossRef]
- Actor, J.K. 12—Clinical Bacteriology. In Elsevier’s Integrated Review Immunology and Microbiology, 2nd ed.; W.B. Saunders: Philadelphia, PA, USA, 2012; pp. 105–120. ISBN 978-0-323-07447-6. [Google Scholar]
- Carvalho, A.C.; Barbosa, A.V.; Arais, L.R.; Ribeiro, P.F.; Carneiro, V.C.; Cerqueira, A.M.F. Resistance Patterns, ESBL Genes, and Genetic Relatedness of Escherichia Coli from Dogs and Owners. Braz. J. Microbiol. 2016, 47, 150–158. [Google Scholar] [CrossRef]
- Akhtardanesh, B.; Ghanbarpour, R.; Ganjalikhani, S.; Gazanfari, P. Determination of Antibiotic Resistance Genes in Relation to Phylogenetic Background in Escherichia Coli Isolates from Fecal Samples of Healthy Pet Cats in Kerman City. Vet. Res. Forum Int. Q. J. 2016, 7, 301–308. [Google Scholar]
- Lenart-Boron, A.; Augustyniak, K.; Boron, P. Screening of Antimicrobial Resistance and Molecular Detection of Fluoroquinolone Resistance Mechanisms in Chicken Faeces-Derived Escherichia Coli. Vet. Med. 2016, 61, 80–89. [Google Scholar] [CrossRef]
- Gniadkowski, M.; Żabicka, D.; Hryniewicz, W. Rekomendacje Doboru Testów Do Oznaczania Wrażliwości Bakterii Na Antybiotyki i Chemioterapeutyki 2009 Oznaczanie Wrażliwo ś Ci Pałeczek Gram-Ujemnych; National Reference Center for Antimicrobial Susceptibility, National Institute of Medicines: Warsaw, Poland, 2009; pp. 1–29. [Google Scholar]
- Drieux, L.; Brossier, F.; Sougakoff, W.; Jarlier, V. Phenotypic Detection of Extended-Spectrum β-Lactamase Production in Enterobacteriaceae: Review and Bench Guide. Clin. Microbiol. Infect. 2008, 14, 90–103. [Google Scholar] [CrossRef]
- Fiebelkorn, K.R.; Crawford, S.A.; McElmeel, M.L.; Jorgensen, J.H. Practical Disk Diffusion Method for Detection of Inducible Clindamycin Resistance in Staphylococcus Aureus and Coagulase-Negative Staphylococci. J. Clin. Microbiol. 2003, 41, 4740–4744. [Google Scholar] [CrossRef]
- EUCAST European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. 2023, pp. 1–77. Available online: http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_5.0_Breakpoint_Table_01.pdf (accessed on 10 September 2023).
- Lina, G.; Quaglia, A.; Reverdy, M.E.; Leclercq, R.; Vandenesch, F.; Etienne, J. Distribution of Genes Encoding Resistance to Macrolides, Lincosamides, and Streptogramins among Staphylococci. Antimicrob. Agents Chemother. 1999, 43, 1062–1066. [Google Scholar] [CrossRef] [PubMed]
- Sutcliffe, J.; Grebe, T.; Tait-Kamradt, A.; Wondrack, L. Detection of Erythromycin-Resistant Determinants by PCR. Antimicrob. Agents Chemother. 1996, 40, 2562–2566. [Google Scholar] [CrossRef]
- Geha, D.J.; Uhl, J.R.; Gustaferro, C.A.; Persing, D.H. Multiplex PCR for Identification of Methicillin-Resistant Staphylococci in the Clinical Laboratory. J. Clin. Microbiol. 1994, 32, 1768–1772. [Google Scholar] [CrossRef]
- Pazda, M.; Rybicka, M.; Stolte, S.; Piotr Bielawski, K.; Stepnowski, P.; Kumirska, J.; Wolecki, D.; Mulkiewicz, E. Identification of Selected Antibiotic Resistance Genes in Two Different Wastewater Treatment Plant Systems in Poland: A Preliminary Study. Molecules 2020, 25, 2851. [Google Scholar] [CrossRef]
- Sáenz, Y.; Briñas, L.; Domínguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of Resistance in Multiple-Antibiotic-Resistant Escherichia Coli Strains of Human, Animal, and Food Origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef]
- Batchelor, M.; Hopkins, K.; Threlfall, E.J.; Clifton-Hadley, F.A.; Stallwood, A.D.; Davies, R.H.; Liebana, E. BlaCTX-M Genes in Clinical Salmonella Isolates Recovered from Humans in England and Wales from 1992 to 2003. Antimicrob. Agents Chemother. 2005, 49, 1319–1322. [Google Scholar] [CrossRef] [PubMed]
- Szczepanowski, R.; Linke, B.; Krahn, I.; Gartemann, K.-H.; Gützkow, T.; Eichler, W.; Pühler, A.; Schlüter, A. Detection of 140 Clinically Relevant Antibiotic-Resistance Genes in the Plasmid Metagenome of Wastewater Treatment Plant Bacteria Showing Reduced Susceptibility to Selected Antibiotics. Microbiology 2009, 155, 2306–2319. [Google Scholar] [CrossRef] [PubMed]
- Cattoir, V.; Poirel, L.; Rotimi, V.; Soussy, C.-J.; Nordmann, P. Multiplex PCR for Detection of Plasmid-Mediated Quinolone Resistance Qnr Genes in ESBL-Producing Enterobacterial Isolates. J. Antimicrob. Chemother. 2007, 60, 394–397. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.; Li, L.; Ashbolt, N.; Wang, X.; Cui, Y.; Zhu, X.; Xu, Y.; Yang, Y.; Mao, D.; Luo, Y. Arctic Antibiotic Resistance Gene Contamination, a Result of Anthropogenic Activities and Natural Origin. Sci. Total Environ. 2018, 621, 1176–1184. [Google Scholar] [CrossRef]
- Walsh, F.; Ingenfeld, A.; Zampicolli, M.; Hilber-Bodmer, M.; Frey, J.E.; Duffy, B. Real-Time PCR Methods for Quantitative Monitoring of Streptomycin and Tetracycline Resistance Genes in Agricultural Ecosystems. J. Microbiol. Methods 2011, 86, 150–155. [Google Scholar] [CrossRef]
- Morley, P.S. Surveillance for Nosocomial Infections in Veterinary Hospitals. Vet. Clin. N. Am. Equine Pract. 2004, 20, 561–576, vi–vii. [Google Scholar] [CrossRef]





| Gram-negative (n = 65; 47.79%) | ||
| Genus | Number | Percentage |
| Acinetobacter | 10 | 7.35 |
| Aeromonas | 1 | 0.74 |
| Brevundimonas | 2 | 1.47 |
| Citrobacter | 3 | 2.21 |
| Enterobacter | 3 | 2.21 |
| Escherichia | 11 | 8.09 |
| Hafnia | 1 | 0.74 |
| Klebsiella | 3 | 2.21 |
| Leclercia | 1 | 0.74 |
| Pantoea | 3 | 2.21 |
| Moraxella | 1 | 0.74 |
| Proteus | 8 | 5.88 |
| Pseudomonas | 9 | 6.62 |
| Psychrobacter | 3 | 2.21 |
| Serratia | 4 | 2.94 |
| Stenotrophomonas | 2 | 1.47 |
| Gram-positive (n = 71; 52.21%) | ||
| Bacillus | 1 | 0.74 |
| Curtobacterium | 1 | 0.74 |
| Enterococcus | 17 | 12.50 |
| Kocuria | 1 | 0.74 |
| Lactococcus | 1 | 0.74 |
| Lysinibacillus | 1 | 0.74 |
| Macrococcus | 1 | 0.74 |
| Micrococcus | 1 | 0.74 |
| Microbacterium | 4 | 2.94 |
| Peribacillus | 1 | 0.74 |
| Staphylococcus | 37 | 27.21 |
| Streptococcus | 5 | 3.68 |
| Number of Antibiotics Bacteria Are Resistant to (n, %) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Group of Bacteria | 0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | MDR |
| Enterobacterales (n = 38) | 3 (7.9) | 2 (5.3) | 12 (31.6) | 7 (18.4) | 6 (15.8) | 3 (7.9) | 2 (5.3) | 2 (5.3) | 1 (2.6) | 16 (42.1) |
| Pseudomonas (n = 7) | 0 | 0 | 0 | 1 | 0 | 3 (42.9) | 3 (42.9) | 0 | 0 | 7 (100) |
| Acinetobacter (n = 9) | 0 | 5 (55.6) | 1 (11.1) | 1 (11.1) | 1 (11.1) | 1 (11.1) | 0 | - | - | 3 (33.3) |
| Enterococcus (n = 15) | 0 | 3 (20.0) | 3 (20.0) | 2 (13.3) | 7 (46.7) | 0 | - | - | - | 9 (60) |
| Staphylococcus (n = 51) | 14 (27.5) | 15 (29.4) | 8 (15.7) | 3 (5.9) | 5 (9.8) | 0 | 3 (5.9) | 3 (5.9) | 0 | 14 (27.5) |
| Animal | n (%) | |||||
|---|---|---|---|---|---|---|
| mecA | msrA | lnuA | strA | tetK | sul3 | |
| Cat | 0 | 3 (12) | 0 | 7 (28) | 6 (21.4) | 6 (21.4) |
| Dog | 4 (11.8) | 1 (2.9) | 4 (11.8) | 10 (29.4) | 3 (8.8) | 3 (8.8) |
| Animal | n (%) | ||||||
|---|---|---|---|---|---|---|---|
| blaTEM | blaSHV | blaCTX-M | blaOXA-1 | sul3 | qnrD | strA | |
| Cat | 3 (25) | 0 | 1 (8.3) | 0 | 3 (25) | 0 | 1 (8.3) |
| Dog | 10 (30.3) | 3 (9.1) | 1 (3) | 1 (3) | 2 (6.1) | 0 | 10 (30.3) |
| Rabbit | 0 | 1 (25) | 0 | 0 | 0 | 0 | 1 (25) |
| Origin | Species | Phenotype of Resistance (Antibiotic Class) | Resistance Genes (Type of Resistance) |
|---|---|---|---|
| feline | Enterococcus faecalis | IMP (β-lactam-carbapenem) ENR (fluoroquinolone) TGC (tetracycline) TY (macrolide) | mecA (methicillin) msrA (macrolides) lnuA (lincosamides) tetK (tetracyclines) |
| canine | Enterococcus faecalis | IMP (β-lactam-carbapenem) ENR (fluoroquinolone) TGC (tetracycline) TY (macrolide) | msrA (macrolides) strA (aminoglycosides) tetK (tetracyclines) sul3 (sulfonamides) |
| canine | Staphylococcus sciuri | - | lnuA (lincosamides) strA (aminoglycosides) tetK (tetracyclines) |
| canine | Staphylococus pseudintermedius | TE (tetracycline) DA (lincosamide) E (macrolide) SXT (diaminopyrimidines/sulfonamide) ENR (fluoroquinolone) CN (aminoglycoside) TY (macrolide) | lnuA (lincosamides) strA (aminoglycosides) tetK (tetracyclines) |
| canine | Escherichia coli | CN (aminoglycoside) AMC (β-lactam/β-lactamase inhibitor) AMP (β-lactam-aminopenicillin) IMP (β-lactam-carbapenem) | blaTEM (ESBL) blaSHV (ESBL) strA (aminoglycosides) |
| canine | Escherichia coli | CTX (β-lactam–3rd gen. cephalosporin) AMC (β-lactam/β-lactamase inhibitor) CAZ (β-lactam–3rd gen. cephalosporin) AMP (β-lactam-aminopenicillin) TY (macrolide) | blaTEM (ESBL) blaSHV (ESBL) strA (aminoglycosides) |
| canine | Proteus mirabilis | CN (aminoglycoside) SXT (diaminopyrimidines/sulfonamide) CTX (β-lactam–3rd gen. cephalosporin) AMC (β-lactam/β-lactamase inhibitor) CAZ (β-lactam–3rd gen. cephalosporin) ENR (fluoroquinolone) AMP (β-lactam-aminopenicillin) IMP (β-lactam/carbapenem) | blaTEM (ESBL) blaOXA-1 (ESBL-carbapenems) strA (aminoglycosides) |
| Enterobacterales (E. coli, Klebsiella, Proteus, Enterobacter) | Pseudomonas | Acinetobacter | Enterococcus | Staphylococcus | |
|---|---|---|---|---|---|
| No of strains in total | 38 | 7 | 9 | 15 | 51 |
| Cats | 7 | 1 | 3 | 5 | 21 |
| Dogs | 28 | 6 | 5 | 10 | 30 |
| Rabbit | 3 | 0 | 1 | 0 | 0 |
| antimicrobial disks abbreviations * | ENR | ENR | ENR | ENR | ENR |
| AMC (ESBL) ** | AMC (ESBL) ** | AK | AMP | E (MLSb) ** | |
| CAZ (ESBL) ** | CAZ (ESBL) ** | CN | MEM/IMP | DA (MLSb) ** | |
| CTX (ESBL) ** | CTX (ESBL) ** | MEM/IMP | TGC | FOX (MRS) ** | |
| AMP | AK | SXT | TY | CN | |
| CN | MEM/IMP | TY | SXT | ||
| SXT | TZP | TE | |||
| MEM/IMP | TY | TY | |||
| TY |
| No. | Gene | Primer | Sequence (5′-3′) | Annealing Temp. (°C) | Product Length (bp) | Reference |
|---|---|---|---|---|---|---|
| 1. | msrA | msrA-F | GGCACAATAAGAGTGTTTAAAGG AAGTTATATCATGAATAGATTGTCCTGTT | 50 | 940 | [19] |
| msrA-R | ||||||
| 2. | ereA | ereA-F | AACACCCTGAACCCAAGGGACG CTTCACATCCGGATTCGCTCGA | 57 | 420 | [20] |
| ereA-R | ||||||
| 3. | lnuA | lnuA-F | GGTGGCTGGGGGGTAGATGTATTAACTGG GCTTCTTTTGAAATACATGGTATTTTTCGATC | 57 | 323 | [19] |
| lnuA-R | ||||||
| 4. | mecA | mecA-F | GTAGAAAATGACTGAACGTCCGATAA CAATTCCACATTGTTTCGGTCTAA | 55 | 310 | [21] |
| mecA-R | ||||||
| 5. | tetK | tetK-F | TCGATAGGAACAGCAGTA CAGCAGATCCTACTCCTT | 55 | 169 | [22] |
| tetK-R | ||||||
| 6. | blaTEM | blaTEM-F | ATTCTTGAAGACGAAAGGGC ACGCTCAGTGGAACGAAAAC | 60 | 1150 | [23] |
| blaTEM-R | ||||||
| 7. | blaSHV | blaSHV-F | CACTCAAGGATGTATTGTG TTAGCGTTGCCAGTGCTCG | 52 | 885 | [23] |
| blaSHV-R | ||||||
| 8. | blaCTX-M | blaCTX-M-F | CGATGTGCAGTACCAGTAA TTAGTGACCAGAATCAGCGG | 55 | 585 | [24] |
| blaCTX-M-R | ||||||
| 9. | blaOXA-1 | blaOXA-1-F | ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC | 61 | 813 | [23] |
| blaOXA-1-R | ||||||
| 10. | sul3 | sul3-F | ACCACCGATAGTTTTTCCGA TGCCTTTTTCTTTTAAAGCC | 62 | 199 | [25] |
| sul3-R | ||||||
| 11. | qnrA | qnrA-F | GGGTATGGATATTATTGATAAAG CTAATCCGGCAGCACTATTA | 55 | 580 | [26] |
| qnrA-R | ||||||
| 12. | qnrD | qnrD-F | AGTGAGTGTTTAGCTCAAGGAG CAGTGCCATTCCAGCGATT | 53 | 175 | [27] |
| qnrD-R | ||||||
| 13. | strA | strA-F | TCAATCCCGACTTCTTACCG CACCATGGCAAACAACCATA | 52 | 126 | [28] |
| strA-R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lenart-Boroń, A.; Stankiewicz, K.; Czernecka, N.; Ratajewicz, A.; Bulanda, K.; Heliasz, M.; Sosińska, D.; Dworak, K.; Ciesielska, D.; Siemińska, I.; et al. Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection. Int. J. Mol. Sci. 2024, 25, 3121. https://doi.org/10.3390/ijms25063121
Lenart-Boroń A, Stankiewicz K, Czernecka N, Ratajewicz A, Bulanda K, Heliasz M, Sosińska D, Dworak K, Ciesielska D, Siemińska I, et al. Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection. International Journal of Molecular Sciences. 2024; 25(6):3121. https://doi.org/10.3390/ijms25063121
Chicago/Turabian StyleLenart-Boroń, Anna, Klaudia Stankiewicz, Natalia Czernecka, Anna Ratajewicz, Klaudia Bulanda, Miłosz Heliasz, Daria Sosińska, Kinga Dworak, Dominika Ciesielska, Izabela Siemińska, and et al. 2024. "Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection" International Journal of Molecular Sciences 25, no. 6: 3121. https://doi.org/10.3390/ijms25063121
APA StyleLenart-Boroń, A., Stankiewicz, K., Czernecka, N., Ratajewicz, A., Bulanda, K., Heliasz, M., Sosińska, D., Dworak, K., Ciesielska, D., Siemińska, I., & Tischner, M. (2024). Wounds of Companion Animals as a Habitat of Antibiotic-Resistant Bacteria That Are Potentially Harmful to Humans—Phenotypic, Proteomic and Molecular Detection. International Journal of Molecular Sciences, 25(6), 3121. https://doi.org/10.3390/ijms25063121

