Cisplatin Toxicity Causes Neutrophil-Mediated Inflammation in Zebrafish Larvae
Abstract
1. Introduction
2. Results
2.1. Cisplatin Induces Dose-Dependent Mortality
2.2. Cisplatin Reduces Movements and Induces Morphological Deformities in Larvae
2.3. Systemic Expression of Pro-Inflammatory Cytokines Is Increased after Exposure to Cisplatin
2.4. Neutrophil Frequency Is Increased after Exposure to Cisplatin
2.5. Cisplatin Generates a Decrease in Neutrophils in Pronephros
2.6. Cisplatin Exposure Induces Cell Death in the Pronephros
2.7. Cisplatin Induces Systemic Inflammation
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Analysis of the Survival of Zebrafish Larvae in Response to Cisplatin
4.3. Analysis of Locomotor Activity
4.4. Gene Expression Analysis
4.5. FACS Analysis
4.6. Quantification of Mean Fluorescence Intensity
4.7. Cell Death Assay
4.8. Systemic Inflammation Score
4.9. Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kiyota, N.; Tahara, M.; Mizusawa, J.; Kodaira, T.; Fujii, H.; Yamazaki, T.; Mitani, H.; Iwae, S.; Fujimoto, Y.; Onozawa, Y.; et al. Weekly Cisplatin Plus Radiation for Postoperative Head and Neck Cancer (JCOG1008): A Multicenter, Noninferiority, Phase II/III Randomized Controlled Trial. J. Clin. Oncol. 2022, 40, 1980–1990. [Google Scholar] [CrossRef] [PubMed]
- Tate Thigpen, J.; Blessing, J.A.; DeGeest, K.; Look, K.Y.; Homesley, H.D.; Gynecologic Oncology Group. Cisplatin as initial chemotherapy in ovarian carcinosarcomas: A Gynecologic Oncology Group study. Gynecol. Oncol. 2004, 93, 336–339. [Google Scholar] [CrossRef] [PubMed]
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef] [PubMed]
- Siddik, Z.H. Cisplatin: Mode of cytotoxic action and molecular basis of resistance. Oncogene 2003, 22, 7265–7279. [Google Scholar] [CrossRef] [PubMed]
- Gąsior-Głogowska, M.; Malek, K.; Zajac, G.; Baranska, M. A new insight into the interaction of cisplatin with DNA: ROA spectroscopic studies on the therapeutic effect of the drug. Analyst 2016, 141, 291–296. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Qu, Y.; Niu, X.L.; Sun, W.J.; Zhang, X.L.; Li, L.Z. Autocrine production of interleukin-8 confers cisplatin and paclitaxel resistance in ovarian cancer cells. Cytokine 2011, 56, 365–375. [Google Scholar] [CrossRef] [PubMed]
- Kiss, E.; Abdelwahab, E.H.M.M.; Steib, A.; Papp, E.; Torok, Z.; Jakab, L.; Smuk, G.; Sarosi, V.; Pongracz, J.E. Cisplatin treatment induced interleukin 6 and 8 production alters lung adenocarcinoma cell migration in an oncogenic mutation dependent manner. Respir. Res. 2020, 21, 120. [Google Scholar] [CrossRef]
- Faubel, S.; Lewis, E.C.; Reznikov, L.; Ljubanovic, D.; Hoke, T.S.; Somerset, H.; Oh, D.-J.; Lu, L.; Klein, C.L.; Dinarello, C.A.; et al. Cisplatin-induced acute renal failure is associated with an increase in the cytokines interleukin (IL)-1beta, IL-18, IL-6, and neutrophil infiltration in the kidney. J. Pharmacol. Exp. Ther. 2007, 322, 8–15. [Google Scholar] [CrossRef]
- Zhang, B.; Ramesh, G.; Norbury, C.C.; Reeves, W.B. Cisplatin-induced nephrotoxicity is mediated by tumor necrosis factor-alpha produced by renal parenchymal cells. Kidney Int. 2007, 72, 37–44. [Google Scholar] [CrossRef]
- de Oliveira, S.; Rosowski, E.E.; Huttenlocher, A. Neutrophil migration in infection and wound repair: Going forward in reverse. Nat. Rev. Immunol. 2016, 16, 378–391. [Google Scholar] [CrossRef]
- Tadagavadi, R.; Reeves, W.B. Neutrophils in Cisplatin AKI-Mediator or Marker? Kidney Int. 2017, 92, 11–13. [Google Scholar] [CrossRef] [PubMed]
- Humanes, B.; Camaño, S.; Lara, J.M.; Sabbisetti, V.; González-Nicolás, M.; Bonventre, J.V.; Tejedor, A.; Lázaro, A. Cisplatin-induced renal inflammation is ameliorated by cilastatin nephroprotection. Nephrol. Dial. Transplant. 2017, 32, 1645–1655. [Google Scholar] [CrossRef] [PubMed]
- Makrilia, N.; Syrigou, E.; Kaklamanos, I.; Manolopoulos, L.; Saif, M.W. Hypersensitivity reactions associated with platinum antineoplastic agents: A systematic review. Met. Based Drugs. 2010, 2010, 207084. [Google Scholar] [CrossRef] [PubMed]
- Karasawa, T.; Steyger, P.S. An integrated view of cisplatin-induced nephrotoxicity and ototoxicity. Toxicol. Lett. 2015, 237, 219–227. [Google Scholar] [CrossRef] [PubMed]
- Tchounwou, P.B.; Dasari, S.; Noubissi, F.K.; Ray, P.; Kumar, S. Advances in Our Understanding of the Molecular Mechanisms of Action of Cisplatin in Cancer Therapy. J. Exp. Pharmacol. 2021, 13, 303–328. [Google Scholar] [CrossRef] [PubMed]
- Amptoulach, S.; Tsavaris, N. Neurotoxicity caused by the treatment with platinum analogues. Chemother. Res. Pract. 2011, 2011, 843019. [Google Scholar] [CrossRef] [PubMed]
- Ishida, S.; Lee, J.; Thiele, D.J.; Herskowitz, I. Uptake of the anticancer drug cisplatin mediated by the copper transporter Ctr1 in yeast and mammals. Proc. Natl. Acad. Sci. USA. 2002, 99, 14298–14302. [Google Scholar] [CrossRef] [PubMed]
- Schoeberl, A.; Gutmann, M.; Theiner, S.; Corte-Rodríguez, M.; Braun, G.; Vician, P.; Berger, W.; Koellensperger, G. The copper transporter CTR1 and cisplatin accumulation at the single-cell level by LA-ICP-TOFMS. Front. Mol. Biosci. 2022, 9, 1055356. [Google Scholar] [CrossRef]
- Yimit, A.; Adebali, O.; Sancar, A.; Jiang, Y. Differential damage and repair of DNA-adducts induced by anti-cancer drug cisplatin across mouse organs. Nat. Commun. 2019, 10, 309. [Google Scholar] [CrossRef]
- Yu, W.; Chen, Y.; Dubrulle, J.; Stossi, F.; Putluri, V.; Sreekumar, A.; Berger, W.; Koellensperger, G. Cisplatin generates oxidative stress which is accompanied by rapid shifts in central carbon metabolism. Sci. Rep. 2018, 8, 4306. [Google Scholar] [CrossRef]
- Zhu, H.; Luo, H.; Zhang, W.; Shen, Z.; Hu, X.; Zhu, X. Molecular mechanisms of cisplatin resistance in cervical cancer. Drug Des. Devel Ther. 2016, 10, 1885–1895. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Ma, H.; Shao, J.; Wu, J.; Zhou, L.; Zhang, Z.; Wang, Y.; Huang, Z.; Ren, J.; Liu, S.; et al. A Role for Tubular Necroptosis in Cisplatin-Induced AKI. J. Am. Soc. Nephrol. 2015, 26, 2647–2658. [Google Scholar] [CrossRef] [PubMed]
- Ozkok, A.; Edelstein, C.L. Pathophysiology of cisplatin-induced acute kidney injury. BioMed Res. Int. 2014, 2014, 967826. [Google Scholar] [CrossRef] [PubMed]
- Solari, J.I.G.; Filippi-Chiela, E.; Pilar, E.S.; Nunes, V.; Gonzalez, E.A.; Figueiró, F.; Andrade, C.F.; Klamt, F. Damage-associated molecular patterns (DAMPs) related to immunogenic cell death are differentially triggered by clinically relevant chemotherapeutics in lung adenocarcinoma cells. BMC Cancer. 2020, 20, 474. [Google Scholar] [CrossRef] [PubMed]
- Sharp, C.N.; Siskind, L.J. Developing better mouse models to study cisplatin-induced kidney injury. Am. J. Physiol. Renal Physiol. 2017, 313, F835–F841. [Google Scholar] [CrossRef] [PubMed]
- Santoriello, C.; Zon, L.I. Hooked! Modeling human disease in zebrafish. J. Clin. Investig. 2012, 122, 2337–2343. [Google Scholar] [CrossRef] [PubMed]
- Delvecchio, C.; Tiefenbach, J.; Krause, H.M. The zebrafish: A powerful platform for in vivo, HTS drug discovery. Assay. Drug Dev. Technol. 2011, 9, 354–361. [Google Scholar] [CrossRef]
- Kim, M.J.; Moon, D.; Jung, S.; Lee, J.; Kim, J. Cisplatin nephrotoxicity is induced via poly(ADP-ribose) polymerase activation in adult zebrafish and mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2020, 318, R843–R854. [Google Scholar] [CrossRef]
- Wen, X.; Cui, L.; Morrisroe, S.; Maberry, D.; Emlet, D.; Watkins, S.; Hukriede, N.A.; Kellum, J.A. A zebrafish model of infection-associated acute kidney injury. Am. J. Physiol. Renal Physiol. 2018, 315, F291–F299. [Google Scholar] [CrossRef]
- Cianciolo Cosentino, C.; Roman, B.L.; Drummond, I.A.; Hukriede, N.A. Intravenous microinjections of zebrafish larvae to study acute kidney injury. J. Vis. Exp. 2010, 42, e2079. [Google Scholar]
- Hentschel, D.M.; Park, K.M.; Cilenti, L.; Zervos, A.S.; Drummond, I.; Bonventre, J.V. Acute renal failure in zebrafish: A novel system to study a complex disease. Am. J. Physiol. Renal Physiol. 2005, 288, F923–F929. [Google Scholar] [CrossRef]
- Trede, N.S.; Langenau, D.M.; Traver, D.; Look, A.T.; Zon, L.I. The use of zebrafish to understand immunity. Immunity 2004, 20, 367–379. [Google Scholar] [CrossRef]
- Fénero, C.M.; Padovani, B.N.; do Amaral, M.A.; de Barros, G.J.B.; de Oliveira, I.K.X.; Hiyane, M.I.; Camâra, N.O.S. Acute Kidney Injury Model Induced by Cisplatin in Adult Zebrafish. J. Vis. Exp. 2021, 171, e61575. [Google Scholar]
- de Almeida, D.C.; Bassi, Ê.; Azevedo, H.; Anderson, L.; Origassa, C.S.; Cenedeze, M.A.; de Andrade-Oliveira, V.; Felizardo, R.J.F.; Felizardo, R.J.F.; da Silva, R.C.; et al. A Regulatory miRNA-mRNA Network Is Associated with Tissue Repair Induced by Mesenchymal Stromal Cells in Acute Kidney Injury. Front. Immunol. 2016, 7, 645. [Google Scholar] [CrossRef] [PubMed]
- Perše, M. Cisplatin Mouse Models: Treatment, Toxicity and Translatability. Biomedicines 2021, 9, 1406. [Google Scholar] [CrossRef] [PubMed]
- Matsushima, K.; Yang, D.; Oppenheim, J.J. Interleukin-8: An evolving chemokine. Cytokine 2022, 153, 155828. [Google Scholar] [CrossRef] [PubMed]
- Volarevic, V.; Djokovic, B.; Jankovic, M.G.; Harrell, C.R.; Fellabaum, C.; Djonov, V.; Arsenijevic, N. Molecular mechanisms of cisplatin-induced nephrotoxicity: A balance on the knife edge between renoprotection and tumor toxicity. J. Biomed. Sci. 2019, 26, 25. [Google Scholar] [CrossRef] [PubMed]
- Barros, T.P.; Alderton, W.K.; Reynolds, H.M.; Roach, A.G.; Berghmans, S. Zebrafish: An emerging technology for in vivo pharmacological assessment to identify potential safety liabilities in early drug discovery. Br. J. Pharmacol. 2008, 154, 1400–1413. [Google Scholar] [CrossRef]
- van den Bent, M.J.; van Putten, W.L.; Hilkens, P.H.; de Wit, R.; van der Burg, M.E. Retreatment with dose-dense weekly cisplatin after previous cisplatin chemotherapy is not complicated by significant neuro-toxicity. Eur. J. Cancer. 2002, 38, 387–391. [Google Scholar] [CrossRef]
- Perše, M.; Večerić-Haler, Ž. Cisplatin-Induced Rodent Model of Kidney Injury: Characteristics and Challenges. BioMed Res. Int. 2018, 2018, 1462802. [Google Scholar] [CrossRef]
- Holmgren, M.; Sheets, L. Using the Zebrafish Lateral Line to Understand the Roles of Mitochondria in Sensorineural Hearing Loss. Front. Cell Dev. Biol. 2020, 8, 628712. [Google Scholar] [CrossRef] [PubMed]
- Ou, H.C.; Raible, D.W.; Rubel, E.W. Cisplatin-induced hair cell loss in zebrafish (Danio rerio) lateral line. Hear. Res. 2007, 233, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Suli, A.; Watson, G.M.; Rubel, E.W.; Raible, D.W. Rheotaxis in larval zebrafish is mediated by lateral line mechanosensory hair cells. PLoS ONE. 2012, 7, e29727. [Google Scholar] [CrossRef] [PubMed]
- Jijie, R.; Mihalache, G.; Balmus, I.M.; Strungaru, S.A.; Baltag, E.S.; Ciobica, A.; Nicoara, M.; Faggio, C. Zebrafish as a Screening Model to Study the Single and Joint Effects of Antibiotics. Pharmaceuticals 2021, 14, 578. [Google Scholar] [CrossRef] [PubMed]
- Stehr, C.M.; Linbo, T.L.; Incardona, J.P.; Scholz, N.L. The developmental neurotoxicity of fipronil: Notochord degeneration and locomotor defects in zebrafish embryos and larvae. Toxicol. Sci. 2006, 92, 270–278. [Google Scholar] [CrossRef] [PubMed]
- Domingo, I.K.; Latif, A.; Bhavsar, A.P. Pro-Inflammatory Signalling PRRopels Cisplatin-Induced Toxicity. Int. J. Mol. Sci. 2022, 23, 7227. [Google Scholar] [CrossRef] [PubMed]
- Zwirner, N.W.; Ziblat, A. Regulation of NK Cell Activation and Effector Functions by the IL-12 Family of Cytokines: The Case of IL-27. Front. Immunol. 2017, 8, 25. [Google Scholar] [CrossRef]
- Kaplanski, G.; Marin, V.; Montero-Julian, F.; Mantovani, A.; Farnarier, C. IL-6: A regulator of the transition from neutrophil to monocyte recruitment during inflammation. Trends Immunol. 2003, 24, 25–29. [Google Scholar] [CrossRef]
- Gee, K.; Guzzo, C.; Che Mat, N.F.; Ma, W.; Kumar, A. The IL-12 family of cytokines in infection, inflammation and autoimmune disorders. Inflamm. Allergy Drug Targets. 2009, 8, 40–52. [Google Scholar] [CrossRef]
- Barros-Becker, F.; Squirrell, J.M.; Burke, R.; Chini, J.; Rindy, J.; Karim, A.; Eliceiri, K.W.; Gibson, A.; Huttenlocher, A. Distinct Tissue Damage and Microbial Cues Drive Neutrophil and Macrophage Recruitment to Thermal Injury. iScience 2020, 23, 101699. [Google Scholar] [CrossRef]
- Nechemia-Arbely, Y.; Barkan, D.; Pizov, G.; Shriki, A.; Rose-John, S.; Galun, E.; Axelrod, J.H. IL-6/IL-6R axis plays a critical role in acute kidney injury. J. Am. Soc. Nephrol. 2008, 19, 1106–1115. [Google Scholar] [CrossRef] [PubMed]
- Manfredi, A.A.; Ramirez, G.A.; Rovere-Querini, P.; Maugeri, N. The Neutrophil’s Choice: Phagocytose vs Make Neutrophil Extracellular Traps. Front. Immunol. 2018, 9, 288. [Google Scholar] [CrossRef]
- Brilli Skvarca, L.; Han, H.I.; Espiritu, E.B.; Missinato, M.A.; Rochon, E.R.; McDaniels, M.D.; Bais, A.S.; Roman, B.L.; Waxman, J.S.; Watkins, S.C.; et al. Enhancing regeneration after acute kidney injury by promoting cellular dedifferentiation in zebrafish. Dis. Model. Mech. 2019, 12, dmm037390. [Google Scholar] [CrossRef]
- George, B.; Wen, X.; Mercke, N.; Gomez, M.; O’Bryant, C.; Bowles, D.W.; Hu, Y.; Hogan, S.L.; Joy, M.S.; Aleksunes, L.M. Time-dependent changes in kidney injury biomarkers in patients receiving multiple cycles of cisplatin chemotherapy. Toxicol. Rep. 2020, 7, 571–576. [Google Scholar] [CrossRef] [PubMed]
- Hall, C.; Flores, M.V.; Storm, T.; Crosier, K.; Crosier, P. The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish. BMC Dev. Biol. 2007, 7, 42. [Google Scholar] [CrossRef] [PubMed]
- Matthews, M.; Varga, Z.M. Anesthesia and euthanasia in zebrafish. ILAR J. 2012, 53, 192–204. [Google Scholar] [CrossRef] [PubMed]
- Wilson, J.M.; Bunte, R.M.; Carty, A.J. Evaluation of rapid cooling and tricaine methanesulfonate (MS222) as methods of euthanasia in zebrafish (Danio rerio). J. Am. Assoc. Lab. Anim. Sci. 2009, 48, 785–789. [Google Scholar]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Feliz-Norberto, M.; Michael, C.; de Oliveira, S. Neutrophil Reverse Migration from Liver Fuels Neutrophilic Inflammation to Tissue Injury in Nonalcoholic Steatohepatitis. bioRxiv 2021. Available online: https://www.biorxiv.org/content/10.1101/2021.10.03.462893v1 (accessed on 22 December 2023). [CrossRef]
Gene | Forward (5′ -> 3′) | Reverse (5′ -> 3′) |
---|---|---|
efl1a1 | AGTGTTGCCTTCGTCCCAAT | TTCCATCCCTTGAACCAGCC |
il6 | GGCATTTGAAGGGGTCAGGA | TCAGGACGCTGTAGATTCGC |
il8 | GTTTTCCTGGCATTTCTGACCA | GCGTCGGCTTTCTGTTTCAA |
il12 | ACGCAAACGGTGTCTGTCT | CTCTGTAGGCATTCGCTCTCAT |
havcr1/kim1 | CGCTAGAAGTAAGGCAGAA | CACTGTTCGTATTCGCTTTC |
Score | Distribution of Neutrophils |
---|---|
None | Neutrophils aligned in the caudal hematopoietic tissue (CHT); neutrophils concentrated in the glomerular region of pronephros; absence of cells in the heart, brain, and around the eyes. |
Mild | More dispersed neutrophils are in the glomerular region of pronephros; neutrophils are present in the muscular portion of the tail; cell infiltration in the liver. |
Severe | Low concentration of cells in the glomerular region of pronephros; a high number of neutrophils in the liver; presence of neutrophils in the heart, brain, and around the eyes; CHT emptied. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Padovani, B.N.; Morales Fénero, C.; Paredes, L.C.; Amaral, M.A.d.; Domínguez-Amorocho, O.; Cipelli, M.; Gomes, J.M.M.; da Silva, E.M.; Silva, L.M.; Vieira, R.d.S.; et al. Cisplatin Toxicity Causes Neutrophil-Mediated Inflammation in Zebrafish Larvae. Int. J. Mol. Sci. 2024, 25, 2363. https://doi.org/10.3390/ijms25042363
Padovani BN, Morales Fénero C, Paredes LC, Amaral MAd, Domínguez-Amorocho O, Cipelli M, Gomes JMM, da Silva EM, Silva LM, Vieira RdS, et al. Cisplatin Toxicity Causes Neutrophil-Mediated Inflammation in Zebrafish Larvae. International Journal of Molecular Sciences. 2024; 25(4):2363. https://doi.org/10.3390/ijms25042363
Chicago/Turabian StylePadovani, Barbara Nunes, Camila Morales Fénero, Lais Cavalieri Paredes, Mariana Abrantes do Amaral, Omar Domínguez-Amorocho, Marcella Cipelli, Juliana Moreira Mendonça Gomes, Eloisa Martins da Silva, Luísa Menezes Silva, Raquel de Souza Vieira, and et al. 2024. "Cisplatin Toxicity Causes Neutrophil-Mediated Inflammation in Zebrafish Larvae" International Journal of Molecular Sciences 25, no. 4: 2363. https://doi.org/10.3390/ijms25042363
APA StylePadovani, B. N., Morales Fénero, C., Paredes, L. C., Amaral, M. A. d., Domínguez-Amorocho, O., Cipelli, M., Gomes, J. M. M., da Silva, E. M., Silva, L. M., Vieira, R. d. S., Pereira, M. T., Cruz, M. C., & Câmara, N. O. S. (2024). Cisplatin Toxicity Causes Neutrophil-Mediated Inflammation in Zebrafish Larvae. International Journal of Molecular Sciences, 25(4), 2363. https://doi.org/10.3390/ijms25042363