Epigenetic and Cellular Reprogramming of Doxorubicin-Resistant MCF-7 Cells Treated with Curcumin
Abstract
1. Introduction
2. Results and Discussion
2.1. Effects of Curcumin on P-Glycoprotein Expression
2.2. Effects of Curcumin on the MCF-7R DNA Methylation Landscape
2.2.1. Global Analysis of RRBS Data
2.2.2. Curcumin Affects the rRNA Loci Methylation Rate
2.2.3. Curcumin Affects Cytoskeletal Dynamics, WNT Pathway, and Transcriptional and Epigenetic Regulation
2.2.4. Differentially Methylated Non-Coding RNAs
2.3. Effects of Curcumin on ABCB1 Transcription Regulators
2.3.1. DNA Methylation: Several TFs Are Differentially Methylated
2.3.2. Expression Analysis: Egr1 and Ezh2 Transcripts Change Their Levels in MCF-7R Cells Treated with Curcumin
3. Materials and Methods
3.1. Cell Lines
3.2. Western Blotting
3.3. NF-κB Activation
3.4. Reduced Representation Bisulfite Sequencing (RRBS) and Differential Methylation Analysis
3.5. Reverse Transctiption and Quantitative PCR
3.6. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ponnusamy, L.; Mahalingaiah, P.K.S.; Chang, Y.-W.; Singh, K.P. Reversal of Epigenetic Aberrations Associated with the Acquisition of Doxorubicin Resistance Restores Drug Sensitivity in Breast Cancer Cells. Eur. J. Pharm. Sci. 2018, 123, 56–69. [Google Scholar] [CrossRef] [PubMed]
- Chekhun, V.F.; Kulik, G.I.; Yurchenko, O.V.; Tryndyak, V.P.; Todor, I.N.; Luniv, L.S.; Tregubova, N.A.; Pryzimirska, T.V.; Montgomery, B.; Rusetskaya, N.V.; et al. Role of DNA Hypomethylation in the Development of the Resistance to Doxorubicin in Human MCF-7 Breast Adenocarcinoma Cells. Cancer Lett. 2006, 231, 87–93. [Google Scholar] [CrossRef]
- David, G.L.; Yegnasubramanian, S.; Kumar, A.; Marchi, V.L.; Marzo, A.M.D.; Lin, X.; Nelson, W.G. MDR1 Promoter Hypermethylation in MCF-7 Human Breast Cancer Cells: Changes in Chromatin Structure Induced by Treatment with 5-Aza-Cytidine. Cancer Biol. Ther. 2004, 3, 540–548. [Google Scholar] [CrossRef] [PubMed]
- Chekhun, V.F.; Lukyanova, N.Y.; Kovalchuk, O.; Tryndyak, V.P.; Pogribny, I.P. Epigenetic Profiling of Multidrug-Resistant Human MCF-7 Breast Adenocarcinoma Cells Reveals Novel Hyper- and Hypomethylated Targets. Mol. Cancer Ther. 2007, 6, 1089–1098. [Google Scholar] [CrossRef] [PubMed]
- Ai, L.; Kim, W.-J.; Demircan, B.; Dyer, L.M.; Bray, K.J.; Skehan, R.R.; Massoll, N.A.; Brown, K.D. The Transglutaminase 2 Gene (TGM2), a Potential Molecular Marker for Chemotherapeutic Drug Sensitivity, Is Epigenetically Silenced in Breast Cancer. Carcinogenesis 2008, 29, 510–518. [Google Scholar] [CrossRef]
- Dong, J.; Qin, Z.; Zhang, W.-D.; Cheng, G.; Yehuda, A.G.; Ashby, C.R.; Chen, Z.-S.; Cheng, X.-D.; Qin, J.-J. Medicinal Chemistry Strategies to Discover P-Glycoprotein Inhibitors: An Update. Drug Resist. Updates 2020, 49, 100681. [Google Scholar] [CrossRef]
- Zhao, X.; Di, J.; Luo, D.; Vaishnav, Y.; Kamal; Nuralieva, N.; Verma, D.; Verma, P.; Verma, S. Recent Developments of P-Glycoprotein Inhibitors and Its Structure–Activity Relationship (SAR) Studies. Bioorg. Chem. 2024, 143, 106997. [Google Scholar] [CrossRef]
- Labbozzetta, M.; Poma, P.; Notarbartolo, M. Natural Inhibitors of P-Glycoprotein in Acute Myeloid Leukemia. Int. J. Mol. Sci. 2023, 24, 4140. [Google Scholar] [CrossRef]
- Lopes-Rodrigues, V.; Sousa, E.; Vasconcelos, M.H. Curcumin as a Modulator of P-Glycoprotein in Cancer: Challenges and Perspectives. Pharmaceuticals 2016, 9, 71. [Google Scholar] [CrossRef]
- Ming, T.; Tao, Q.; Tang, S.; Zhao, H.; Yang, H.; Liu, M.; Ren, S.; Xu, H. Curcumin: An Epigenetic Regulator and Its Application in Cancer. Biomed. Pharmacother. 2022, 156, 113956. [Google Scholar] [CrossRef]
- Hassan, F.; Rehman, M.S.; Khan, M.S.; Ali, M.A.; Javed, A.; Nawaz, A.; Yang, C. Curcumin as an Alternative Epigenetic Modulator: Mechanism of Action and Potential Effects. Front. Genet. 2019, 10, 514. [Google Scholar] [CrossRef]
- Khan, A.; Khan, A.; Khan, M.A.; Malik, Z.; Massey, S.; Parveen, R.; Mustafa, S.; Shamsi, A.; Husain, S.A. Phytocompounds Targeting Epigenetic Modulations: An Assessment in Cancer. Front. Pharmacol. 2024, 14, 1273993. [Google Scholar] [CrossRef] [PubMed]
- Rigogliuso, S.; Cusimano, A.; Condorelli, L.; Labbozzetta, M.; Schiera, G.; Poma, P.; Notarbartolo, M. Vesicle-Transported Multidrug Resistance as a Possible Therapeutic Target of Natural Compounds. Pharmaceuticals 2024, 17, 1358. [Google Scholar] [CrossRef] [PubMed]
- Carbone, C.; Rigogliuso, S.; Brucato, V.M.B.; Cusimano, A.; Labbozzetta, M.; La Carrubba, V.; Poma, P.; Notarbartolo, M.; Carfì Pavia, F. PLLA Porous Scaffold as a 3D Breast Cancer Model to Investigate Drug Resistance. J. Biomed. Mater. Res. A epub ahead of print. 2024. [Google Scholar] [CrossRef] [PubMed]
- Liczbiński, P.; Michałowicz, J.; Bukowska, B. Molecular Mechanism of Curcumin Action in Signaling Pathways: Review of the Latest Research. Phytother. Res. 2020, 34, 1992–2005. [Google Scholar] [CrossRef]
- Zoi, V.; Galani, V.; Lianos, G.D.; Voulgaris, S.; Kyritsis, A.P.; Alexiou, G.A. The Role of Curcumin in Cancer Treatment. Biomedicines 2021, 9, 1086. [Google Scholar] [CrossRef]
- Labbozzetta, M.; Notarbartolo, M.; Poma, P. Can NF-κB Be Considered a Valid Drug Target in Neoplastic Diseases? Our Point of View. Int. J. Mol. Sci. 2020, 21, 3070. [Google Scholar] [CrossRef]
- Poma, P.; Notarbartolo, M.; Labbozzetta, M.; Maurici, A.; Carina, V.; Alaimo, A.; Rizzi, M.; Simoni, D.; D’Alessandro, N. The Antitumor Activities of Curcumin and of Its Isoxazole Analogue Are Not Affected by Multiple Gene Expression Changes in an MDR Model of the MCF-7 Breast Cancer Cell Line: Analysis of the Possible Molecular Basis. Int. J. Mol. Med. 2007, 20, 329–335. [Google Scholar] [CrossRef]
- Karahan, G.; Sayar, N.; Gozum, G.; Bozkurt, B.; Konu, O.; Yulug, I.G. Relative Expression of rRNA Transcripts and 45S rDNA Promoter Methylation Status Are Dysregulated in Tumors in Comparison with Matched-Normal Tissues in Breast Cancer. Oncol. Rep. 2015, 33, 3131–3145. [Google Scholar] [CrossRef] [PubMed]
- Gagnon-Kugler, T.; Langlois, F.; Stefanovsky, V.; Lessard, F.; Moss, T. Loss of Human Ribosomal Gene CpG Methylation Enhances Cryptic RNA Polymerase II Transcription and Disrupts Ribosomal RNA Processing. Mol. Cell 2009, 35, 414–425. [Google Scholar] [CrossRef] [PubMed]
- Sloan, K.E.; Bohnsack, M.T.; Watkins, N.J. The 5S RNP Couples P53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress. Cell Rep. 2013, 5, 237–247. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.; Chen, Z.; Liu, Z.; Liu, Z. Unmasking the Biological Function and Regulatory Mechanism of NOC2L: A Novel Inhibitor of Histone Acetyltransferase. J. Transl. Med. 2023, 21, 31. [Google Scholar] [CrossRef] [PubMed]
- Dong, Z.; Zhu, C.; Zhan, Q.; Jiang, W. The Roles of RRP15 in Nucleolar Formation, Ribosome Biogenesis and Checkpoint Control in Human Cells. Oncotarget 2017, 8, 13240–13252. [Google Scholar] [CrossRef] [PubMed]
- Pryszlak, M.; Wiggans, M.; Chen, X.; Jaramillo, J.E.; Burns, S.E.; Richards, L.M.; Pugh, T.J.; Kaplan, D.R.; Huang, X.; Dirks, P.B.; et al. The DEAD-Box Helicase DDX56 Is a Conserved Stemness Regulator in Normal and Cancer Stem Cells. Cell Rep. 2021, 34, 108903. [Google Scholar] [CrossRef]
- Darrow, E.M.; Chadwick, B.P. A Novel tRNA Variable Number Tandem Repeat at Human Chromosome 1q23.3 Is Implicated as a Boundary Element Based on Conservation of a CTCF Motif in Mouse. Nucleic Acids Res. 2014, 42, 6421. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pavon-Eternod, M.; Gomes, S.; Geslain, R.; Dai, Q.; Rosner, M.R.; Pan, T. tRNA Over-Expression in Breast Cancer and Functional Consequences. Nucleic Acids Res. 2009, 37, 7268–7280. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.-L.; Wang, R.-C.; Cheng, K.; Ring, B.Z.; Su, L. Roles of Rap1 Signaling in Tumor Cell Migration and Invasion. Cancer Biol. Med. 2017, 14, 90–99. [Google Scholar] [CrossRef]
- Holy, J. Curcumin Inhibits Cell Motility and Alters Microfilament Organization and Function in Prostate Cancer Cells. Cell Motil. 2004, 58, 253–268. [Google Scholar] [CrossRef] [PubMed]
- Revet, I.; Huizenga, G.; Koster, J.; Volckmann, R.; van Sluis, P.; Versteeg, R.; Geerts, D. MSX1 Induces the Wnt Pathway Antagonist Genes DKK1, DKK2, DKK3, and SFRP1 in Neuroblastoma Cells, but Does Not Block Wnt3 and Wnt5A Signalling to DVL3. Cancer Lett. 2010, 289, 195–207. [Google Scholar] [CrossRef]
- Zhong, Z.; Virshup, D.M. Wnt Signaling and Drug Resistance in Cancer. Mol. Pharmacol. 2020, 97, 72–89. [Google Scholar] [CrossRef]
- Di Liegro, C.M.; Schiera, G.; Di Liegro, I. H1.0 Linker Histone as an Epigenetic Regulator of Cell Proliferation and Differentiation. Genes 2018, 9, 310. [Google Scholar] [CrossRef] [PubMed]
- Nozawa, R.-S.; Nagao, K.; Masuda, H.-T.; Iwasaki, O.; Hirota, T.; Nozaki, N.; Kimura, H.; Obuse, C. Human POGZ Modulates Dissociation of HP1alpha from Mitotic Chromosome Arms through Aurora B Activation. Nat. Cell Biol. 2010, 12, 719–727. [Google Scholar] [CrossRef] [PubMed]
- Vislovukh, A.; Kratassiouk, G.; Porto, E.; Gralievska, N.; Beldiman, C.; Pinna, G.; El’skaya, A.; Harel-Bellan, A.; Negrutskii, B.; Groisman, I. Proto-Oncogenic Isoform A2 of Eukaryotic Translation Elongation Factor eEF1 Is a Target of miR-663 and miR-744. Br. J. Cancer 2013, 108, 2304–2311. [Google Scholar] [CrossRef]
- Zhang, C.; Chen, B.; Jiao, A.; Li, F.; Sun, N.; Zhang, G.; Zhang, J. miR-663a Inhibits Tumor Growth and Invasion by Regulating TGF-Β1 in Hepatocellular Carcinoma. BMC Cancer 2018, 18, 1179. [Google Scholar] [CrossRef]
- Qu, P.; Shao, Z.A.; Wang, B.; He, J.P.; Zhang, Y.N.; Wei, W.J.; Hua, J.R.; Zhou, H.; Lu, D.; Ding, N.; et al. MiR-663a Inhibits Radiation-Induced Epithelium-to-Mesenchymal Transition by Targeting TGF-Β1. Biomed. Environ. Sci. 2022, 35, 437–447. [Google Scholar] [CrossRef]
- Miao, C.; Shi, W.; Xiong, Y.; Yu, H.; Zhang, X.; Qin, M.; Du, C.; Song, T.; Zhang, B.; Li, J. MicroRNA-663 Activates the Canonical Wnt Signaling through the Adenomatous Polyposis Coli Suppression. Immunol. Lett. 2015, 166, 45–54. [Google Scholar] [CrossRef] [PubMed]
- Park, E.Y.; Chang, E.; Lee, E.J.; Lee, H.-W.; Kang, H.-G.; Chun, K.-H.; Woo, Y.M.; Kong, H.K.; Ko, J.Y.; Suzuki, H.; et al. Targeting of miR34a–NOTCH1 Axis Reduced Breast Cancer Stemness and Chemoresistance. Cancer Res. 2014, 74, 7573–7582. [Google Scholar] [CrossRef]
- Yi, C.; Wang, Q.; Wang, L.; Huang, Y.; Li, L.; Liu, L.; Zhou, X.; Xie, G.; Kang, T.; Wang, H.; et al. MiR-663, a microRNA Targeting p21WAF1/CIP1, Promotes the Proliferation and Tumorigenesis of Nasopharyngeal Carcinoma. Oncogene 2012, 31, 4421–4433. [Google Scholar] [CrossRef] [PubMed]
- Corney, D.C.; Hwang, C.-I.; Matoso, A.; Vogt, M.; Flesken-Nikitin, A.; Godwin, A.K.; Kamat, A.A.; Sood, A.K.; Ellenson, L.H.; Hermeking, H.; et al. Frequent Downregulation of miR-34 Family in Human Ovarian Cancers. Clin. Cancer Res. 2010, 16, 1119–1128. [Google Scholar] [CrossRef]
- Peurala, H.; Greco, D.; Heikkinen, T.; Kaur, S.; Bartkova, J.; Jamshidi, M.; Aittomäki, K.; Heikkilä, P.; Bartek, J.; Blomqvist, C.; et al. MiR-34a Expression Has an Effect for Lower Risk of Metastasis and Associates with Expression Patterns Predicting Clinical Outcome in Breast Cancer. PLoS ONE 2011, 6, e26122. [Google Scholar] [CrossRef]
- Tanaka, N.; Toyooka, S.; Soh, J.; Kubo, T.; Yamamoto, H.; Maki, Y.; Muraoka, T.; Shien, K.; Furukawa, M.; Ueno, T.; et al. Frequent Methylation and Oncogenic Role of microRNA-34b/c in Small-Cell Lung Cancer. Lung Cancer 2012, 76, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Chekhun, V.F.; Borikun, T.V.; Lukianova, N.Y. Effect of 5-Azacytidine on miRNA Expression in Human Breast Cancer Cells with Different Sensitivity to Cytostatics. Exp. Oncol. 2016, 38, 26–30. [Google Scholar] [CrossRef]
- Wang, L.; Bu, P.; Ai, Y.; Srinivasan, T.; Chen, H.J.; Xiang, K.; Lipkin, S.M.; Shen, X. A Long Non-Coding RNA Targets microRNA miR-34a to Regulate Colon Cancer Stem Cell Asymmetric Division. eLife 2016, 5, e14620. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Ao, X.; Jia, Z.; Li, Y.; Kuang, S.; Du, C.; Zhang, J.; Wang, J.; Liu, Y. Non-Coding RNA in Cancer Drug Resistance: Underlying Mechanisms and Clinical Applications. Front. Oncol. 2022, 12, 951864. [Google Scholar] [CrossRef]
- Hu, Y.-C.; Wang, A.-M.; Lu, J.-K.; Cen, R.; Liu, L.-L. Long Noncoding RNA HOXD-AS1 Regulates Proliferation of Cervical Cancer Cells by Activating Ras/ERK Signaling Pathway. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 5049–5055. [Google Scholar] [CrossRef]
- Li, L.; Wang, Y.; Zhang, X.; Huang, Q.; Diao, Y.; Yin, H.; Liu, H. Long Non-Coding RNA HOXD-AS1 in Cancer. Clin. Chim. Acta 2018, 487, 197–201. [Google Scholar] [CrossRef] [PubMed]
- Corrêa, S.; Binato, R.; Du Rocher, B.; Castelo-Branco, M.T.; Pizzatti, L.; Abdelhay, E. Wnt/β-Catenin Pathway Regulates ABCB1 Transcription in Chronic Myeloid Leukemia. BMC Cancer 2012, 12, 303. [Google Scholar] [CrossRef]
- Labialle, S.; Gayet, L.; Marthinet, E.; Rigal, D.; Baggetto, L.G. Transcriptional Regulators of the Human Multidrug Resistance 1 Gene: Recent Views. Biochem. Pharmacol. 2002, 64, 943–948. [Google Scholar] [CrossRef]
- Sampath, J.; Sun, D.; Kidd, V.J.; Grenet, J.; Gandhi, A.; Shapiro, L.H.; Wang, Q.; Zambetti, G.P.; Schuetz, J.D. Mutant P53 Cooperates with ETS and Selectively Up-Regulates Human MDR1 Not MRP1. J. Biol. Chem. 2001, 276, 39359–39367. [Google Scholar] [CrossRef]
- McCoy, C.; Smith, D.E.; Cornwell, M.M. 12-O-Tetradecanoylphorbol-13-Acetate Activation of the MDR1 Promoter Is Mediated by EGR1. Mol. Cell Biol. 1995, 15, 6100–6108. [Google Scholar] [CrossRef] [PubMed]
- McCoy, C.; McGee, S.B.; Cornwell, M.M. The Wilms’ Tumor Suppressor, WT1, Inhibits 12-O-Tetradecanoylphorbol-13-Acetate Activation of the Multidrug Resistance-1 Promoter. Cell Growth Differ. 1999, 10, 377–386. [Google Scholar] [PubMed]
- Hammal, F.; de Langen, P.; Bergon, A.; Lopez, F.; Ballester, B. ReMap 2022: A Database of Human, Mouse, Drosophila and Arabidopsis Regulatory Regions from an Integrative Analysis of DNA-Binding Sequencing Experiments. Nucleic Acids Res. 2022, 50, D316–D325. [Google Scholar] [CrossRef]
- Yang, Z.; Chen, F.; Wei, D.; Chen, F.; Jiang, H.; Qin, S. EGR1 Mediates MDR1 Transcriptional Activity Regulating Gemcitabine Resistance in Pancreatic Cancer. BMC Cancer 2024, 24, 268. [Google Scholar] [CrossRef]
- Li, X.; Gera, L.; Zhang, S.; Chen, Y.; Lou, L.; Wilson, L.M.; Xie, Z.-R.; Sautto, G.; Liu, D.; Danaher, A.; et al. Pharmacological Inhibition of Noncanonical EED-EZH2 Signaling Overcomes Chemoresistance in Prostate Cancer. Theranostics 2021, 11, 6873–6890. [Google Scholar] [CrossRef] [PubMed]
- Xi, Y.; Li, W. BSMAP: Whole Genome Bisulfite Sequence MAPping Program. BMC Bioinform. 2009, 10, 232. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Ragusa, M.A.; Naselli, F.; Cruciata, I.; Volpes, S.; Schimmenti, C.; Serio, G.; Mauro, M.; Librizzi, M.; Luparello, C.; Chiarelli, R.; et al. Indicaxanthin Induces Autophagy in Intestinal Epithelial Cancer Cells by Epigenetic Mechanisms Involving DNA Methylation. Nutrients 2023, 15, 3495. [Google Scholar] [CrossRef] [PubMed]
- Ge, S.X.; Jung, D.; Yao, R. ShinyGO: A Graphical Gene-Set Enrichment Tool for Animals and Plants. Bioinformatics 2020, 36, 2628–2629. [Google Scholar] [CrossRef] [PubMed]
Treatments | Arbitrary Units/μg of Cell Nuclear Extract Protein |
---|---|
Control | 0.7 ± 0.001 |
Curcumin 30 µM | 0.06 ± 0.002 * |
Symbol | diff.meth Mean (R-S) | diff.meth Mean (RC-R) | Prom | CCRE | CGI (Shore) | Description |
---|---|---|---|---|---|---|
H1-0 | 66 | −31 | 0 | 1 | 1 (1) | H1.0 linker histone |
H3C8 | 37 | −28 | 1 | 1 | 1 (1) | H3 clustered histone 8 |
MEN1 | 53 | −38 | 1 | 1 | 1 (0) | menin 1 (HMT complex) |
CBX2, CBX8 | 63 | −25 | 0 | 1 | 1 (0) | chromobox 2/8 (PRC1 complex) |
CBX4 | 61 | −28 | 0 | 1 | 1 (0) | chromobox 4 (PRC1 complex) |
RING1 | 47 | −27 | 0 | 1 | 0 (1) | ring finger protein 1 (PRC1 complex) |
MBD3L1 | 58 | −34 | 1 | 1 | 1 (0) | methyl-CpG binding domain protein 3 like 1 (Does not bind methylated DNA) |
NOC2L | 63 | −31 | 1 | 1 | 1 (0) | NOC2 like nucleolar associated transcriptional repressor (INHAT) |
HOXB13 | 46 | −30 | 1 | 1 | 1 (1) | homeobox B13 |
HOXD1 | 59 | −37 | 1 | 1 | 1 (1) | homeobox D1 |
DLX4 | 36 | −28 | 0 | 1 | 1 (1) | distal-less homeobox 4 |
MSX1 | 72 | −27 | 0 | 1 | 1 (1) | msh homeobox 1 |
NKX2-5 | 35 | −27 | 0 | 1 | 1 (0) | NK2 homeobox 5 |
ZNF503/Nlz2 | 46 | −26 | 1 | 1 | 1 (0) | zinc finger protein 503 (transcriptional repressor) |
TRIM27 | 82 | −27 | 0 | 1 | 0 (0) | tripartite motif containing 27 (transcriptional repressor) |
MLXIPL | 59 | −30 | 1 | 0 | 1 (0) | MLX interacting protein like (TF of the Myc/Max/Mad superfamily) |
TOX2 | 44 | −33 | 1 | 1 | 1 (0) | TOX high mobility group box family member 2 |
Symbol | diff.meth Mean (R-S) | diff.meth Mean (RC-R) | Prom | CCRE | CGI (Shore) | Description |
---|---|---|---|---|---|---|
HAGLR/ HALGROS | 53 | −29 | 1 | 1 | 1 (0) | HOXD antisense growth-associated long non-coding RNA/HAGLR opposite strand lncRNA |
FAM182B | 72 | −51 | 1 | 1 | 0 (0) | family with sequence similarity 182 member B, lncRNA |
MIR663A | 35 | −30 | 1 | 1 | 1 (0) | microRNA 663a |
MIR34AHG | 69 | −30 | 1 | 1 | 1 (0) | microRNA 34a host gene |
MIR3648-1 | 29 | −36 | 1 | 0 | 0 (0) | microRNA 3648-1 |
MIR6724-2 | 36 | −28 | 1 | 0 | 1 (0) | microRNA 6724-2 |
LINC01623 | 82 | −27 | 0 | 1 | 0 (0) | long intergenic non-protein coding RNA 1623 |
Target | FORWARD | REVERSE |
---|---|---|
DNMT1 | GTCATGAACTCCAAGACCCACC | AGCGCCTCATAACTCTCAAAGC |
HDAC1 | TATCGCCCTCACAAAGCCAATG | AGTTTCACAGCACTTGCCACAG |
TET1 | AAAGAAGAGGGCTGCGATGATG | ACGGTCTCAGTGTTACTCCCTAAG |
EZH2 | TGTTTCCAGATAAGGGCACAGC | ACTCCTTTGCTCCCTCCAAATG |
FOXA1 | CACAGGGCTGGATGGTTGTATTG | GAGTAGGCCTCCTGCGTGTC |
FOS | CCAAGCGGAGACAGACCAACTA | CATTGAGGAGAGGCAGGGTGAA |
RUNX1 | CGGTCGAAGTGGAAGAGGGAAA | ATCTCCAGGGTGCTGTGTCTTC |
NANOG | CAGCTACAAACAGGTGAAGACC | AGTCACTGGCAGGAGAATTTGG |
EGR1 | CCGCAGAGTCTTTTCCTGACATC | TAAATGGGACTGCTGTCGTTGG |
ABCB1 | ACTAGAAGGTTCTGGGAAGATCGC | TGTGGGCTGCTGATATTTTGGC |
GAPDH | GACAGTCAGCCGCATCTTCT | TTAAAAGCAGCCCTGGTGAC |
PCBP1 | TGATCATCGACAAGCTGGAG | TCTTTGATCTTACACCCGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Poma, P.; Rigogliuso, S.; Labbozzetta, M.; Nicosia, A.; Costa, S.; Ragusa, M.A.; Notarbartolo, M. Epigenetic and Cellular Reprogramming of Doxorubicin-Resistant MCF-7 Cells Treated with Curcumin. Int. J. Mol. Sci. 2024, 25, 13416. https://doi.org/10.3390/ijms252413416
Poma P, Rigogliuso S, Labbozzetta M, Nicosia A, Costa S, Ragusa MA, Notarbartolo M. Epigenetic and Cellular Reprogramming of Doxorubicin-Resistant MCF-7 Cells Treated with Curcumin. International Journal of Molecular Sciences. 2024; 25(24):13416. https://doi.org/10.3390/ijms252413416
Chicago/Turabian StylePoma, Paola, Salvatrice Rigogliuso, Manuela Labbozzetta, Aldo Nicosia, Salvatore Costa, Maria Antonietta Ragusa, and Monica Notarbartolo. 2024. "Epigenetic and Cellular Reprogramming of Doxorubicin-Resistant MCF-7 Cells Treated with Curcumin" International Journal of Molecular Sciences 25, no. 24: 13416. https://doi.org/10.3390/ijms252413416
APA StylePoma, P., Rigogliuso, S., Labbozzetta, M., Nicosia, A., Costa, S., Ragusa, M. A., & Notarbartolo, M. (2024). Epigenetic and Cellular Reprogramming of Doxorubicin-Resistant MCF-7 Cells Treated with Curcumin. International Journal of Molecular Sciences, 25(24), 13416. https://doi.org/10.3390/ijms252413416