Establishment of Novel High-Grade Serous Ovarian Carcinoma Cell Line OVAR79
Abstract
1. Introduction
2. Results
2.1. Patient Medical History
2.2. The Basic Characteristics of the Cell Line
2.3. Mutation Profile
2.4. DNA Copy Number Alterations
2.5. Marker Expression and Phenotypic Analysis of OVAR79 Cells
2.6. In Vitro Chemosensitivity
2.7. Comparison of OVAR79 to Other Ovarian Cancer Cell Lines
3. Discussion
4. Materials and Methods
4.1. Patient and Sample Data
4.2. Cell Line Establishment and Culture Conditions
4.3. Short Tandem Repeat (STR) Analysis
4.4. Cell Proliferation Measurement
4.5. Wound Healing Assay
4.6. Single Nucleotide Polymorphism (SNP) Array Analysis
4.7. Mutation Identification
4.8. Reverse Transcription Followed by Semi-Quantitative PCR
4.9. FACS Analysis
4.10. MTT Assay
4.11. Transient Transfection
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- Webb, P.M.; Jordan, S.J. Epidemiology of Epithelial Ovarian Cancer. Best Pract. Res. Clin. Obstet. Gynaecol. 2017, 41, 3–14. [Google Scholar]
- Kuroki, L.; Guntupalli, S.R. Treatment of Epithelial Ovarian Cancer. BMJ 2020, 371, m3773. [Google Scholar] [CrossRef] [PubMed]
- Ghose, A.; Bolina, A.; Mahajan, I.; Raza, S.A.; Clarke, M.; Pal, A.; Sanchez, E.; Rallis, K.S.; Boussios, S. Hereditary Ovarian Cancer: Towards a Cost-Effective Prevention Strategy. Int. J. Environ. Res. Public Health 2022, 19, 12057. [Google Scholar] [CrossRef]
- Rojas, V.; Hirshfield, K.M.; Ganesan, S.; Rodriguez-Rodriguez, L. Molecular Characterization of Epithelial Ovarian Cancer: Implications for Diagnosis and Treatment. Int. J. Mol. Sci. 2016, 17, 2113. [Google Scholar] [CrossRef]
- Cancer of the Ovary—Cancer Stat Facts. Available online: https://seer.cancer.gov/statfacts/html/ovary.html (accessed on 25 September 2024).
- Lheureux, S.; Gourley, C.; Vergote, I.; Oza, A.M. Epithelial Ovarian Cancer. Lancet 2019, 393, 1240–1253. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas Research Network. Integrated Genomic Analyses of Ovarian Carcinoma. Nature 2011, 474, 609–615. [Google Scholar] [CrossRef]
- Kotnik, E.N.; Mullen, M.M.; Spies, N.C.; Li, T.; Inkman, M.; Zhang, J.; Martins-Rodrigues, F.; Hagemann, I.S.; McCourt, C.K.; Thaker, P.H.; et al. Genetic Characterization of Primary and Metastatic High-Grade Serous Ovarian Cancer Tumors Reveals Distinct Features Associated with Survival. Commun. Biol. 2023, 6, 688. [Google Scholar] [CrossRef]
- Freimund, A.E.; Beach, J.A.; Christie, E.L.; Bowtell, D.D.L. Mechanisms of Drug Resistance in High-Grade Serous Ovarian Cancer. Hematol. Oncol. Clin. N. Am. 2018, 32, 983–996. [Google Scholar] [CrossRef]
- Jacob, F.; Nixdorf, S.; Hacker, N.F.; Heinzelmann-Schwarz, V.A. Reliable in Vitro Studies Require Appropriate Ovarian Cancer Cell Lines. J. Ovarian Res. 2014, 7, 60. [Google Scholar] [CrossRef]
- Scherer, W.F.; Syverton, J.T.; Gey, G.O. Studies on the Propagation in Vitro of Poliomyelitis Viruses. IV. Viral Multiplication in a Stable Strain of Human Malignant Epithelial Cells (strain HeLa) Derived from an Epidermoid Carcinoma of the Cervix. J. Exp. Med. 1953, 97, 695–710. [Google Scholar] [CrossRef]
- Soule, H.D.; Vazguez, J.; Long, A.; Albert, S.; Brennan, M. A Human Cell Line from a Pleural Effusion Derived from a Breast Carcinoma. J. Natl. Cancer Inst. 1973, 51, 1409–1416. [Google Scholar] [CrossRef] [PubMed]
- Graham, F.L.; Smiley, J.; Russell, W.C.; Nairn, R. Characteristics of a Human Cell Line Transformed by DNA from Human Adenovirus Type 5. J. Gen. Virol. 1977, 36, 59–74. [Google Scholar] [CrossRef]
- Liu, Y.; Mi, Y.; Mueller, T.; Kreibich, S.; Williams, E.G.; Van Drogen, A.; Borel, C.; Frank, M.; Germain, P.-L.; Bludau, I.; et al. Multi-Omic Measurements of Heterogeneity in HeLa Cells across Laboratories. Nat. Biotechnol. 2019, 37, 314–322. [Google Scholar] [CrossRef] [PubMed]
- Collins, K.E.; Wang, X.; Klymenko, Y.; Davis, N.B.; Martinez, M.C.; Zhang, C.; So, K.; Buechlein, A.; Rusch, D.B.; Creighton, C.J.; et al. Transcriptomic Analyses of Ovarian Clear-Cell Carcinoma with Concurrent Endometriosis. Front. Endocrinol. 2023, 14, 1162786. [Google Scholar] [CrossRef]
- Aliyuda, F.; Moschetta, M.; Ghose, A.; Sofia Rallis, K.; Sheriff, M.; Sanchez, E.; Rassy, E.; Boussios, S. Advances in Ovarian Cancer Treatment Beyond PARP Inhibitors. Curr. Cancer Drug Targets 2023, 23, 433–446. [Google Scholar] [CrossRef]
- You, Y.; Bi, F.-F.; Jiang, Y.; Xu, Y.-T.; An, Y.-Y.; Li, D.; Yang, Q. BRCA1 Affects the Resistance and Stemness of SKOV3-Derived Ovarian Cancer Stem Cells by Regulating Autophagy. Cancer Med. 2019, 8, 656–668. [Google Scholar] [CrossRef]
- Yamulla, R.J.; Nalubola, S.; Flesken-Nikitin, A.; Nikitin, A.Y.; Schimenti, J.C. Most Commonly Mutated Genes in High-Grade Serous Ovarian Carcinoma Are Nonessential for Ovarian Surface Epithelial Stem Cell Transformation. Cell Rep. 2020, 32, 108086. [Google Scholar] [CrossRef] [PubMed]
- Mazloumi Gavgani, F.; Smith Arnesen, V.; Jacobsen, R.G.; Krakstad, C.; Hoivik, E.A.; Lewis, A.E. Class I Phosphoinositide 3-Kinase /p110α and /p110β Isoforms in Endometrial Cancer. Int. J. Mol. Sci. 2018, 19, 3931. [Google Scholar] [CrossRef]
- Rugo, H.S.; Raskina, K.; Schrock, A.B.; Madison, R.W.; Graf, R.P.; Sokol, E.S.; Sivakumar, S.; Lee, J.K.; Fisher, V.; Oxnard, G.R.; et al. Biology and Targetability of the Extended Spectrum of PIK3CA Mutations Detected in Breast Carcinoma. Clin. Cancer Res. 2023, 29, 1056–1067. [Google Scholar] [CrossRef]
- Álvarez-Garcia, V.; Tawil, Y.; Wise, H.M.; Leslie, N.R. Mechanisms of PTEN Loss in Cancer: It’s All about Diversity. Semin. Cancer Biol. 2019, 59, 66–79. [Google Scholar] [CrossRef]
- Yehia, L.; Ngeow, J.; Eng, C. PTEN-Opathies: From Biological Insights to Evidence-Based Precision Medicine. J. Clin. Investig. 2019, 129, 452–464. [Google Scholar] [CrossRef] [PubMed]
- Samuels, Y.; Diaz, L.A., Jr.; Schmidt-Kittler, O.; Cummins, J.M.; Delong, L.; Cheong, I.; Rago, C.; Huso, D.L.; Lengauer, C.; Kinzler, K.W.; et al. Mutant PIK3CA Promotes Cell Growth and Invasion of Human Cancer Cells. Cancer Cell 2005, 7, 561–573. [Google Scholar] [CrossRef] [PubMed]
- Cummings, S.; Alfonso, A.; Hughes, E.; Kucera, M.; Mabey, B.; Singh, N.; Eng, C. Cancer Risk Associated with Pathogenic Variants Identified Using Multigene Hereditary Cancer Panel Testing. JCO Precis. Oncol. 2023, 7, e2200415. [Google Scholar] [CrossRef] [PubMed]
- Capuozzo, M.; Santorsola, M.; Bocchetti, M.; Perri, F.; Cascella, M.; Granata, V.; Celotto, V.; Gualillo, O.; Cossu, A.M.; Nasti, G.; et al. p53: From Fundamental Biology to Clinical Applications in Cancer. Biology 2022, 11, 1325. [Google Scholar] [CrossRef] [PubMed]
- Talbot, T.; Lu, H.; Aboagye, E.O. Amplified Therapeutic Targets in High-Grade Serous Ovarian Carcinoma—A Review of the Literature with Quantitative Appraisal. Cancer Gene Ther. 2023, 30, 955–963. [Google Scholar] [CrossRef]
- Elkin, R.; Oh, J.H.; Liu, Y.L.; Selenica, P.; Weigelt, B.; Reis-Filho, J.S.; Zamarin, D.; Deasy, J.O.; Norton, L.; Levine, A.J.; et al. Geometric Network Analysis Provides Prognostic Information in Patients with High Grade Serous Carcinoma of the Ovary Treated with Immune Checkpoint Inhibitors. NPJ Genom. Med. 2021, 6, 99. [Google Scholar] [CrossRef]
- Łukomska, A.; Menkiszak, J.; Gronwald, J.; Tomiczek-Szwiec, J.; Szwiec, M.; Jasiówka, M.; Blecharz, P.; Kluz, T.; Stawicka-Niełacna, M.; Mądry, R.; et al. Recurrent Mutations in BRCA1, BRCA2, RAD51C, PALB2 and CHEK2 in Polish Patients with Ovarian Cancer. Cancers 2021, 13, 849. [Google Scholar] [CrossRef]
- Indovina, P.; Pentimalli, F.; Casini, N.; Vocca, I.; Giordano, A. RB1 Dual Role in Proliferation and Apoptosis: Cell Fate Control and Implications for Cancer Therapy. Oncotarget 2015, 6, 17873–17890. [Google Scholar] [CrossRef]
- Skoda, A.M.; Simovic, D.; Karin, V.; Kardum, V.; Vranic, S.; Serman, L. The Role of the Hedgehog Signaling Pathway in Cancer: A Comprehensive Review. Bosn. J. Basic Med. Sci. 2018, 18, 8–20. [Google Scholar] [CrossRef]
- Bakr, A.; Della Corte, G.; Veselinov, O.; Kelekçi, S.; Chen, M.-J.M.; Lin, Y.-Y.; Sigismondo, G.; Iacovone, M.; Cross, A.; Syed, R.; et al. ARID1A Regulates DNA Repair through Chromatin Organization and Its Deficiency Triggers DNA Damage-Mediated Anti-Tumor Immune Response. Nucleic Acids Res. 2024, 52, 5698–5719. [Google Scholar] [CrossRef]
- Di Palma, T.; Zannini, M. PAX8 as a Potential Target for Ovarian Cancer: What We Know so Far. OncoTargets Ther. 2022, 15, 1273–1280. [Google Scholar] [CrossRef]
- Duffy, M.J.; O’Grady, S.; Tang, M.; Crown, J. MYC as a Target for Cancer Treatment. Cancer Treat. Rev. 2021, 94, 102154. [Google Scholar] [CrossRef] [PubMed]
- Madhunapantula, S.V.; Robertson, G.P. The PTEN-AKT3 Signaling Cascade as a Therapeutic Target in Melanoma. Pigment Cell Melanoma Res. 2009, 22, 400–419. [Google Scholar] [CrossRef] [PubMed]
- Qiao, F.-H.; Tu, M.; Liu, H.-Y. Role of MALAT1 in Gynecological Cancers: Pathologic and Therapeutic Aspects. Oncol. Lett. 2021, 21, 333. [Google Scholar] [CrossRef]
- Taki, M.; Abiko, K.; Baba, T.; Hamanishi, J.; Yamaguchi, K.; Murakami, R.; Yamanoi, K.; Horikawa, N.; Hosoe, Y.; Nakamura, E.; et al. Snail Promotes Ovarian Cancer Progression by Recruiting Myeloid-Derived Suppressor Cells via CXCR2 Ligand Upregulation. Nat. Commun. 2018, 9, 1685. [Google Scholar] [CrossRef]
- He, Q.-Z.; Luo, X.-Z.; Wang, K.; Zhou, Q.; Ao, H.; Yang, Y.; Li, S.-X.; Li, Y.; Zhu, H.-T.; Duan, T. Isolation and Characterization of Cancer Stem Cells from High-Grade Serous Ovarian Carcinomas. Cell Physiol. Biochem. 2014, 33, 173–184. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.; Gilbert, S.F.; Waters, J.A.; Lujano-Olazaba, O.; Lara, J.; Alexander, L.J.; Green, S.E.; Burkeen, G.A.; Patrus, O.; Sarwar, Z.; et al. Characterization of SOX2, OCT4 and NANOG in Ovarian Cancer Tumor-Initiating Cells. Cancers 2021, 13, 262. [Google Scholar] [CrossRef]
- Landen, C.N., Jr.; Goodman, B.; Katre, A.A.; Steg, A.D.; Nick, A.M.; Stone, R.L.; Miller, L.D.; Mejia, P.V.; Jennings, N.B.; Gershenson, D.M.; et al. Targeting Aldehyde Dehydrogenase Cancer Stem Cells in Ovarian Cancer. Mol. Cancer Ther. 2010, 9, 3186–3199. [Google Scholar] [CrossRef] [PubMed]
- Vos, M.C.; Hollemans, E.; Ezendam, N.; Feijen, H.; Boll, D.; Pijlman, B.; van der Putten, H.; Klinkhamer, P.; van Kuppevelt, T.H.; van der Wurff, A.A.M.; et al. MMP-14 and CD44 in Epithelial-to-Mesenchymal Transition (EMT) in Ovarian Cancer. J. Ovarian Res. 2016, 9, 53. [Google Scholar] [CrossRef]
- Domcke, S.; Sinha, R.; Levine, D.A.; Sander, C.; Schultz, N. Evaluating Cell Lines as Tumour Models by Comparison of Genomic Profiles. Nat. Commun. 2013, 4, 2126. [Google Scholar] [CrossRef]
- Fogh, J.; Trempe, G. New Human Tumor Cell Lines. In Human Tumor Cells In Vitro; Springer: Boston, MA, USA, 1975; pp. 115–159. ISBN 9781475716498. [Google Scholar]
- Hamilton, T.C.; Young, R.C.; McKoy, W.M.; Grotzinger, K.R.; Green, J.A.; Chu, E.W.; Whang-Peng, J.; Rogan, A.M.; Green, W.R.; Ozols, R.F. Characterization of a Human Ovarian Carcinoma Cell Line (NIH:OVCAR-3) with Androgen and Estrogen Receptors. Cancer Res. 1983, 43, 5379–5389. [Google Scholar] [PubMed]
- Karlan, B.Y.; Jones, J.; Slamon, D.J.; Lagasse, L.D. Glucocorticoids Stabilize HER-2/neu Messenger RNA in Human Epithelial Ovarian Carcinoma Cells. Gynecol. Oncol. 1994, 53, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Behrens, B.C.; Hamilton, T.C.; Masuda, H.; Grotzinger, K.R.; Whang-Peng, J.; Louie, K.G.; Knutsen, T.; McKoy, W.M.; Young, R.C.; Ozols, R.F. Characterization of a Cis-diamminedichloroplatinum(II)-Resistant Human Ovarian Cancer Cell Line and Its Use in Evaluation of Platinum Analogues. Cancer Res. 1987, 47, 414–418. [Google Scholar] [PubMed]
- Bradbury, A.; O’Donnell, R.; Drew, Y.; Curtin, N.J.; Sharma Saha, S. Characterisation of Ovarian Cancer Cell Line NIH-OVCAR3 and Implications of Genomic, Transcriptomic, Proteomic and Functional DNA Damage Response Biomarkers for Therapeutic Targeting. Cancers 2020, 12, 1939. [Google Scholar] [CrossRef] [PubMed]
- Barnes, B.M.; Nelson, L.; Tighe, A.; Burghel, G.J.; Lin, I.-H.; Desai, S.; McGrail, J.C.; Morgan, R.D.; Taylor, S.S. Distinct Transcriptional Programs Stratify Ovarian Cancer Cell Lines into the Five Major Histological Subtypes. Genome Med. 2021, 13, 140. [Google Scholar] [CrossRef]
- Phadngam, S.; Castiglioni, A.; Ferraresi, A.; Morani, F.; Follo, C.; Isidoro, C. PTEN Dephosphorylates AKT to Prevent the Expression of GLUT1 on Plasmamembrane and to Limit Glucose Consumption in Cancer Cells. Oncotarget 2016, 7, 84999–85020. [Google Scholar] [CrossRef]
- Lee, S.; Choi, E.-J.; Jin, C.; Kim, D.-H. Activation of PI3K/Akt Pathway by PTEN Reduction and PIK3CA mRNA Amplification Contributes to Cisplatin Resistance in an Ovarian Cancer Cell Line. Gynecol. Oncol. 2005, 97, 26–34. [Google Scholar] [CrossRef]
- Pang, L.; Chang, X. Resistin Expression in Epithelial Ovarian Cancer Promotes the Proliferation and Migration of Ovarian Cancer Cells to Worsen Prognosis. J. Cancer 2021, 12, 6796–6804. [Google Scholar] [CrossRef]
- Xiang, J.; Zhou, L.; He, Y.; Wu, S. LDH-A Inhibitors as Remedies to Enhance the Anticancer Effects of PARP Inhibitors in Ovarian Cancer Cells. Aging 2021, 13, 25920–25930. [Google Scholar] [CrossRef]
- Choi, E.J.; Seo, E.J.; Kim, D.K.; Lee, S.I.; Kwon, Y.W.; Jang, I.H.; Kim, K.-H.; Suh, D.-S.; Kim, J.H. FOXP1 Functions as an Oncogene in Promoting Cancer Stem Cell-like Characteristics in Ovarian Cancer Cells. Oncotarget 2016, 7, 3506–3519. [Google Scholar] [CrossRef]
- Coscia, F.; Watters, K.M.; Curtis, M.; Eckert, M.A.; Chiang, C.Y.; Tyanova, S.; Montag, A.; Lastra, R.R.; Lengyel, E.; Mann, M. Integrative Proteomic Profiling of Ovarian Cancer Cell Lines Reveals Precursor Cell Associated Proteins and Functional Status. Nat. Commun. 2016, 7, 12645. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Gan, H.; Zhao, F.; Ma, X.; Xie, X.; Huang, R.; Zhao, J. CPEB4-Promoted Paclitaxel Resistance in Ovarian Cancer Relies on Translational Regulation of CSAG2. Front. Pharmacol. 2020, 11, 600994. [Google Scholar] [CrossRef] [PubMed]
- Wojtowicz, K.; Nowicki, M. The Characterization of the Sensitive Ovarian Cancer Cell Lines A2780 and W1 in Response to Ovarian CAFs. Biochem. Biophys. Res. Commun. 2023, 662, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Shishido, A.; Mori, S.; Yokoyama, Y.; Hamada, Y.; Minami, K.; Qian, Y.; Wang, J.; Hirose, H.; Wu, X.; Kawaguchi, N.; et al. Mesothelial Cells Facilitate Cancer Stem-like Properties in Spheroids of Ovarian Cancer Cells. Oncol. Rep. 2018, 40, 2105–2114. [Google Scholar] [CrossRef]
- Wiechert, A.; Saygin, C.; Thiagarajan, P.S.; Rao, V.S.; Hale, J.S.; Gupta, N.; Hitomi, M.; Nagaraj, A.B.; DiFeo, A.; Lathia, J.D.; et al. Cisplatin Induces Stemness in Ovarian Cancer. Oncotarget 2016, 7, 30511–30522. [Google Scholar] [CrossRef]
- Forbes, S.A.; Tang, G.; Bindal, N.; Bamford, S.; Dawson, E.; Cole, C.; Kok, C.Y.; Jia, M.; Ewing, R.; Menzies, A.; et al. COSMIC (the Catalogue of Somatic Mutations in Cancer): A Resource to Investigate Acquired Mutations in Human Cancer. Nucleic Acids Res. 2010, 38, D652–D657. [Google Scholar] [CrossRef]
- Nelson, L.; Tighe, A.; Golder, A.; Littler, S.; Bakker, B.; Moralli, D.; Murtuza Baker, S.; Donaldson, I.J.; Spierings, D.C.J.; Wardenaar, R.; et al. A Living Biobank of Ovarian Cancer Ex Vivo Models Reveals Profound Mitotic Heterogeneity. Nat. Commun. 2020, 11, 822. [Google Scholar] [CrossRef]
- Rickard, B.P.; Conrad, C.; Sorrin, A.J.; Ruhi, M.K.; Reader, J.C.; Huang, S.A.; Franco, W.; Scarcelli, G.; Polacheck, W.J.; Roque, D.M.; et al. Malignant Ascites in Ovarian Cancer: Cellular, Acellular, and Biophysical Determinants of Molecular Characteristics and Therapy Response. Cancers 2024, 13, 4318. [Google Scholar] [CrossRef]
- Latifi, A.; Luwor, R.B.; Bilandzic, M.; Nazaretian, S.; Stenvers, K.; Pyman, J.; Zhu, H.; Thompson, E.W.; Quinn, M.A.; Findlay, J.K.; et al. Isolation and Characterization of Tumor Cells from the Ascites of Ovarian Cancer Patients: Molecular Phenotype of Chemoresistant Ovarian Tumors. PLoS ONE 2012, 7, e46858. [Google Scholar] [CrossRef]
- Ding, Y.; Labitzky, V.; Legler, K.; Qi, M.; Schumacher, U.; Schmalfeldt, B.; Stürken, C.; Oliveira-Ferrer, L. Molecular Characteristics and Tumorigenicity of Ascites-Derived Tumor Cells: Mitochondrial Oxidative Phosphorylation as a Novel Therapy Target in Ovarian Cancer. Mol. Oncol. 2021, 15, 3578–3595. [Google Scholar] [CrossRef]
- Loret, N.; Denys, H.; Tummers, P.; Berx, G. The Role of Epithelial-to-Mesenchymal Plasticity in Ovarian Cancer Progression and Therapy Resistance. Cancers 2019, 11, 838. [Google Scholar] [CrossRef] [PubMed]
- Chiang, Y.-C.; Cheng, W.-F.; Chang, M.-C.; Lu, T.-P.; Kuo, K.-T.; Lin, H.-P.; Hsieh, C.-Y.; Chen, C.-A. Establishment of a New Ovarian Cancer Cell Line CA5171. Reprod. Sci. 2015, 22, 725–734. [Google Scholar] [CrossRef] [PubMed]
Feature | OVAR79 | SKOV3 | OVCAR3 | CaOV3 | A2780 |
---|---|---|---|---|---|
Origin | Ascitic fluid | Ascitic fluid [42] | Ascitic fluid [43] | Tumor [44] | Tumor [45] |
Diagnosis | HGSOC | Clear-cell carcinoma [15] | HGSOC [46] | Possibly HGSOC [41] | Endometrioid ovarian carcinoma [47] |
TP53 mutation | Wild-type | Wild-type [41] or truncating mutation [47] | Mutated [46] | Mutated [41] | Wild-type [41] |
PIK3CA mutations | Mutated | Mutated [47] | Wild-type [48,49] | Wild-type [47] | Mutated [47] |
PTEN mutations | Mutated | Wild-type [47] | Wild-type [48,49] | Wild-type [47] | Mutated [47] |
Proliferation rate | High | High | Moderate | High [50] | High [51] |
Migration ability | High | High | Low | High [50] | Low [52] |
Epithelial/Mesenchymal markers | Epithelial with EMT potential | Predominantly mesenchymal | Epithelial [53] | Epithelial [53] | Epithelial [53] |
Chemoresistance | Highly resistant to carboplatin, moderate sensitivity to cisplatin | Resistant to paclitaxel, resistant to low doses of cisplatin | Resistant to low doses of cisplatin | Resistant to paclitaxel (comparable to SKOV3) [54] | Sensitive to chemotherapy drugs of different classes [55] |
Stemness markers | High NANOG, moderate CD44 | Moderate | High CD44 | Moderate CD44, Bmi-1, low Dclk-1 [56] | Low [57] |
Chromosomal instability | High | Moderate [58] | High [58] | Moderate [58] | Low [58] |
Gene | Exon | Primers | |
---|---|---|---|
KRAS | 1 | Forward primer sequence 5′>3′ | 5′-TTGAAACCCAAGGTACATTTCAG-3′ |
Reverse primer sequence 5′>3′ | 5′-TCTTAAGCGTCGATGGAGGAG-3′ | ||
KRAS | 2 | Forward primer sequence 5′>3′ | 5′-TATGCATGGCATTAGCAAAGAC-3′ |
Reverse primer sequence 5′>3′ | 5′-CGTCATCTTTGGAGCAGGAAC-3′ | ||
BRAF | 15 | Forward primer sequence 5′>3′ | 5′-TCATAATGCTTGCTCTGATAGGA-3′ |
Reverse primer sequence 5′>3′ | 5′-GGCCAAAAATTTAATCAGTGGA-3′ | ||
TP53 | 3–4 | Forward primer sequence 5′>3′ | 5′-GAGGAATCCCAAAGTTCCAAAC-3′ |
Reverse primer sequence 5′>3′ | 5′-ACGTTCTGGTAAGGACAAGGG-3′ | ||
TP53 | 5–6 | Forward primer sequence 5′>3′ | 5′-CAGGAGGTGCTTACGCATGTT-3′ |
Reverse primer sequence 5′>3′ | 5′-AGGAGAAAGCCCCCCTACTG-3′ | ||
TP53 | 7 | Forward primer sequence 5′>3′ | 5′-AGAAATCGGTAAGAGGTGGGC-3′ |
Reverse primer sequence 5′>3′ | 5′-CATCCTGGCTAACGGTGAAAC-3′ | ||
TP53 | 8 | Forward primer sequence 5′>3′ | 5′-TTGGGCAGTGCTAGGAAAGAG-3′ |
Reverse primer sequence 5′>3′ | 5′-GTTGGGAGTAGATGGAGCCTG-3′ | ||
PIK3CA | 1 | Forward primer sequence 5′>3′ | 5′-CCCCTCCATCAACTTCTTCAA-3′ |
Reverse primer sequence 5′>3′ | 5′-ATTGTATCATACCAATTTCTCGATTG-3′ | ||
PIK3CA | 1 | Forward primer sequence 5′>3′ | 5′-TGCTTTGGGACAACCATACATC-3′ |
Reverse primer sequence 5′>3′ | 5′-CTTGCTTCTTTAAATAGTTCATGCTTT-3′ | ||
PIK3CA | 9 | Forward primer sequence 5′>3′ | 5′-TCAGCAGTTACTATTCTGTGACTGG-3′ |
Reverse primer sequence 5′>3′ | 5′-TGCTGAGATCAGCCAAATTCA-3′ | ||
PIK3CA | 20 | Forward primer sequence 5′>3′ | 5′-GACATTTGAGCAAAGACCTGAAG-3′ |
Reverse primer sequence 5′>3′ | 5′-TGGATTGTGCAATTCCTATGC-3′ | ||
PTEN | 1 | Forward primer sequence 5′>3′ | 5′-TTTCCATCCTGCAGAAGAAGC-3′ |
Reverse primer sequence 5′>3′ | 5′-TCCGTCTAGCCAAACACACC-3′ | ||
PTEN | 2 | Forward primer sequence 5′>3′ | 5′-TCTGTGATGTATAAACCGTGAGTTTC-3′ |
Reverse primer sequence 5′>3′ | 5′-CCCTGAAGTCCATTAGGTACGG-3′ | ||
PTEN | 3 | Forward primer sequence 5′>3′ | 5′-ATTACTACTCTAAACCCATAGAAGG-3′ |
Reverse primer sequence 5′>3′ | 5′-TCAAATATGGGCTAGATGCCA-3′ | ||
PTEN | 4 | Forward primer sequence 5′>3′ | 5′-ATAAAGATTCAGGCAATGTTTGTTAG-3′ |
Reverse primer sequence 5′>3′ | 5′-GACCAACTGCCTCAAATAGTAGG-3′ | ||
PTEN | 5 | Forward primer sequence 5′>3′ | 5′-TGCAACATTTCTAAAGTTACCTACTTG-3′ |
Reverse primer sequence 5′>3′ | 5′-TTTACTTGTCAATTACACCTCAATAAA-3′ | ||
PTEN | 6 | Forward primer sequence 5′>3′ | 5′-AATGGCTACGACCCAGTTACC-3′ |
Reverse primer sequence 5′>3′ | 5′-TTTGGCTTCTTTAGCCCAATG-3′ | ||
PTEN | 7 | Forward primer sequence 5′>3′ | 5′-TGCAGATACAGAATCCATATTTCG-3′ |
Reverse primer sequence 5′>3′ | 5′-AATGTCTCACCAATGCCAGAG-3′ | ||
PTEN | 8 | Forward primer sequence 5′>3′ | 5′-TGCAACAGATAACTCAGATTGCC-3′ |
Reverse primer sequence 5′>3′ | 5′-TGTCAAGCAAGTTCTTCATCAGC-3′ | ||
PTEN | 9 | Forward primer sequence 5′>3′ | 5′-AAGATCATGTTTGTTACAGTGCTTAAA-3′ |
Reverse primer sequence 5′>3′ | 5′-TGACACAATGTCCTATTGCCA-3′ | ||
CTNNB | 2 | Forward primer sequence 5′>3′ | 5′-GCGTGGACAATGGCTACTCAA-3′ |
Reverse primer sequence 5′>3′ | 5′-GGATCTGCATGCCCTCATCTA-3′ | ||
NF1 | 3 | Forward primer sequence 5′>3′ | 5′-TGTGTGTTGATTGGTAGCAGA-3′ |
Reverse primer sequence 5′>3′ | 5′-AGACAGATACGTGGCTGAAACA-3′ | ||
NF1 | 5 | Forward primer sequence 5′>3′ | 5′-TTCTCCACTTCACCCCGTCA-3′ |
Reverse primer sequence 5′>3′ | 5′-AATACCTGCCCAAGGCTTCC-3′ | ||
NF1 | 37 | Forward primer sequence 5′>3′ | 5′-TTCTCCACTTCACCCCGTCA-3′ |
Reverse primer sequence 5′>3′ | 5′-ACCTACCGTAAACTCGGGTC-3′ | ||
NF1 | 39 | Forward primer sequence 5′>3′ | 5′-TCTCCAGGCCTGATTCTAGGT-3′ |
Reverse primer sequence 5′>3′ | 5′-AATACCTGCCCAAGGCTTCC-3′ | ||
RB1 | 17 | Forward primer sequence 5′>3′ | 5′-CTTTCCCATGGATTCTGAATGTGC-3′ |
Reverse primer sequence 5′>3′ | 5′-AGATGGTTTAGGGTGCTCGAT-3′ | ||
RB1 | 20 | Forward primer sequence 5′>3′ | 5′-CTTCCACCAGGGTAGGTCAAAA-3′ |
Reverse primer sequence 5′>3′ | 5′-ATAGATTTTCTTCACCCCGCCC-3′ |
Gene | Forward Primer | Reverse Primer |
---|---|---|
CD324 | GAACGCATTGCCACATACAC | GAATTCGGGCTTGTTGTCAT |
ZO1 | CAACATACAGTGACGCTTCACA | CACTATTGACGTTTCCCCACTC |
CD325 | TGTTTGACTATGAAGGCAGTGG | TCAGTCATCACCTCCACCAT |
VIM | ATCCAAGTTTGCTGACCTCTC | CTCAGTGGACTCCTGCTTTG |
SNAI1 | CTTCCAGCAGCCCTACGAC | CGGTGGGGTTGAGGATCT |
SOX2 | TTTGTCGGAGACGGAGAAGC | CCCGCTCGCCATGCTATT |
OCT4 | GGGGGTTCTATTTGGGAAGGTA | ACTGGGCGATGTGGCTGAT |
CD44 | CGTGGAATACACCTGCAAAGC | CGGACACCATGGACAAGTTTT |
ALDH1A1 | CCACTCACTGAATCATGCCA | CTGAGCCAGTCACCTGTGTTC |
NANOG | AATGGTGTGACGCAGGGATG | GCAGGAGAATTTGGCTGGAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shnaider, P.V.; Malyants, I.K.; Ivanova, O.M.; Gordeeva, V.D.; Svirina, E.A.; Zakharzhevskaya, N.B.; Shagaleeva, O.Y.; Selezneva, O.V.; Bogomazova, A.N.; Lukina, M.M.; et al. Establishment of Novel High-Grade Serous Ovarian Carcinoma Cell Line OVAR79. Int. J. Mol. Sci. 2024, 25, 13236. https://doi.org/10.3390/ijms252413236
Shnaider PV, Malyants IK, Ivanova OM, Gordeeva VD, Svirina EA, Zakharzhevskaya NB, Shagaleeva OY, Selezneva OV, Bogomazova AN, Lukina MM, et al. Establishment of Novel High-Grade Serous Ovarian Carcinoma Cell Line OVAR79. International Journal of Molecular Sciences. 2024; 25(24):13236. https://doi.org/10.3390/ijms252413236
Chicago/Turabian StyleShnaider, Polina V., Irina K. Malyants, Olga M. Ivanova, Veronika D. Gordeeva, Ekaterina A. Svirina, Natalya B. Zakharzhevskaya, Olga Y. Shagaleeva, Oksana V. Selezneva, Alexandra N. Bogomazova, Maria M. Lukina, and et al. 2024. "Establishment of Novel High-Grade Serous Ovarian Carcinoma Cell Line OVAR79" International Journal of Molecular Sciences 25, no. 24: 13236. https://doi.org/10.3390/ijms252413236
APA StyleShnaider, P. V., Malyants, I. K., Ivanova, O. M., Gordeeva, V. D., Svirina, E. A., Zakharzhevskaya, N. B., Shagaleeva, O. Y., Selezneva, O. V., Bogomazova, A. N., Lukina, M. M., Aleshikova, O. I., Babaeva, N. A., Slonov, A. V., & Shender, V. O. (2024). Establishment of Novel High-Grade Serous Ovarian Carcinoma Cell Line OVAR79. International Journal of Molecular Sciences, 25(24), 13236. https://doi.org/10.3390/ijms252413236