gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae
Abstract
1. Introduction
2. Results
2.1. GαsS Temporal Expression Analysis in the Zebrafish
2.2. Determination of Optimal Morpholino Dose for gnas Gene Knockdown in Zebrafish
2.2.1. Knockdown Efficacy at 48 Hours Post-Fertilization
2.2.2. Toxicity Assessment of the Morpholino Doses
2.3. Phenotypic Analyses of gnas Morphants
2.3.1. gnas Knockdown Increased Neutral Lipid Content and Yolk Sac Size in Zebrafish Larvae at 120 hpf
2.3.2. gnas Knockdown Led to a Significant, Specific Reduction in Metabolic Rate
2.3.3. gnas Morphants Exhibited Skeletal Abnormalities and Reduced Body Lengths
2.3.4. gnas Morphants Showed a Slight but Non-Specific Increase in Mean Larval Wet Mass
2.3.5. gnas Knockdown Resulted in Delayed Hatching at 72 hpf
2.3.6. gnas Morphants Manifested Largely Increased Triglyceride Levels with No Appreciable Changes in cAMP and Leptin Levels
3. Discussion
3.1. Limitations
3.2. Implications and Future Directions
4. Materials and Methods
4.1. Zebrafish Husbandry and Ethical Compliance
4.2. Experimental Design
4.3. Morpholino Design and Preparation
4.4. Microinjection Procedure
4.5. Western Blotting
4.6. Assessment of Survival, Hatching, and Tail-Flicking Rates
4.7. Brightfield Imaging and Morphometric Measurements
4.8. Larval Wet Body Mass Measurement
4.9. Oil Red O Staining, Extraction, and Quantification in Zebrafish Larvae
4.10. AlamarBlueTM Zebrafish Metabolic Rate Assay
4.11. Measurement of Triglyceride, cAMP, and Leptin Levels in Larval Zebrafish Using ELISA
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Raatz, S.; Gross, A.C. Clinical Assessment and Treatment of Early-Onset Severe Obesity. Curr. Obes. Rep. 2021, 10, 31–38. [Google Scholar] [CrossRef] [PubMed]
- WHO. Obesity and Overweight. 2021. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 5 January 2023).
- Farrag, N.S.; Cheskin, L.J.; Farag, M.K. A systematic review of childhood obesity in the Middle East and North Africa (MENA) region: Prevalence and risk factors meta-analysis. Adv. Pediatr. Res. 2017, 4, 8. [Google Scholar] [PubMed]
- Al-Thani, M.; Al-Thani, A.; Alyafei, S.; Al-Chetachi, W.; Khalifa, S.; Ahmed, A.; Ahmad, A.; Vinodson, B.; Akram, H. The prevalence and characteristics of overweight and obesity among students in Qatar. Public Health 2018, 160, 143–149. [Google Scholar] [CrossRef]
- Morales Camacho, W.J.; Díaz, J.M.M.; Ortiz, S.P.; Ortiz, J.E.P.; Camacho, M.A.M.; Calderón, B.P. Childhood obesity: Aetiology, comorbidities, and treatment. Diabetes/Metab. Res. Rev. 2019, 35, e3203. [Google Scholar] [CrossRef]
- Choquet, H.; Meyre, D. Genomic insights into early-onset obesity. Genome Med. 2010, 2, 36. [Google Scholar] [CrossRef]
- Loos, R.J.F.; Yeo, G.S.H. The genetics of obesity: From discovery to biology. Nat. Rev. Genet. 2022, 23, 120–133. [Google Scholar] [CrossRef] [PubMed]
- Huvenne, H.; Dubern, B.; Clément, K.; Poitou, C. Rare Genetic Forms of Obesity: Clinical Approach and Current Treatments in 2016. Obes. Facts 2016, 9, 158–173. [Google Scholar] [CrossRef]
- Niazi, R.K.; Gjesing, A.P.; Hollensted, M.; Have, C.T.; Borisevich, D.; Grarup, N.; Pedersen, O.; Ullah, A.; Shahid, G.; Shafqat, I.; et al. Screening of 31 genes involved in monogenic forms of obesity in 23 Pakistani probands with early-onset childhood obesity: A case report. BMC Med. Genet. 2019, 20, 152. [Google Scholar] [CrossRef]
- El Goundali, K.; Chebabe, M.; Laamiri, F.Z.; Hilali, A. The Determinants of Consanguineous Marriages among the Arab Population: A Systematic Review. Iran J. Public Health 2022, 51, 253–265. [Google Scholar] [CrossRef]
- Saeed, S.; Arslan, M.; Froguel, P. Genetics of Obesity in Consanguineous Populations: Toward Precision Medicine and the Discovery of Novel Obesity Genes. Obesity 2018, 26, 474–484. [Google Scholar] [CrossRef]
- Mohammed, I.; Haris, B.; Al-Barazenji, T.; Vasudeva, D.; Tomei, S.; Al Azwani, I.; Dauleh, H.; Shehzad, S.; Chirayath, S.; Mohamadsalih, G.; et al. Understanding the Genetics of Early-Onset Obesity in a Cohort of Children From Qatar. J. Clin. Endocrinol. Metab. 2023, 108, 3201–3213. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, L.S.; Liu, J.; Sakamoto, A.; Xie, T.; Chen, M. Minireview: GNAS: Normal and Abnormal Functions. Endocrinology 2004, 145, 5459–5464. [Google Scholar] [CrossRef] [PubMed]
- Turan, S.; Bastepe, M. The GNAS Complex Locus and Human Diseases Associated with Loss-of-Function Mutations or Epimutations within This Imprinted Gene. Horm. Res. Paediatr. 2013, 80, 229–241. [Google Scholar] [CrossRef] [PubMed]
- Lemos, M.C.; Thakker, R.V. GNAS mutations in Pseudohypoparathyroidism type 1a and related disorders. Hum. Mutat. 2015, 36, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, G.; de Sanctis, L.; Barbieri, A.M.; Elli, F.M.; Bollati, V.; Vaira, V.; Labarile, P.; Bondioni, S.; Peverelli, E.; Lania, A.G.; et al. Pseudohypoparathyroidism and GNAS epigenetic defects: Clinical evaluation of albright hereditary osteodystrophy and molecular analysis in 40 patients. J. Clin. Endocrinol. Metab. 2010, 95, 651–658. [Google Scholar] [CrossRef]
- Chang, G.; Li, Q.; Li, N.; Li, G.; Li, J.; Ding, Y.; Huang, X.; Shen, Y.; Wang, J.; Wang, X. Evaluating the variety of GNAS inactivation disorders and their clinical manifestations in 11 Chinese children. BMC Endocr. Disord. 2022, 22, 70. [Google Scholar] [CrossRef]
- Mendes de Oliveira, E.; Keogh, J.M.; Talbot, F.; Henning, E.; Ahmed, R.; Perdikari, A.; Bounds, R.; Wasiluk, N.; Ayinampudi, V.; Barroso, I.; et al. Obesity-Associated GNAS Mutations and the Melanocortin Pathway. N. Engl. J. Med. 2021, 385, 1581–1592. [Google Scholar] [CrossRef]
- Grüters-Kieslich, A.; Reyes, M.; Sharma, A.; Demirci, C.; DeClue, T.J.; Lankes, E.; Tiosano, D.; Schnabel, D.; Jüppner, H. Early-Onset Obesity: Unrecognized First Evidence for GNAS Mutations and Methylation Changes. J. Clin. Endocrinol. Metab. 2017, 102, 2670–2677. [Google Scholar] [CrossRef]
- Germain-Lee, E.L.; Schwindinger, W.; Crane, J.L.; Zewdu, R.; Zweifel, L.S.; Wand, G.; Huso, D.L.; Saji, M.; Ringel, M.D.; Levine, M.A. A Mouse Model of Albright Hereditary Osteodystrophy Generated by Targeted Disruption of Exon 1 of the Gnas Gene. Endocrinology 2005, 146, 4697–4709. [Google Scholar] [CrossRef]
- Chen, M.; Berger, A.; Kablan, A.; Zhang, J.; Gavrilova, O.; Weinstein, L.S. Gsα Deficiency in the Paraventricular Nucleus of the Hypothalamus Partially Contributes to Obesity Associated with Gsα Mutations. Endocrinology 2012, 153, 4256–4265. [Google Scholar] [CrossRef]
- Chen, M.; Shrestha, Y.B.; Podyma, B.; Cui, Z.; Naglieri, B.; Sun, H.; Ho, T.; Wilson, E.A.; Li, Y.-Q.; Gavrilova, O.; et al. Gsα deficiency in the dorsomedial hypothalamus underlies obesity associated with Gsα mutations. J. Clin. Investig. 2017, 127, 500–510. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Wilson, E.A.; Cui, Z.; Sun, H.; Shrestha, Y.B.; Podyma, B.; Le, C.H.; Naglieri, B.; Pacak, K.; Gavrilova, O.; et al. Gsα deficiency in the dorsomedial hypothalamus leads to obesity, hyperphagia, and reduced thermogenesis associated with impaired leptin signaling. Mol. Metab. 2019, 25, 142–153. [Google Scholar] [CrossRef] [PubMed]
- Perlman, R.L. Mouse models of human disease: An evolutionary perspective. Evol. Med. Public Health 2016, 2016, 170–176. [Google Scholar] [CrossRef]
- Gurumurthy, C.B.; Saunders, T.L.; Ohtsuka, M. Designing and generating a mouse model: Frequently asked questions. J. Biomed. Res. 2021, 35, 76–90. [Google Scholar] [CrossRef]
- Zang, L.; Maddison, L.A.; Chen, W. Zebrafish as a Model for Obesity and Diabetes. Front. Cell Dev. Biol. 2018, 6, 91. [Google Scholar] [CrossRef] [PubMed]
- Faillaci, F.; Milosa, F.; Critelli, R.M.; Turola, E.; Schepis, F.; Villa, E. Obese zebrafish: A small fish for a major human health condition. Anim. Models Exp. Med. 2018, 1, 255–265. [Google Scholar] [CrossRef]
- Veldman, M.B.; Lin, S. Zebrafish as a Developmental Model Organism for Pediatric Research. Pediatr. Res. 2008, 64, 470–476. [Google Scholar] [CrossRef]
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef]
- Bárbara do Carmo Rodrigues, V.; André Rodrigues da Cunha Barreto, V.; Luis David Solis, M. Zebrafish as an Experimental Model for the Study of Obesity. In Zebrafish in Biomedical Research; Yusuf, B., Ed.; IntechOpen: Rijeka, Croatia, 2019; Chapter 4. [Google Scholar]
- Choi, T.-Y.; Choi, T.-I.; Lee, Y.-R.; Choe, S.-K.; Kim, C.-H. Zebrafish as an animal model for biomedical research. Exp. Mol. Med. 2021, 53, 310–317. [Google Scholar] [CrossRef]
- Farmanur Rahman, K.; Saleh Sulaiman, A. Zebrafish (Danio rerio) as a Model Organism. In Current Trends in Cancer Management; Liliana, S., Ionut, G.D., Michael, S., Eds.; IntechOpen: Rijeka, Croatia, 2018; Chapter 1. [Google Scholar]
- Hippe, H.-J.; Wolf, N.M.; Abu-Taha, I.; Mehringer, R.; Just, S.; Lutz, S.; Niroomand, F.; Postel, E.H.; Katus, H.A.; Rottbauer, W.; et al. The interaction of nucleoside diphosphate kinase B with Gβγ dimers controls heterotrimeric G protein function. Proc. Natl. Acad. Sci. USA 2009, 106, 16269–16274. [Google Scholar] [CrossRef]
- Timme-Laragy, A.R.; SKarchner, I.; Hahn, M.E. Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: Applications for developmental toxicology. Methods Mol. Biol. 2012, 889, 51–71. [Google Scholar] [PubMed]
- Bill, B.R.; Petzold, A.M.; Clark, K.J.; Schimmenti, L.A.; Ekker, S.C. A primer for morpholino use in zebrafish. Zebrafish 2009, 6, 69–77. [Google Scholar] [CrossRef] [PubMed]
- Ekker, S.C. Nonconventional antisense in zebrafish for functional genomics applications. Methods Cell Biol. 2004, 77, 121–136. [Google Scholar]
- Ekker, S.C.; Larson, J.D. Morphant technology in model developmental systems. Genesis 2001, 30, 89–93. [Google Scholar] [CrossRef] [PubMed]
- Cheng, B.; Jiang, F.; Su, M.; Zhou, L.; Zhang, H.; Cao, Z.; Liao, X.; Xiong, G.; Xiao, J.; Liu, F.; et al. Effects of lincomycin hydrochloride on the neurotoxicity of zebrafish. Ecotoxicol. Environ. Saf. 2020, 201, 110725. [Google Scholar] [CrossRef]
- Da’as, S.I.; Aamer, W.; Hasan, W.; Al-Maraghi, A.; Al-Kurbi, A.; Kilani, H.; AlRayahi, J.; Zamel, K.; Stotland, M.A.; Fakhro, K.A. PGAP3 Associated with Hyperphosphatasia with Mental Retardation Plays a Novel Role in Brain Morphogenesis and Neuronal Wiring at Early Development. Cells 2020, 9, 1782. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Pickart, M.A.; Klee, E.W.; Nielsen, A.L.; Sivasubbu, S.; Mendenhall, E.M.; Bill, B.R.; Chen, E.; Eckfeldt, C.E.; Knowlton, M.; Robu, M.E.; et al. Genome-Wide Reverse Genetics Framework to Identify Novel Functions of the Vertebrate Secretome. PLoS ONE 2006, 1, e104. [Google Scholar] [CrossRef][Green Version]
- Zoupa, M.; Machera, K. Zebrafish as an Alternative Vertebrate Model for Investigating Developmental Toxicity—The Triadimefon Example. Int. J. Mol. Sci. 2017, 18, 817. [Google Scholar] [CrossRef]
- Imrie, D.; Sadler, K.C. White adipose tissue development in zebrafish is regulated by both developmental time and fish size. Dev. Dyn. 2010, 239, 3013–3023. [Google Scholar] [CrossRef]
- Fukushima, H.; Bailone, R.L.; Corrêa, T.; Janke, H.; De Aguiar, L.K.; Setti, P.G.; Borra, R.C. Zebrafish toxicological screening could aid Leishmaniosis drug discovery. Lab. Anim. Res. 2021, 37, 27. [Google Scholar] [CrossRef] [PubMed]
- Fraher, D.; Sanigorski, A.; Mellett, N.A.; Meikle, P.J.; Sinclair, A.J.; Gibert, Y. Zebrafish Embryonic Lipidomic Analysis Reveals that the Yolk Cell Is Metabolically Active in Processing Lipid. Cell Rep. 2016, 14, 1317–1329. [Google Scholar] [CrossRef] [PubMed]
- Sant, K.E.; Timme-Laragy, A.R. Zebrafish as a Model for Toxicological Perturbation of Yolk and Nutrition in the Early Embryo. Curr. Environ. Health Rep. 2018, 5, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.M.; Wahba, M.; Yu, L.; Achari, G.; Habibi, H.R. Health Impact Assessment of Sulfolane on Embryonic Development of Zebrafish (Danio rerio). Toxics 2019, 7, 42. [Google Scholar] [CrossRef]
- Renquist, B.J.; Zhang, C.; Williams, S.Y.; Cone, R.D. Development of an assay for high-throughput energy expenditure monitoring in the zebrafish. Zebrafish 2013, 10, 343–352. [Google Scholar] [CrossRef]
- Hsieh, Y.W.; Tsai, Y.-W.; Lai, H.-H.; Lai, C.-Y.; Lin, C.-Y.; Her, G.M. Depletion of Alpha-Melanocyte-Stimulating Hormone Induces Insatiable Appetite and Gains in Energy Reserves and Body Weight in Zebrafish. Biomedicines 2021, 9, 941. [Google Scholar] [CrossRef]
- Nesan, D.; Vijayan, M.M. Maternal Cortisol Mediates Hypothalamus-Pituitary-Interrenal Axis Development in Zebrafish. Sci. Rep. 2016, 6, 22582. [Google Scholar] [CrossRef]
- Schubert, S.; Keddig, N.; Hanel, R.; Kammann, U. Microinjection into zebrafish embryos (Danio rerio)—A useful tool in aquatic toxicity testing? Environ. Sci. Eur. 2014, 26, 32. [Google Scholar] [CrossRef]
- Westerfield, M. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), 5th ed.; University of Oregon Press: Eugene, Oregon, 2007. [Google Scholar]
- Basnet, R.M.; Guarienti, M.; Memo, M. Zebrafish Embryo as an In Vivo Model for Behavioral and Pharmacological Characterization of Methylxanthine Drugs. Int. J. Mol. Sci. 2017, 18, 596. [Google Scholar] [CrossRef]
- Lu, D.; Dong, A.; Zhang, J.; Guo, X. A novel GNAS mutation in pseudohypoparathyroidism type 1a in a Chinese man presented with recurrent seizure: A case report. BMC Endocr. Disord. 2021, 21, 12. [Google Scholar] [CrossRef]
- Tocher, D.R. Metabolism and Functions of Lipids and Fatty Acids in Teleost Fish. Rev. Fish. Sci. 2003, 11, 107–184. [Google Scholar] [CrossRef]
- Rod-In, W.; Monmai, C.; Shin, I.-S.; You, S.; Park, W.J. Neutral Lipids, Glycolipids, and Phospholipids, Isolated from Sandfish (Arctoscopus japonicus) Eggs, Exhibit Anti-Inflammatory Activity in LPS-Stimulated RAW264.7 Cells through NF-κB and MAPKs Pathways. Mar. Drugs 2020, 18, 480. [Google Scholar] [CrossRef] [PubMed]
- Quinlivan, V.H.; Farber, S.A. Lipid Uptake, Metabolism, and Transport in the Larval Zebrafish. Front. Endocrinol. 2017, 8, 319. [Google Scholar] [CrossRef]
- Lucore, E.C.; Connaughton, V.P. Observational learning and irreversible starvation in first-feeding zebrafish larvae: Is it okay to copy from your friends? Zoology 2021, 145, 125896. [Google Scholar] [CrossRef]
- Shoemaker, A.H.; Jüppner, H. Nonclassic features of pseudohypoparathyroidism type 1A. Curr. Opin. Endocrinol. Diabetes Obes. 2017, 24, 33–38. [Google Scholar] [CrossRef]
- Miyares, R.L.; de Rezende, V.B.; Farber, S.A. Zebrafish yolk lipid processing: A tractable tool for the study of vertebrate lipid transport and metabolism. Dis. Models Mech. 2014, 7, 915–927. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Dalman, M.; Chen, Y.; Akhter, M.; Brahmandam, S.; Patel, Y.; Lowe, J.; Thakkar, M.; Gregory, A.-V.; Phelps, D.; et al. Knockdown of leptin A expression dramatically alters zebrafish development. Gen. Comp. Endocrinol. 2012, 178, 562–572. [Google Scholar] [CrossRef]
- Wilson, L.C.; Hall, C.M. Albright’s hereditary osteodystrophy and pseudohypoparathyroidism. Semin. Musculoskelet. Radiol. 2002, 6, 273–283. [Google Scholar] [CrossRef]
- Simon, A.; Koppeschaar, H.P.F.; Roijers, J.F.M.; Höppener, J.W.M.; Lips, C.J.M. Pseudohypoparathyroidism type Ia. Albright hereditary osteodystrophy: A model for research on G protein-coupled receptors and genomic imprinting. Neth. J. Med. 2000, 56, 100–109. [Google Scholar] [CrossRef]
- Levine, M.A.; Ahn, T.G.; Klupt, S.F.; Kaufman, K.D.; Smallwood, P.M.; Bourne, H.R.; A Sullivan, K.; Van Dop, C. Genetic deficiency of the alpha subunit of the guanine nucleotide-binding protein Gs as the molecular basis for Albright hereditary osteodystrophy. Proc. Natl. Acad. Sci. USA 1988, 85, 617–621. [Google Scholar] [CrossRef]
- Germain-Lee, E.L. Management of pseudohypoparathyroidism. Curr. Opin. Pediatr. 2019, 31, 537–549. [Google Scholar] [CrossRef] [PubMed]
- Miyakawa, Y.; Takasawa, K.; Matsubara, Y.; Ihara, K.; Ohtsu, Y.; Kamasaki, H.; Kitsuda, K.; Kobayashi, H.; Satoh, M.; Sano, S.; et al. Language delay and developmental catch-up would be a clinical feature of pseudohypoparathyroidism type 1A during childhood. Endocr. J. 2019, 66, 215–221. [Google Scholar] [CrossRef]
- Abbas, A.; Hammad, A.S.; Al-Shafai, M. The role of genetic and epigenetic GNAS alterations in the development of early-onset obesity. Mutat. Res. /Rev. Mutat. Res. 2024, 793, 108487. [Google Scholar] [CrossRef] [PubMed]
- Shibata, T.; Kawakami, K.; Kawana, H.; Aoki, J.; Inoue, A. Phenotypic evaluation of constitutive GPCR/G-protein signaling in zebrafish embryos and larvae. Biochem. Biophys. Res. Commun. 2022, 602, 70–76. [Google Scholar] [CrossRef]
- Liu, R.; Kinoshita, M.; Adolfi, M.C.; Schartl, M. Analysis of the Role of the Mc4r System in Development, Growth, and Puberty of Medaka. Front. Endocrinol. 2019, 10, 213. [Google Scholar] [CrossRef] [PubMed]
- Krejszeff, S.; Żarski, D.; Palińska-Żarska, K.; Trąbska, I.; Kupren, K.; Targońska, K.; Bowszys, M.; Kucharczyk, D. Procedure for Harmless Estimation of Fish Larvae Weight. Ital. J. Anim. Sci. 2013, 12, e44. [Google Scholar] [CrossRef][Green Version]
- Avella, M.A.; Place, A.; Du, S.-J.; Williams, E.; Silvi, S.; Zohar, Y.; Carnevali, O. Lactobacillus rhamnosus accelerates zebrafish backbone calcification and gonadal differentiation through effects on the GnRH and IGF systems. PLoS ONE 2012, 7, e45572. [Google Scholar] [CrossRef]
- Czopka, T.; Lyons, D.A. Chapter 2—Dissecting Mechanisms of Myelinated Axon Formation Using Zebrafish. In Methods in Cell Biology; Detrich, H.W., Westerfield, M., Zon, L.I., Eds.; Academic Press: Cambridge, MA, USA, 2011; pp. 25–62. [Google Scholar]
- Linglart, A.; Levine, M.A.; Jüppner, H. Pseudohypoparathyroidism. Endocrinol. Metab. Clin. N. Am. 2018, 47, 865–888. [Google Scholar] [CrossRef]
- Moulton, J.D. Making a Morpholino Experiment Work: Controls, Favoring Specificity, Improving Efficacy, Storage, and Dose. In Morpholino Oligomers: Methods and Protocols; Moulton, H.M., Moulton, J.D., Eds.; Springer: New York, NY, USA, 2017; pp. 17–29. [Google Scholar]
- Yoganantharjah, P.; Byreddy, A.R.; Fraher, D.; Puri, M.; Gibert, Y. Rapid quantification of neutral lipids and triglycerides during zebrafish embryogenesis. Int. J. Dev. Biol. 2017, 61, 105–111. [Google Scholar] [CrossRef]
- Choe, C.P.; Choi, S.-Y.; Kee, Y.; Kim, M.J.; Kim, S.-H.; Lee, Y.; Park, H.-C. Transgenic fluorescent zebrafish lines that have revolutionized biomedical research. Lab. Anim. Res. 2021, 37, 26. [Google Scholar] [CrossRef]
- Gao, F.; Yang, S.; Wang, J.; Zhu, G. cAMP-PKA cascade: An outdated topic for depression? Biomed. Pharmacother. 2022, 150, 113030. [Google Scholar] [CrossRef] [PubMed]
- Jüppner, H. Obesity and Gαs Variants. N. Engl. J. Med. 2021, 385, 1619–1622. [Google Scholar] [CrossRef] [PubMed]
- Niederriter, A.R.; Davis, E.E.; Golzio, C.; Oh, E.C.; Tsai, I.C.; Katsanis, N. In vivo modeling of the morbid human genome using Danio rerio. J. Vis. Exp. 2013, e50338. [Google Scholar]
- Moulton, J.D.; Yan, Y.L. Using Morpholinos to control gene expression. Curr. Protoc. Mol. Biol. 2008, 83, 26.8.1–26.8.29. [Google Scholar] [CrossRef]
- Al-Jamal, O.; Al-Jighefee, H.; Younes, N.; Abdin, R.; Al-Asmakh, M.A.; Radwan, A.B.; Sliem, M.H.; Majdalawieh, A.F.; Pintus, G.; Yassine, H.M.; et al. Organ-specific toxicity evaluation of stearamidopropyl dimethylamine (SAPDMA) surfactant using zebrafish embryos. Sci. Total Environ. 2020, 741, 140450. [Google Scholar] [CrossRef]
MO Name | MO Sequence | Target mRNA Transcript 1 |
---|---|---|
gnas-MO1 | ACCAATGCTTGCTGTTTAACATCCG | XM_001335696.6 |
gnas-MO2 | TCTTACTGTTGCCCAAACAACCCAT | XM_005172124.4 |
Standard Control | CCTCTTACCTCAGTTACAATTTATA | N/A |
Working Solution | Final MO Concentration in Injection Volume (mM) * | Volume of MO Stock Solution (µL) | Volume of Sterile MQ Water (µL) | Volume of 0.5% (w/v) Phenol Red (µL) |
---|---|---|---|---|
Expt MOs (1 ng) | 0.026 | 0.13 (gnas-MO1) | 7.74 | 2 |
0.13 (gnas-MO2) | ||||
Expt MOs (3 ng) | 0.078 | 0.39 (gnas-MO1) | 7.22 | 2 |
0.39 (gnas-MO2) | ||||
Expt MOs (5 ng) | 0.13 | 0.65 (gnas-MO1) | 6.70 | 2 |
0.65 (gnas-MO2) | ||||
Std Ctrl MO (5 ng) | 0.13 | 1.31 (Std Ctrl) | 6.69 | 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abbas, A.; Hammad, A.S.; Zakaria, Z.Z.; Al-Asmakh, M.; Hussain, K.; Al-Shafai, M. gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae. Int. J. Mol. Sci. 2024, 25, 12674. https://doi.org/10.3390/ijms252312674
Abbas A, Hammad AS, Zakaria ZZ, Al-Asmakh M, Hussain K, Al-Shafai M. gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae. International Journal of Molecular Sciences. 2024; 25(23):12674. https://doi.org/10.3390/ijms252312674
Chicago/Turabian StyleAbbas, Alaa, Ayat S Hammad, Zain Z. Zakaria, Maha Al-Asmakh, Khalid Hussain, and Mashael Al-Shafai. 2024. "gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae" International Journal of Molecular Sciences 25, no. 23: 12674. https://doi.org/10.3390/ijms252312674
APA StyleAbbas, A., Hammad, A. S., Zakaria, Z. Z., Al-Asmakh, M., Hussain, K., & Al-Shafai, M. (2024). gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae. International Journal of Molecular Sciences, 25(23), 12674. https://doi.org/10.3390/ijms252312674