Characterization of Feeding Behaviors, Appetite Regulation and Growth Performance of All-Female (cyp17a1+/−;XX Genotype) Common Carp (Cyprinus carpio)
Abstract
1. Introduction
2. Results
2.1. AF Carp Exhibited Faster Feeding Activities
2.2. Gene Expression Involved in Orexigenic Factors
2.3. AF Carp Exhibited More Active Swimming Activities
2.4. AF Carp Exhibited Higher Growth Performance
2.5. The Relationships Between Fish Movement and Their Feeding Behaviors
3. Discussion
4. Materials and Methods
4.1. Fish and Experimental Conditions
4.2. DNA Extraction, Genotype and Sex Confirmation
4.3. Feeding Behavior Assay
4.4. Growth Performance, Feed Intake and Feed Efficiency
4.5. qRT-PCR Analysis
4.6. Data Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Mei, J.; Gui, J.F. Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. Sci. China-Life Sci. 2015, 58, 124–136. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Zhang, X.; Wang, X.; Li, J.; Liu, G.; Kuang, Y.; Xu, J.; Zheng, X.; Ren, L.; Wang, G.; et al. Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat. Genet. 2014, 46, 1212–1219. [Google Scholar] [CrossRef] [PubMed]
- Yue, G.H.; Wang, L. Current status of genome sequencing and its applications in aquaculture. Aquaculture 2017, 468, 337–347. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2020; FAO: Rome, Italy, 2020. [Google Scholar]
- Panicz, R.; Calka, B.; Cubillo, A.; Ferreira, J.G.; Guilder, J.; Kay, S.; Kennerley, A.; Lopes, A.; Lencart, E.S.J.; Taylor, N.; et al. Impact of climate-driven temperature increase on inland aquaculture: Application to land-based production of common carp (Cyprinus carpio L.). Transbound. Emerg. Dis. 2022, 69, e2341–e2350. [Google Scholar] [CrossRef]
- National Bureau of Statistics of China. China Fishery Statistical Yearbook 2022; China Agriculture Press: Beijing, China, 2022. [Google Scholar]
- National Bureau of Statistics of China. China Fishery Statistical Yearbook 2017; China Agriculture Press: Beijing, China, 2017. [Google Scholar]
- Wu, Q.J.; Gui, J. Fish Genetics and Breeding Engineering; Shanghai Science and Technology Press: Shanghai, China, 1999; pp. 73–94. [Google Scholar]
- Singh, A.K. Introduction of modern endocrine techniques for the production of monosex population of fishes. Gen. Comp. Endocrinol. 2013, 181, 146–155. [Google Scholar] [CrossRef]
- Jiang, M.Y.; Wu, X.X.; Chen, K.X.; Luo, H.R.; Yu, W.; Jia, S.T.; Li, Y.M.; Wang, Y.F.; Yang, P.H.; Zhu, Z.Y.; et al. Production of YY Supermale and XY Physiological Female Common Carp for Potential Eradication of this Invasive Species. J. World Aquac. Soc. 2018, 49, 315–327. [Google Scholar] [CrossRef]
- Zhai, G.; Shu, T.T.; Xia, Y.G.; Lu, Y.; Shang, G.H.; Jin, X.; He, J.Y.; Nie, P.; Yin, Z. Characterization of Sexual Trait Development in cyp17a1-Deficient Zebrafish. Endocrinology 2018, 159, 3549–3562. [Google Scholar] [CrossRef]
- Zhai, G.; Shu, T.T.; Chen, K.X.; Lou, Q.Y.; Jia, J.Y.; Huang, J.F.; Shi, C.; Jin, X.; He, J.Y.; Jiang, D.H.; et al. Successful Production of an All-Female Common Carp (Cyprinus carpio L.) Population Using cyp17a1-Deficient Neomale Carp. Engineering 2022, 8, 181–189. [Google Scholar] [CrossRef]
- Chen, G.; Huang, J.; Jia, J.; Lou, Q.; Shi, C.; Yasheng, M.; Zhao, Y.; Yuan, Q.; Tang, K.; Liu, X.; et al. The food safety assessment of all-female common carp (Cyprinus carpio)(cyp17a1+/−; XX genotype) generated using genome editing technology. Food Chem. Toxicol. 2023, 181, 114103. [Google Scholar] [CrossRef]
- Brothers, E.B. Age and growth studies on tropical fishes. In Stock Assessment for Tropical Small-Scale Fisheries: Proceedings of an International Workshop Held September 19–21, 1979 at the University of Rhode Island, Kingston, R.I.; International Center for Marine Resource Development, University of Rhode Island: Narragansett, RI, USA, 1979; pp. 119–136. [Google Scholar]
- Assan, D.; Huang, Y.L.; Mustapha, U.F.; Addah, M.N.; Li, G.L.; Chen, H.P. Fish Feed Intake, Feeding Behavior, and the Physiological Response of Apelin to Fasting and Refeeding. Front. Endocrinol. 2021, 12, 798903. [Google Scholar] [CrossRef]
- Nguyen, N.H. Genetic improvement for important farmed aquaculture species with a reference to carp, tilapia and prawns in Asia: Achievements, lessons and challenges. Fish Fish. 2016, 17, 483–506. [Google Scholar] [CrossRef]
- Craig, S.R.; Helfrich, L.A.; Kuhn, D.; Schwarz, M.H. Understanding Fish Nutrition, Feeds, and Feeding; Virginia State University: Petersburg, VA, USA, 2017; pp. 1–6. [Google Scholar]
- Zhong, C.R.; Song, Y.L.; Wang, Y.P.; Zhang, T.L.; Duan, M.; Li, Y.M.; Liao, L.J.; Zhu, Z.Y.; Hu, W. Increased food intake in growth hormone-transgenic common carp (Cyprinus carpio L.) may be mediated by upregulating Agouti-related protein (AgRP). Gen. Comp. Endocrinol. 2013, 192, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Biro, P.A.; Stamps, J.A. Are animal personality traits linked to life-history productivity? Trends Ecol. Evol. 2008, 23, 361–368. [Google Scholar] [CrossRef] [PubMed]
- Toscano, B.J.; Gownaris, N.J.; Heerhartz, S.M.; Monaco, C.J. Personality, foraging behavior and specialization: Integrating behavioral and food web ecology at the individual level. Oecologia 2016, 182, 55–69. [Google Scholar] [CrossRef]
- Li, B.; Liang, W.; Fu, S.; Fu, C.; Cai, Z.; Munson, A.; Shi, H. Swimming behavior affects ingestion of microplastics by fish. Aquat. Toxicol. 2023, 266, 106798. [Google Scholar] [CrossRef]
- Chen, Y.L.; Li, W.W.; Xiang, L.L.; Mi, X.Y.; Duan, M.; Wu, C.X. Fish personality affects their exposure to microplastics. Ecotoxicol. Environ. Safe 2022, 233, 113301. [Google Scholar] [CrossRef]
- Lin, X.W.; Volkoff, H.; Narnaware, Y.; Bernier, N.J.; Peyon, P.; Peter, R.E. Brain regulation of feeding behavior and food intake in fish. Comp. Biochem. Physiol. A 2000, 126, 415–434. [Google Scholar] [CrossRef]
- Volkoff, H. The Neuroendocrine Regulation of Food Intake in Fish: A Review of Current Knowledge. Front. Neurosci. 2016, 10, 540. [Google Scholar] [CrossRef]
- Volkoff, H.; Peter, R.E. Feeding Behavior of Fish and Its Control. Zebrafish 2006, 3, 131–140. [Google Scholar] [CrossRef]
- Volkoff, H.; Hoskins, L.J.; Tuziak, S.M. Influence of intrinsic signals and environmental cues on the endocrine control of feeding in fish: Potential application in aquaculture. Gen. Comp. Endocrinol. 2010, 167, 352–359. [Google Scholar] [CrossRef]
- Elvy, J.E.; Symonds, J.E.; Hilton, Z.; Walker, S.P.; Tremblay, L.A.; Casanovas, P.; Herbert, N.A. The relationship of feed intake, growth, nutrient retention, and oxygen consumption to feed conversion ratio of farmed saltwater Chinook salmon (Oncorhynchus tshawytscha). Aquaculture 2022, 554, 738184. [Google Scholar] [CrossRef]
- Johnsson, J.I.; Bjornsson, B.T. Growth-Hormone Increases Growth-Rate, Appetite and Dominance in Juvenile Rainbow-Trout, Oncorhynchus-Mykiss. Anim. Behav. 1994, 48, 177–186. [Google Scholar] [CrossRef]
- Devlin, R.H.; Yesaki, T.Y.; Biagi, C.A.; Donaldson, E.M.; Swanson, P.; Chan, W.K. Extraordinary Salmon Growth. Nature 1994, 371, 209–210. [Google Scholar] [CrossRef]
- Sundström, L.F.; Devlin, R.H.; Johnsson, J.I.; Biagi, C.A. Vertical position reflects increased feeding motivation in growth hormone transgenic coho salmon (Oncorhynchus kisutch). Ethology 2003, 109, 701–712. [Google Scholar] [CrossRef]
- Gonçalves, D.; Fusani, B.; Cardoso, S.D.; Canário, A.V. Hormones and sexual behavior of teleost fishes. In Hormones and Reproduction of Vertebrates; Academic Press: Cambridge, MA, USA, 2024; Volume 1. [Google Scholar]
- Laskowski, K.L.; Seebacher, F.; Habedank, M.; Meka, J.; Bierbach, D. Two Locomotor Traits Show Different Patterns of Developmental Plasticity Between Closely Related Clonal and Sexual Fish. Front. Physiol. 2021, 12, 740604. [Google Scholar] [CrossRef]
- Volkoff, H.; Canosa, L.F.; Unniappan, S.; Cerdá-Reverter, J.M.; Bernier, N.J.; Kelly, S.P.; Peter, R.E. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 2005, 142, 3–19. [Google Scholar] [CrossRef]
- Cerda-Reverter, J.M.; Peter, R.E. Endogenous melanocortin antagonist in fish: Structure, brain mapping, and regulation by fasting of the goldfish agouti-related protein gene. Endocrinology 2003, 144, 4552–4561. [Google Scholar] [CrossRef]
- Song, Y.; Golling, G.; Thacker, T.L.; Cone, R.D. Agouti-related protein (AGRP) is conserved and regulated by metabolic state in the zebrafish. Endocrine 2003, 22, 257–265. [Google Scholar] [CrossRef]
- Volkoff, H.; Bjorklund, J.M.; Peter, R.E. Stimulation of feeding behavior and food consumption in the goldfish, Carassius auratus, by orexin-A and orexin-B. Brain Res. 1999, 846, 204–209. [Google Scholar] [CrossRef]
- Chen, G.H.; Song, C.C.; Zhao, T.; Hogstrand, C.; Wei, X.L.; Lv, W.H.; Song, Y.F.; Luo, Z. Mitochondria-Dependent Oxidative Stress Mediates ZnO Nanoparticle (ZnO NP)-Induced Mitophagy and Lipotoxicity in Freshwater Teleost Fish. Environ. Sci. Technol. 2022, 56, 2407–2420. [Google Scholar] [CrossRef]
Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
gh | TGCTATTGTCGGTGGT | CTGTCTGCGTTCCTCA |
npy | TGCTTGGGAACTCTAACGGAA | GACCTTTTGCCATACCTCTGC |
agrp1 | CCGTGCATCCCTCATCAGC | GCTACGGCAGTAGCAGAAGGC |
orxin | AATCCTGACGATGGGAAAGAG | TCGTGGTTTTAGCGACAAGTG |
β-actin | GATGATGAAATTGCCGCACTG | ACCAACCATGACACCCTGATGT |
cyp17a1 | GTGGCATTGAAGAATTCGCAT | CCGTATTTCTTCTGCAGCTGC |
Sex marker | GAGCATCCACTGTCAACTT | ACTCTTCCCAAACACTGATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Zou, Q.; Liu, X.; Lou, Q.; Jin, X.; He, J.; Yin, Z.; Zhai, G.; Duan, M.; Chen, G. Characterization of Feeding Behaviors, Appetite Regulation and Growth Performance of All-Female (cyp17a1+/−;XX Genotype) Common Carp (Cyprinus carpio). Int. J. Mol. Sci. 2024, 25, 12517. https://doi.org/10.3390/ijms252312517
Li X, Zou Q, Liu X, Lou Q, Jin X, He J, Yin Z, Zhai G, Duan M, Chen G. Characterization of Feeding Behaviors, Appetite Regulation and Growth Performance of All-Female (cyp17a1+/−;XX Genotype) Common Carp (Cyprinus carpio). International Journal of Molecular Sciences. 2024; 25(23):12517. https://doi.org/10.3390/ijms252312517
Chicago/Turabian StyleLi, Xuehui, Qingqing Zou, Xuebo Liu, Qiyong Lou, Xia Jin, Jiangyan He, Zhan Yin, Gang Zhai, Ming Duan, and Guanghui Chen. 2024. "Characterization of Feeding Behaviors, Appetite Regulation and Growth Performance of All-Female (cyp17a1+/−;XX Genotype) Common Carp (Cyprinus carpio)" International Journal of Molecular Sciences 25, no. 23: 12517. https://doi.org/10.3390/ijms252312517
APA StyleLi, X., Zou, Q., Liu, X., Lou, Q., Jin, X., He, J., Yin, Z., Zhai, G., Duan, M., & Chen, G. (2024). Characterization of Feeding Behaviors, Appetite Regulation and Growth Performance of All-Female (cyp17a1+/−;XX Genotype) Common Carp (Cyprinus carpio). International Journal of Molecular Sciences, 25(23), 12517. https://doi.org/10.3390/ijms252312517