Effect of Low-Molecular-Weight Hyaluronate-Based Nanoparticles on the In Vitro Expression of Cartilage Markers
Abstract
1. Introduction
2. Results
2.1. Characterization of NPs by DLS
2.2. Drying of Nanosuspensions and Evaluation of Resulting Powder
2.3. Redispersion of Powders in Different Physiological Media
2.4. Effects of NPs on Horse Chondrocytes
2.4.1. Viability
2.4.2. Gene Expression Analysis of Cartilage Markers
2.4.3. Immunofluorescent Staining
2.4.4. Scanning Electron Microscopy
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Production of Sodium Hyaluronate Nanoparticles
4.3. Characterization of NPs by Dynamic Light Scattering (DLS) and z-Potential
4.4. Drying of Nanoparticles
4.5. Evaluation of Particle Size Distribution of the Powder
4.6. Redispersion of the Powder
4.7. Cell Cultures
4.7.1. Establishment of Primary Culture of Horse Chondrocytes
4.7.2. MTT Assay
4.8. Gene Expression Analysis of Differentiation Markers
4.8.1. Total RNA Extraction and cDNA Synthesis
4.8.2. Reverse Transcription (RT)
4.8.3. Quantification of mRNA by Real-Time PCR (qPCR)
4.9. Immunofluorescent Staining
4.10. Scanning Electron Microscopy
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gupta, R.C.; Lall, R.; Srivastava, A.; Sinha, A. Hyaluronic Acid: Molecular Mechanisms and Therapeutic Trajectory. Front. Vet. Sci. 2019, 6, 458280. [Google Scholar] [CrossRef] [PubMed]
- Cyphert, J.M.; Trempus, C.S.; Garantziotis, S. Size Matters: Molecular Weight Specificity of Hyaluronan Effects in Cell Biology. Int. J. Cell Biol. 2015, 2015, 563818. [Google Scholar] [CrossRef] [PubMed]
- Fuchs, K.; Hippe, A.; Schmaus, A.; Homey, B.; Sleeman, J.P.; Orian-Rousseau, V. Opposing Effects of High- and Low-Molecular Weight Hyaluronan on CXCL12-Induced CXCR4 Signaling Depend on CD44. Cell Death Dis. 2013, 4, e819. [Google Scholar] [CrossRef] [PubMed]
- Rayahin, J.E.; Buhrman, J.S.; Zhang, Y.; Koh, T.J.; Gemeinhart, R.A. High and Low Molecular Weight Hyaluronic Acid Differentially Influence Macrophage Activation. ACS Biomater. Sci. Eng. 2015, 1, 481–493. [Google Scholar] [CrossRef] [PubMed]
- Maharjan, A.S.; Pilling, D.; Gomer, R.H. High and Low Molecular Weight Hyaluronic Acid Differentially Regulate Human Fibrocyte Differentiation. PLoS ONE 2011, 6, e26078. [Google Scholar] [CrossRef]
- Smith, M.M.; Ghosh, P. The Synthesis of Hyaluronic Acid by Human Synovial Fibroblasts Is Influenced by the Nature of the Hyaluronate in the Extracellular Environment. Rheumatol. Int. 1987, 7, 113–122. [Google Scholar] [CrossRef]
- Grishko, V.; Xu, M.; Ho, R.; Mates, A.; Watson, S.; Kim, J.T.; Wilson, G.L.; Pearsall, A.W. Effects of Hyaluronic Acid on Mitochondrial Function and Mitochondria-Driven Apoptosis Following Oxidative Stress in Human Chondrocytes. J. Biol. Chem. 2009, 284, 9132–9139. [Google Scholar] [CrossRef]
- Falcone, S.J.; Palmeri, D.M.; Berg, R.A. Rheological and Cohesive Properties of Hyaluronic Acid. J. Biomed. Mater. Res. A 2006, 76, 721–728. [Google Scholar] [CrossRef]
- Weigel, P.H.; Fuller, G.M.; LeBoeuf, R.D. A Model for the Role of Hyaluronic Acid and Fibrin in the Early Events during the Inflammatory Response and Wound Healing. J. Theor. Biol. 1986, 119, 219–234. [Google Scholar] [CrossRef]
- Cowman, M.K.; Shortt, C.; Arora, S.; Fu, Y.; Villavieja, J.; Rathore, J.; Huang, X.; Rakshit, T.; Jung, G.I.; Kirsch, T. Role of Hyaluronan in Inflammatory Effects on Human Articular Chondrocytes. Inflammation 2019, 42, 1808–1820. [Google Scholar] [CrossRef]
- Olsson, M.; Bremer, L.; Aulin, C.; Harris, H.E. Fragmented Hyaluronan Has No Alarmin Function Assessed in Arthritis Synovial Fibroblast and Chondrocyte Cultures. Innate Immun. 2018, 24, 131–141. [Google Scholar] [CrossRef] [PubMed]
- Knudson, W.; Ishizuka, S.; Terabe, K.; Askew, E.B.; Knudson, C.B. The Pericellular Hyaluronan of Articular Chondrocytes. Matrix Biol. 2019, 78–79, 32–46. [Google Scholar] [CrossRef] [PubMed]
- Erickson, M.; Stern, R. Chain Gangs: New Aspects of Hyaluronan Metabolism. Biochem. Res. Int. 2011, 2012, 893947. [Google Scholar] [CrossRef]
- Hua, Q.; Knudson, C.B.; Knudson, W. Internalization of Hyaluronan by Chondrocytes Occurs via Receptor-Mediated Endocytosis. J. Cell Sci. 1993, 106, 365–375. [Google Scholar] [CrossRef]
- Brackin, R.B.; McColgan, G.E.; Pucha, S.A.; Kowalski, M.A.; Drissi, H.; Doan, T.N.; Patel, J.M. Improved Cartilage Protection with Low Molecular Weight Hyaluronic Acid Hydrogel. Bioengineering 2023, 10, 1013. [Google Scholar] [CrossRef]
- Cai, Y.; López-Ruiz, E.; Wengel, J.; Creemers, L.B.; Howard, K.A. A Hyaluronic Acid-Based Hydrogel Enabling CD44-Mediated Chondrocyte Binding and Gapmer Oligonucleotide Release for Modulation of Gene Expression in Osteoarthritis. J. Control. Release 2017, 253, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Ishida, O.; Tanaka, Y.; Morimoto, I.; Takigawa, M.; Eto, S. Chondrocytes Are Regulated by Cellular Adhesion through CD44 and Hyaluronic Acid Pathway. J. Bone Min. Res. 1997, 12, 1657–1663. [Google Scholar] [CrossRef]
- Grogan, S.P.; Barbero, A.; Diaz-Romero, J.; Cleton-Jansen, A.-M.; Soeder, S.; Whiteside, R.; Hogendoorn, P.C.W.; Farhadi, J.; Aigner, T.; Martin, I.; et al. Identification of Markers to Characterize and Sort Human Articular Chondrocytes with Enhanced in Vitro Chondrogenic Capacity. Arthritis Rheum. 2007, 56, 586–595. [Google Scholar] [CrossRef]
- Brown, S.; Kumar, S.; Sharma, B. Intra-Articular Targeting of Nanomaterials for the Treatment of Osteoarthritis. Acta Biomater. 2019, 93, 239–257. [Google Scholar] [CrossRef]
- Jiang, T.; Kan, H.-M.; Rajpura, K.; Carbone, E.J.; Li, Y.; Lo, K.W.-H. Development of Targeted Nanoscale Drug Delivery System for Osteoarthritic Cartilage Tissue. J. Nanosci. Nanotechnol. 2018, 18, 2310–2317. [Google Scholar] [CrossRef]
- Huang, H.; Lou, Z.; Zheng, S.; Wu, J.; Yao, Q.; Chen, R.; Kou, L.; Chen, D. Intra-Articular Drug Delivery Systems for Osteoarthritis Therapy: Shifting from Sustained Release to Enhancing Penetration into Cartilage. Drug Deliv. 2022, 29, 767–791. [Google Scholar] [CrossRef] [PubMed]
- Raj, A.; Wang, M.; Zander, T.; Wieland, D.C.F.; Liu, X.; An, J.; Garamus, V.M.; Willumeit-Römer, R.; Fielden, M.; Claesson, P.M.; et al. Lubrication Synergy: Mixture of Hyaluronan and Dipalmitoylphosphatidylcholine (DPPC) Vesicles. J. Colloid Interface Sci. 2017, 488, 225–233. [Google Scholar] [CrossRef]
- Forsey, R.W.; Fisher, J.; Thompson, J.; Stone, M.H.; Bell, C.; Ingham, E. The Effect of Hyaluronic Acid and Phospholipid Based Lubricants on Friction within a Human Cartilage Damage Model. Biomaterials 2006, 27, 4581–4590. [Google Scholar] [CrossRef] [PubMed]
- Martinelli, F.; Balducci, A.G.; Kumar, A.; Sonvico, F.; Forbes, B.; Bettini, R.; Buttini, F. Engineered Sodium Hyaluronate Respirable Dry Powders for Pulmonary Drug Delivery. Int. J. Pharm. 2017, 517, 286–295. [Google Scholar] [CrossRef]
- Rossi, I.; Buttini, F.; Sonvico, F.; Affaticati, F.; Martinelli, F.; Annunziato, G.; Machado, D.; Viveiros, M.; Pieroni, M.; Bettini, R. Sodium Hyaluronate Nanocomposite Respirable Microparticles to Tackle Antibiotic Resistance with Potential Application in Treatment of Mycobacterial Pulmonary Infections. Pharmaceutics 2019, 11, 203. [Google Scholar] [CrossRef]
- Staskus, P.W.; Johnson, W.C. Conformational Transition of Hyaluronic Acid in Aqueous-Organic Solvent Monitored by Vacuum Ultraviolet Circular Dichroism. Biochemistry 1988, 27, 1522–1527. [Google Scholar] [CrossRef]
- Ghosh, P.; Guidolin, D. Potential Mechanism of Action of Intra-Articular Hyaluronan Therapy in Osteoarthritis: Are the Effects Molecular Weight Dependent? Semin. Arthritis Rheum. 2002, 32, 10–37. [Google Scholar] [CrossRef] [PubMed]
- Pasquali-Ronchetti, I.; Quaglino, D.; Mori, G.; Bacchelli, B.; Ghosh, P. Hyaluronan–Phospholipid Interactions. J. Struct. Biol. 1997, 120, 1–10. [Google Scholar] [CrossRef]
- Kosinska, M.K.; Liebisch, G.; Lochnit, G.; Wilhelm, J.; Klein, H.; Kaesser, U.; Lasczkowski, G.; Rickert, M.; Schmitz, G.; Steinmeyer, J. A Lipidomic Study of Phospholipid Classes and Species in Human Synovial Fluid. Arthritis Rheum. 2013, 65, 2323–2333. [Google Scholar] [CrossRef]
- Park, J.-B.; Duong, C.-T.; Chang, H.-G.; Sharma, A.R.; Thompson, M.S.; Park, S.; Kwak, B.-C.; Kim, T.-Y.; Lee, S.-S.; Park, S. Role of Hyaluronic Acid and Phospholipid in the Lubrication of a Cobalt-Chromium Head for Total Hip Arthroplasty. Biointerphases 2014, 9, 031007. [Google Scholar] [CrossRef]
- Parlati, C.; Colombo, P.; Buttini, F.; Young, P.M.; Adi, H.; Ammit, A.J.; Traini, D. Pulmonary Spray Dried Powders of Tobramycin Containing Sodium Stearate to Improve Aerosolization Efficiency. Pharm. Res. 2009, 26, 1084–1092. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.J.; Owen, S.C. Hyaluronic Acid Binding to CD44S Is Indiscriminate of Molecular Weight. Biochim. Biophys. Acta BBA—Biomembr. 2020, 1862, 183348. [Google Scholar] [CrossRef] [PubMed]
- Steinert, A.F.; Ghivizzani, S.C.; Rethwilm, A.; Tuan, R.S.; Evans, C.H.; Nöth, U. Major Biological Obstacles for Persistent Cell-Based Regeneration of Articular Cartilage. Arthritis Res. Ther. 2007, 9, 213. [Google Scholar] [CrossRef] [PubMed]
- Medvedeva, E.V.; Grebenik, E.A.; Gornostaeva, S.N.; Telpuhov, V.I.; Lychagin, A.V.; Timashev, P.S.; Chagin, A.S. Repair of Damaged Articular Cartilage: Current Approaches and Future Directions. Int. J. Mol. Sci. 2018, 19, 2366. [Google Scholar] [CrossRef]
- Hubka, K.M.; Dahlin, R.L.; Meretoja, V.V.; Kasper, F.K.; Mikos, A.G. Enhancing Chondrogenic Phenotype for Cartilage Tissue Engineering: Monoculture and Coculture of Articular Chondrocytes and Mesenchymal Stem Cells. Tissue Eng. Part. B Rev. 2014, 20, 641–654. [Google Scholar] [CrossRef]
- Tan, H.; Wan, L.; Wu, J.; Gao, C. Microscale Control over Collagen Gradient on Poly(L-Lactide) Membrane Surface for Manipulating Chondrocyte Distribution. Colloids Surf. B Biointerfaces 2008, 67, 210–215. [Google Scholar] [CrossRef]
- Bhattacharya, D.S.; Svechkarev, D.; Souchek, J.J.; Hill, T.K.; Taylor, M.A.; Natarajan, A.; Mohs, A.M. Impact of Structurally Modifying Hyaluronic Acid on CD44 Interaction. J. Mater. Chem. B 2017, 5, 8183–8192. [Google Scholar] [CrossRef]
- De Angelis, E.; Cacchioli, A.; Ravanetti, F.; Bileti, R.; Cavalli, V.; Martelli, P.; Borghetti, P. Gene Expression Markers in Horse Articular Chondrocytes: Chondrogenic Differentiaton IN VITRO Depends on the Proliferative Potential and Ageing. Implication for Tissue Engineering of Cartilage. Res. Vet. Sci. 2020, 128, 107–117. [Google Scholar] [CrossRef]
- Charlier, E.; Deroyer, C.; Ciregia, F.; Malaise, O.; Neuville, S.; Plener, Z.; Malaise, M.; de Seny, D. Chondrocyte Dedifferentiation and Osteoarthritis (OA). Biochem. Pharmacol. 2019, 165, 49–65. [Google Scholar] [CrossRef]
- De Angelis, E.; Ravanetti, F.; Martelli, P.; Cacchioli, A.; Ivanovska, A.; Corradi, A.; Nasi, S.; Bianchera, A.; Passeri, B.; Canelli, E.; et al. The in Vitro Biocompatibility of D-(+) Raffinose Modified Chitosan: Two-Dimensional and Three-Dimensional Systems for Culturing of Horse Articular Chondrocytes. Res. Vet. Sci. 2017, 115, 310–317. [Google Scholar] [CrossRef]
- De Angelis, E.; Grolli, S.; Saleri, R.; Conti, V.; Andrani, M.; Berardi, M.; Cavalli, V.; Passeri, B.; Ravanetti, F.; Borghetti, P. Platelet Lysate Reduces the Chondrocyte Dedifferentiation during in Vitro Expansion: Implications for Cartilage Tissue Engineering. Res. Vet. Sci. 2020, 133, 98–105. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
MW of HA (kDa) | Before DPPC | After DPPC Addition | ||
---|---|---|---|---|
Size (nm) | ζ-Potential (mV) | Size (nm) | ζ-Potential (mV) | |
25 | 326 ± 38 | −21.6 ± 15.8 | 296 ± 21 | −20 ± 14 |
250 | 268 ± 48 | −11.5 ± 16.5 | 271 ± 15 | −12.1 ± 11.8 |
HA MW (kDa) | Before Drying (nm) | PBS (nm) | DMEM (nm) | DMEM + 10% FBS (nm) |
---|---|---|---|---|
25 | 228 ± 99 (0.171) | 229 ± 209 (0.424) | 225 ± 65 (0.323) | 291 ± 113 (0.606) |
250 | 271 ± 15 (0.388) | 327 ± 57 (0.495) | 138 ± 33 1081 ± 423 (0.725) | 119 ± 46 543 ± 227 (0.645) |
Gene | Primer Sequences | Primer Concentration (nM) |
---|---|---|
Gapdh | Fwd: CAAGGCTGTGGGCAAGGT | 300 |
Rev: GGAAGGCCATGCCAGTGA | 300 | |
Col1a1 | Fwd: AGAAGAAGACATCCCAGCAGTCA | 500 |
Rev: CAGGGCTCGGGTTTCCATA | 500 | |
Col2a1 | Fwd: CTGGTGATGATGGTGAAG | 300 |
Rev: GTAACCTCTGTGACCTTTG | 300 | |
Sox9 | Fwd: CAGGTGCTCAAGGGCTACGA | 300 |
Rev: GACGTGAGGCTTGTTCTTGCT | 300 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bianchera, A.; Borghetti, P.; Ravanetti, F.; Bertocchi, L.; De Angelis, E.; Bettini, R. Effect of Low-Molecular-Weight Hyaluronate-Based Nanoparticles on the In Vitro Expression of Cartilage Markers. Int. J. Mol. Sci. 2024, 25, 12486. https://doi.org/10.3390/ijms252312486
Bianchera A, Borghetti P, Ravanetti F, Bertocchi L, De Angelis E, Bettini R. Effect of Low-Molecular-Weight Hyaluronate-Based Nanoparticles on the In Vitro Expression of Cartilage Markers. International Journal of Molecular Sciences. 2024; 25(23):12486. https://doi.org/10.3390/ijms252312486
Chicago/Turabian StyleBianchera, Annalisa, Paolo Borghetti, Francesca Ravanetti, Laura Bertocchi, Elena De Angelis, and Ruggero Bettini. 2024. "Effect of Low-Molecular-Weight Hyaluronate-Based Nanoparticles on the In Vitro Expression of Cartilage Markers" International Journal of Molecular Sciences 25, no. 23: 12486. https://doi.org/10.3390/ijms252312486
APA StyleBianchera, A., Borghetti, P., Ravanetti, F., Bertocchi, L., De Angelis, E., & Bettini, R. (2024). Effect of Low-Molecular-Weight Hyaluronate-Based Nanoparticles on the In Vitro Expression of Cartilage Markers. International Journal of Molecular Sciences, 25(23), 12486. https://doi.org/10.3390/ijms252312486